conifer-rbcL-old

#NEXUS

BEGIN DATA;
    DIMENSIONS  NTAX=73 NCHAR=1502;
    FORMAT DATATYPE=DNA  MISSING=- GAP=#  INTERLEAVE ;
MATRIX

[                          10        20        30        40        50        60        70        80        90        100]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         ----------------------------------------------------------------------------------------------------   [100]
Callitris         ----------------------------------------------------------------------------------------------------   [100]
Cupressus         ----------------------------------------------------------------------------------------------------   [100]
Callitropsis      ----------------------------------------------------------------------------------------------------   [100]
Chamaecyp         ----------------------------------------------------------------------------------------------------   [100]
Calocedru         ----------------------------------------------------------------------------------------------------   [100]
Cryptomer         ---------------------------------------------------------------------------------------------------C   [100]
Cunninghamia      --------------------------------------------------------------------------ATGTCACCACAAACAGAGACTAAAGC   [100]
Diselma           ----------------------------------------------------------------------------------------------------   [100]
Fitzroya          ----------------------------------------------------------------------------------------------------   [100]
Fokienia          ----------------------------------------------------------------------------------------------------   [100]
Glyptostrobus     ----------------------------------------------------------------------------------------------------   [100]
Juniperus         ----------------------------------------------------------------------------------------------------   [100]
Libocedrus        --------------------------------------------------------------------------------------------ACTAAAAC   [100]
Pilgerodendron    --------------------------------------------------------------------------------------------ACTAAAAC   [100]
Metasequoia       ----------------------------------------------------------------------------GTCACCACAAACAGAGACTAAAGC   [100]
Microbiota        --------------------------------------------------------------------------------------------ACTAAAGC   [100]
Neocallitris      --------------------------------------------------------------------------------------------ACTAAAGC   [100]
Papuacedrus       ----------------------------------------------------------------------------------------------------   [100]
Platycladus       --------------------------------------------------------------------------------------------ACTAAAGN   [100]
Sequoia           ----------------------------------------------------------------------------------------------------   [100]
Sequoiadendron    ----------------------------------------------------------------------------------------------------   [100]
Taiwania          ----------------------------------------------------------------------------------------------------   [100]
Taxodium          ---------------------------------------------------------------------------TGTCACCACAAACAGAAACTAAAGC   [100]
Tetraclinis       --------------------------------------------------------------------------------------------ACTAAAGC   [100]
Thujopsis         --------------------------------------------------------------------------------------------ACTAAAGC   [100]
Thuja             ----------------------------------------------------------------------------------------------------   [100]
Actinostrobus     --------------------------------------------------------------------------------------------ACTAAAGC   [100]
Widdringtonia     ----------------------------------------------------------------------------------------------------   [100]
Austrocedrus      ----------------------------------------------------------------------------------------------------   [100]
Xanthocyparis     ----------------------------------------------------------------------------------------------------   [100]
Agathis           ----------------------------------------------------------------------------------------------------   [100]
Araucaria         ----------------------------------------------------------------------------------------------------   [100]
Wollemia          -------------------------------------------------------------------------------------------AACTAAAAC   [100]
Torreya           ----------------------------------------------------------------------------------------------------   [100]
Taxus             ----------------------------------------------------------------------------------------------------   [100]
Amentotaxus       ----------------------------------------------------------------------------------------------------   [100]
Pseudotaxus       ----------------------------------------------------------------------------------------------------   [100]
Austrotaxus       ----------------------------------------------------------------------------------------------------   [100]
Cephalotaxus      ----------------------------------------------------------------------------------------------------   [100]
Sciadopitys       ----------------------------------------------------------------------------------------------------   [100]
Pinus             ----------------------------------------------------------------------------------------------------   [100]
Picea             --------------------------------------------GAGAGATAATTATTAATAAAGGAGGGACTTATGTCACCAAAAACAGAGACTAAAGC   [100]
Cathaya           -----------------------------------------------------------------------------------------------AAAGC   [100]
Larix             -----------------------------------------------------------------------------------------------AAAGC   [100]
Abies             GTTGACGTTTGATCCATGTCGAGCAGACCTCGTCCTTGCGATAAATCATTATTAATAAAGGAGGGACTTGACTTATGTCACCAAAAACAGAAACTAAAGC   [100]
Pseudotsuga       ----------------------------------------------------------------------------------------------------   [100]
Tsuga             --------------------------------------------------------TTAATTGAGGAGGGACTTATGTCACCAAAAACAGAAACTAAGGC   [100]
Nothotsuga        ----------------------------------------------------------------------------------------------------   [100]
Cedrus            -----------------------------TCGTTCTTGCAAGAAATAATTATTAATAAAGGAGGGAC-----TTATGTCACCAAAAACAGAGACTAAAGC   [100]
Pseudolarix       -----------------------------------------------------------------------------------------------AAAGC   [100]
Keteleeria        -----------------------------------------------------------------------------------------------AAAGC   [100]
Phyllocladus      ----------------------------------------------------------------------------------------------------   [100]
Lagarostrobos     ----------------------------------------------------------------------------------------------------   [100]
Prumnopitys       ----------------------------------------------------------------------------------------------TGAAGC   [100]
Dacrydium         ----------------------------------------------------------------------------------------------TAAAGC   [100]
Dacrycarpus       ----------------------------------------------------------------------------------------------------   [100]
Podocarpus        ----------------------------------------------------------------------------------------------------   [100]
Nageia            --------------------------------------------------------------------------------------------------GC   [100]
Microstrobos      ----------------------------------------------------------------------------------------------------   [100]
Microcachrys      ----------------------------------------------------------------------------------------------------   [100]
Saxegothaea       ----------------------------------------------------------------------------------------------------   [100]
Acmopyle          ----------------------------------------------------------------------------------------------------   [100]
Falcatifolium     ----------------------------------------------------------------------------------------------------   [100]
Manoao            -----------------------------------------------------------------------------------CAAACAGAAACTAAAGC   [100]
Lepidothamnus     ----------------------------------------------------------------------------------------------------   [100]
Halocarpus        ----------------------------------------------------------------------------------------------------   [100]
Afrocarpus        ----------------------------------------------------------------------------------------------------   [100]
Retrophyllum      ----------------------------------------------------------------------------------------------TAAAGC   [100]
Sundacarpus       ----------------------------------------------------------------------------------------------------   [100]
Parasitaxus       ----------------------------------------------------------------------------------------------------   [100]
Cycas             ----------------------------------------------------------------------------------------------------   [100]
Ginkgo            --------------------------------------------------------------------------ATGTCACCAAAAACAGAGACTAAAGC   [100]

[                          110       120       130       140       150       160       170       180       190       200]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         ----GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGACTATCAGGTAAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Callitris         ---------------------------AGATTACAGATTAACTTATTATACTCCCGAATATCCGACCAAAGATACTGATATCTTAGCAGCCTTCCGCGTC   [200]
Cupressus         ----------TTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Callitropsis      ----------------------------GATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Chamaecyp         ------------------------------------ATTAACTTATTATACTCCGGAATATCAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Calocedru         ------------------------------------ATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Cryptomer         AAGTGTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTAGCAGCATTCCGAGTC   [200]
Cunninghamia      AAGTGTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Diselma           ---------------------TGTTAAAGATTATAGTTTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Fitzroya          ---------------------TGTTAAAGATTATAGTTTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Fokienia          ----------------------------------------------------------------------------------------------------   [200]
Glyptostrobus     ----GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTAGCAGCATTCCGAGTC   [200]
Juniperus         ------------------------------------ATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Libocedrus        AAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Pilgerodendron    AAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Metasequoia       AAGTGTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATGCAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Microbiota        AAGTGTCGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Neocallitris      AAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCCGAATATCCGACCAAAGATACTGATATCTTAGCAGCCTTCCGCGTC   [200]
Papuacedrus       ---------------------TGTTAAAGATTATAGTTTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Platycladus       AAGTGTCNGATTCAAAGCGGGTGTTAAAGGTTACAGATTAAATTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Sequoia           ----GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATGTGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Sequoiadendron    --------GATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATGTGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Taiwania          ----GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGGGTC   [200]
Taxodium          AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTACTACACCCCGGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTA   [200]
Tetraclinis       AAGTGTCGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Thujopsis         AAGTGTCGGATTCAAAGCGGGTGTTAAAGNTTACAGATTAACTTNNTATACTCCGGAGTATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Thuja             ------------------------------TTACAGATTAACTTATTATACTCCGGAGTATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGGGTC   [200]
Actinostrobus     AAGTGTCGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Widdringtonia     -----------------------------------GATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Austrocedrus      -----------------------------------GATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Xanthocyparis     ------------------------------------ATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Agathis           -GGTGTTGGATTTAAAGCTGGTGTTAAAGATTATAGATTAACTTATTATACTCCGGAATATCAGACCAAAGACACTGATATCTTGGCAGCATTCCGAGTT   [200]
Araucaria         AGGTGTTGGATTTAAAGCTGGTGTTAAAGATTATAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTC   [200]
Wollemia          AGGTGTTGGATTTAAAGCTGGTGTTAAAGATTATAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Torreya           ----GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGACTATGATACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Taxus             AAGTGTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCACAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Amentotaxus       ----GTTGGCTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCAGAATATAAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Pseudotaxus       ANGTGTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Austrotaxus       ----GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCCGCCCAAAGACACTGATATCTTGGCAGCATTCCGAGTC   [200]
Cephalotaxus      AAGTGTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATAAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTA   [200]
Sciadopitys       ----GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACCCCTGAATATCAGACCAAAGACACTGATATCTTGGCAGCATTCCGAGTC   [200]
Pinus             TAGTGTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAGGATACAGATATCTTGGCAGCATTCCGAGTA   [200]
Picea             TAGTGTCGGATTTAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATTTTGGCAGCATTCCGAGTA   [200]
Cathaya           TAGTGTCGGATTCAAGGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTA   [200]
Larix             TAGTGTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTA   [200]
Abies             TAGTGTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCGGCATTCCGAGTA   [200]
Pseudotsuga       ----GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTA   [200]
Tsuga             TAGCGTAGGGTTCAAAGCTGGTGTTAAGGATTATAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTA   [200]
Nothotsuga        ----------------GCTGGTGTTAAGGATTATAGACTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTA   [200]
Cedrus            TAGTGTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTA   [200]
Pseudolarix       TAGTGTCGGATTCAAAGCTGGTGTTAAAGATTACCGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTA   [200]
Keteleeria        TAGTGTCGGATTCAAAGCTGGTGTTAAAGATTATAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCGGCATTCCGAGTA   [200]
Phyllocladus      AAGTGCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCGGCATTCCGAGTC   [200]
Lagarostrobos     ----GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGACTATCAGGTCGCAGATACTGATATCTTGGCGGCATTCCGAGTC   [200]
Prumnopitys       AAGTGTTGGGTTCAAAGCTGGTGTTAAAGACTACAGATTAACTTATTATACTCCGGAATATCAGTCCCAAGATACTGATATCTTGGCGGCATTCCGAGTC   [200]
Dacrydium         AAGTGCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGACACAGATATCTTGGCGGCATTCCGAGTC   [200]
Dacrycarpus       ----GTTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCCAAGATACTGATATCTTGGCGGCATTCCGAGTC   [200]
Podocarpus        -------GGGTTCAAGGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Nageia            AAGTGCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTC   [200]
Microstrobos      AAGTGTTGGGTTCAAAGCTGGTGTTAAAGGTTACAGATTAACTTATTATACTCCGGTATATCAGTCCAAAGGTACTGATATCTTGGCGGCATTCCGAGTC   [200]
Microcachrys      ----GTTGGGTGCCAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCGGCATTCCGAGTC   [200]
Saxegothaea       ----GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGCCCAAAGATACTGATATCTTGGCGGCATTCCGAGTC   [200]
Acmopyle          --------------AATCTGGCGTTAAAGATTACAKATTAACTTATTATACTCCTGAATATGCGGTCAAAGACACTGATATCTTGGCGGCATTCSGAGTC   [200]
Falcatifolium     ----------TTCAAAGCTGGTGTGCCAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGACACCGATATCTTGGCGGCATTCCGAGTC   [200]
Manoao            AAGTGTTGGGTTCAAAGCTGGTGTTAAAGRTTACAGATTAACTTATTATACTCCTGACTATCAGGTCGCAGGTACTGATATCTTGGCAGCATTCSGAGTC   [200]
Lepidothamnus     -AGTGTCGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCCGACCAAAGATACTGATATCTTAGCGGCATTCCGAGTC   [200]
Halocarpus        --GTGTAGGGTTCAAAGCTGGTGTTAAAGGTTACAGGTTAACTTATTATACTCCGGTATATCAGACCAAAGATACTGATATCTTGGCGGCATTCCGAGTC   [200]
Afrocarpus        ----GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCCGACCAAAGATACTGATATCTTGGCGGCATTCCGAGTC   [200]
Retrophyllum      TAGTGCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATGTCTTGGCGGCATTCCGAGTC   [200]
Sundacarpus       -----------TCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGACTATCAGACCCCCGATACTGATATCTTGGCGGCATTCCGAGTC   [200]
Parasitaxus       -------GGCTACAAAGCTGGTGTTAAAGGTTACAGAGTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCGGCATTCCGAGTC   [200]
Cycas             AAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTAACTTATTACACTCCTGAATATCAAACCAAAGATACCGATATCTTAGCAGCGTTCCGAGTA   [200]
Ginkgo            AAGTGTCGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGAATATCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTA   [200]

[                          210       220       230       240       250       260       270       280       290       300]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         ACTCCTCAACCTGGAGTACCCCCCGAAGAAGCGGGANNNGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Callitris         ACTCCCCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCGGCCGAGTCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Cupressus         ACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCGGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGCCTTACCA   [300]
Callitropsis      ACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCGGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGTCTTACCA   [300]
Chamaecyp         ACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGGGCAGCAGTAGCTGCTGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Calocedru         ACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Cryptomer         ACTCCTCAACCTGGAGTACCCCCCGAAGAAGCGGGAGCAGCAGTAGCCGCCGAATCTTCCACTGGTACGTGGACGACTGTTTGGACCGATGGACTTACCA   [300]
Cunninghamia      ACTCCTCAACCCGGAGTACCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Diselma           ACTCCTCAACCTGGGGTGCCCCCCGAAGAAGCGGGAGCNGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Fitzroya          ACTCCTCAACCTGGGGTGCCCCCCGAAGAAGCGGGAGCNGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Fokienia          ----------------------------------------------------------------------------------------------------   [300]
Glyptostrobus     ACTCCTCAACCTGGAGTACCCCCCGAAGAAGCGGGANNNGCAGTAGCCGCCGAATCTTCCACTGGTACGTGGACGACTGTTTGGACCGATGGACTTACCA   [300]
Juniperus         ACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCGGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGCCTTACCA   [300]
Libocedrus        ACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCAGGAGCAGCAGTAGCTGCCGAATCGTCCACTGGTACGTGGACGACTGTTTGGACCGATGGACTTACTA   [300]
Pilgerodendron    ACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCAGGAGCAGCAGTAGCTGCCGAATCGTCCACTGGTACGTGGACGACTGTTTGGACCGATGGACTTACTA   [300]
Metasequoia       ACTCCGCAGCCTGGAGTACCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCGACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Microbiota        ACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Neocallitris      ACTCCCCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGCAGCGGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Papuacedrus       ACTCCTCAACCTGGGGTGCCCCCCGAAGAAGCGGGAGCNGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Platycladus       ACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGACGGACTTACCA   [300]
Sequoia           ACTCCTCAACCTGGAGTACCCCCCGAAGAAGCGGGANNNGCAGTAGCTGCCGAATCTTCGACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Sequoiadendron    ACTCCTCACCTNGGAGTACCCCCCNNNNNNCGGGAAGCAGCAGTAGCTGCCGAATCTTCGACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Taiwania          ACTCCCCAACCCGGAGTACCCCCCGAAGAAGCGGGACAGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACTA   [300]
Taxodium          ACTCCTCAGCCTGGAGTTCCGCCTGAAGAAGCAGGAGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTTTGGACCGATGGACTTACCA   [300]
Tetraclinis       ACTCCTCAACCTGGAGTGCCCTTCGAAGAAGCAGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Thujopsis         ACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Thuja             ACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Actinostrobus     ACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Widdringtonia     ACTCCTCAACCTGGGGTGCCCCCCGAAGAAGCGGGAGCAGCTGTAGCTGCCGAATCCTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Austrocedrus      ACTCCTCAACCTGGGGTGCCCCCCGAAGAAGCGGGAGCAGCTGTAGCTGCCGAATCCTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Xanthocyparis     ACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCGGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGCCTTACCA   [300]
Agathis           ACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCAGCAGTAGCGGCTGAATCTTCCACCGGTACATGGACAACTGTTTGGACCGATGGACTTACCA   [300]
Araucaria         ACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCAGCAGTAGCGGCTGAATCTTCTACCGGTACATGGACAACTGTTTGGACCGATGGACTTACCA   [300]
Wollemia          ACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCAGCAGTAGCGGCTGAATCTTCCACCGGTACATGGACAACTGTTTGGACCGATGGACTTACCA   [300]
Torreya           ACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Taxus             ACTCCTCAACCGGGAGTGCCCCCCGAGGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Amentotaxus       ACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Pseudotaxus       ACTCCTCAACCAGGAGTGCCTCCCGAGGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Austrotaxus       ACTCCTCAACCGGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Cephalotaxus      ACTCCTCAACCTGGAGTGCCCCCTGAGGAAGCAGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACGA   [300]
Sciadopitys       ACTCCTCAACCCGGAGTGCCTCCTGAGGAGGCAGGANNNGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTCACCA   [300]
Pinus             ACTCCTCAACCCGGGGTGCCACCTGAAGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTA   [300]
Picea             ACTCCTCAACCAGGGGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTA   [300]
Cathaya           ACTCCTCAACCCGGGGTGCCGCCCGAAGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTA   [300]
Larix             ACTCCTCAACCTGGGGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTA   [300]
Abies             ACTCCTCAACCTGGGGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Pseudotsuga       ACTCCTCAACCTGGGGTGCCACCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTA   [300]
Tsuga             ACTCCTCAACCCGGAGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCGTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Nothotsuga        ACTCCTCAACCCGGAGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCGTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Cedrus            ACTCCTCAACCTGGGGTGCCACCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTA   [300]
Pseudolarix       ACTCCTCAACCCGGGGTGCCACCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Keteleeria        ACCCCTCAACCTGGGGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Phyllocladus      ACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGGCTCACCA   [300]
Lagarostrobos     ACTCCTCAACCTGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTCACCA   [300]
Prumnopitys       ACTCCTCAACCSGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCA   [300]
Dacrydium         ACTCCTCAACCCGGAGTACCTCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCA   [300]
Dacrycarpus       ACTCCTCAACCCGGAGTTCCTTCCGAGGAAGCAGGAGCGGCAGTAGCTTCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGGCTTACCA   [300]
Podocarpus        ACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCA   [300]
Nageia            ACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAAGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACTTGGACTACTGTTTGGACCGATGGGCTTACCA   [300]
Microstrobos      ACTCCTCAACCCGGAGTGCCCCCCGAGGTAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCA   [300]
Microcachrys      ACTCCTCAACCCGGAGTGCCCCCCGAGGTAGCAGGAGCGGCAGTATCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGGCTTACCA   [300]
Saxegothaea       ACTGCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGACGGACTTACCA   [300]
Acmopyle          ACWCCTCAACCCGGTGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACCGGTACATGGACTACTGTTTGGACCGATGGACTTACCA   [300]
Falcatifolium     ACTCCTCAACCCGGAGTACCTCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCA   [300]
Manoao            ACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGGCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTYACCA   [300]
Lepidothamnus     ACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCTGTAGCTGCCGAATCTTCTACTGGTACATGGACTACTGTTTGGACCGATGGACTCACCA   [300]
Halocarpus        ACTCCTCAACCTGGTGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGTCCGATGGCCTCACCA   [300]
Afrocarpus        ACTCCTCAACCTGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGGCTTACCA   [300]
Retrophyllum      ACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCA   [300]
Sundacarpus       ACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTATCCGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTCACCA   [300]
Parasitaxus       ACTCCTCAACCTGGTGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGACGGCCTCACCA   [300]
Cycas             ACTCCTCAACCTGGAGTGCCGCCTGAGGAAGCGGGAGCTGCAGTAGCCGCTGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]
Ginkgo            ACTCCTCAACCTGGAGTGCCACCTGAGGAAGCGGGAGCTGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCA   [300]

[                          310       320       330       340       350       360       370       380       390       400]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         GTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Callitris         GTCTCGATCGTTACAAGGGGCGATGTTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCTTATGTAGCCTATCCTTTAGATCTTTTTGA   [400]
Cupressus         GTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTTGA   [400]
Callitropsis      GTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTTGA   [400]
Chamaecyp         GTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Calocedru         GTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Cryptomer         GTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTGGCTTACCCTTTAGATCTTTTTGA   [400]
Cunninghamia      GTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Diselma           GTCTTGATCGGTACAAGGGGCGATGCTATGATATCGAACCCGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Fitzroya          GTCTTGATCGGTACAAGGGGCGATGCTATGATATCGAACCCGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Fokienia          ----------------------------------------------------------------------------------------------------   [400]
Glyptostrobus     GTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTGCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Juniperus         GTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTTGA   [400]
Libocedrus        GTCTTGATCGTTACAAGGGACGATGCTATGATATTGAACCGATTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Pilgerodendron    GTCTTGATCGTTACAAGGGACGATGCTATGATATTGAACCGATTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Metasequoia       GTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCCTTAGATCTTTTTGA   [400]
Microbiota        GTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Neocallitris      GTCTCGATCGTTACAAGGGGCGATGTTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGTTTATGTAGCCTATCCTTTAGATCTTTTTGA   [400]
Papuacedrus       GTCTTGATCGGTACAAGGGGCGATGCTATGATATCGAACCCGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Platycladus       GTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Sequoia           GTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCCTTAGATCTTTTTGA   [400]
Sequoiadendron    GTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTATCCCTTAGATCTTTTTGA   [400]
Taiwania          GTCTTGATCGTTATAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Taxodium          GTCTTGATCGTTACAAAGGACGATGCTATGATATTGAACCCCTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Tetraclinis       GTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTGCTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Thujopsis         GTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Thuja             GTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTGGA   [400]
Actinostrobus     GTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Widdringtonia     GTCTTGATCGGTACAAGGGGCGATGCTATGATATCGAACCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Austrocedrus      GTCTTGATCGGTACAAGGGGCGATGCTATGATATCGAACCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Xanthocyparis     GTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTTGA   [400]
Agathis           GTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTTGA   [400]
Araucaria         GTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTTGA   [400]
Wollemia          GTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTTGA   [400]
Torreya           GTCTTGATCGTTACAAGGGACGATGCTATGATATCGAGCCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Taxus             GTCTTGATCGTTACAAGGGACGATGCTATGATATCGAACCCGTTGCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGATCTTTTTGA   [400]
Amentotaxus       GTCTTGATCGTTACAAGGGACGATGCTATGATATTGAGCCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGA   [400]
Pseudotaxus       GTCTTGATCGTTACAAGGGACGATGTTATGATATCGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTCGA   [400]
Austrotaxus       GTCTTGATCGTTACAAAGGACGATGTTATGATATCGAACCCGTTCCTGGAGAGGAAAATCAATATATTGCCTATGTAGCTTACCCATTAGATCTTTTCGA   [400]
Cephalotaxus      GTCTTGATCGTTACAAGGGACGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGATCTTTTTGA   [400]
Sciadopitys       GTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTATCCCTTAGATCTTTTTGA   [400]
Pinus             GTCTCGATCGTTACAAGGGGCGATGCTATGATATCGAGCCCGTTCCTGGAGAGGAGACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGA   [400]
Picea             GTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGA   [400]
Cathaya           GTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAGGAGAGTCAATTTATTGCCTATGTGGCTTACCCTTTAGACCTTTTCGA   [400]
Larix             GTCTTGATCGTTACAAGGGACGATGCTATGACATCGAGGCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGA   [400]
Abies             GTCTTGATCGTTACAAAGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGA   [400]
Pseudotsuga       GTCTTGATCGTTACAAGGGACGATGCTATGACATCGAGGCCGTTCCTGGAGAGGAGAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGA   [400]
Tsuga             GTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAACCCGTTCCTGGAGAAGAGAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGA   [400]
Nothotsuga        GTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAACCCGTTCCTGGAGAAGAGAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGA   [400]
Cedrus            GTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAGGAGAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGA   [400]
Pseudolarix       GTCTTGATCGTTACAAGGGGCGATGCTATGACATTGAGCCCGTTCCTGGAGAGGAGAGCCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGA   [400]
Keteleeria        GTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGA   [400]
Phyllocladus      GCCTTGATCGTTACAAGGGGCGATGTTATGACATCGAGCCTGTTCCTGGAGAGGAAAATCAATATATTGTCTATGTAGCTTACCCCTTAGACCTTTTTGA   [400]
Lagarostrobos     GCCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAAGTCAATATATTGTCTATGTAGCTTATCCCTTAGACCTTTTTGA   [400]
Prumnopitys       GCCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAAATCAATATATTGTCTATGTAGCTTAMCCCTTAGACCTTTTTGA   [400]
Dacrydium         GTCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTATCCCTTAGACCTTTTTGA   [400]
Dacrycarpus       GCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAACTCAATTTATTGTCTATGTGGCTTATCCCTTAGACCTTGGTGA   [400]
Podocarpus        GCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAAATCAATATATTGTCTATGTAGCTTATCCCTTAGACCTTTTTGA   [400]
Nageia            GCCTCGATCGTTACAAGGGGCGATGCTATGGCATCGAGCCTATTCCTGGAGAGGAGAGTCAATTTATTGCCTATGTAGCTTATCCCTTAGACCTTTTTGA   [400]
Microstrobos      GCCTTGATCGTTATAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTATCCCTTAGACCTTTTTGA   [400]
Microcachrys      GCCTTGATCGTTACAAAGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACCCAATATATTGCCTATGTAGCTTATCCCTTAGACCTTTTTGA   [400]
Saxegothaea       GTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAAGTCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGA   [400]
Acmopyle          GCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTATCCCYTAGACCTTTTTGA   [400]
Falcatifolium     GTCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAACTCAATTTATTGTCTATGTAGCTTATCCCTTAGACCTTTTTGA   [400]
Manoao            GCCTTGATCGTTACAAGGGGMGATGCTATSACATCGAGCCTGTTCCTGGAGAGGAAAATCAATATATTGACTATGTAGCTTACCCCTTGGACCTTTTTGA   [400]
Lepidothamnus     GCCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAAGAAAATCAATATATTGTCTATGTAGCTTACCCCTTAGACCTTTTTGA   [400]
Halocarpus        GCCTTGATCGTTACAAGGGGCGATGCTATGACATTGAGCCTGTTCCTGGAGTGGAAAATCAATTTATTGCCTATGTAGCTTACCCCCTAGACCTTTTTGA   [400]
Afrocarpus        GCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAAATCAATATATTGTCTATGTAGCTTATCCCTTAGACCTTTTKGA   [400]
Retrophyllum      GCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAAATCAATTTATTGTCTATGTAGCTTATCCCTTAGACCTTTTTGA   [400]
Sundacarpus       GCCTTGATCGTTACAAGGGGCGATGCTACGACATCGAGCCTGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTTGA   [400]
Parasitaxus       GCCTTGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCCCTAGACCTTTTTGA   [400]
Cycas             GTCTCGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGGGAGAAAAATCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTCTTTGA   [400]
Ginkgo            GTCTTGATCGTTACAAGGGAAGATGCTATGACATCGAGCCCGTTCCTGGGGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTGGATCTTTTCGA   [400]

[                          410       420       430       440       450       460       470       480       490       500]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         AGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCT   [500]
Callitris         AGAAGGCTCTGTTACTAACCTTTTTACTTCTATTGTCGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCT   [500]
Cupressus         AGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Callitropsis      AGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Chamaecyp         AGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Calocedru         AGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAACGTATTTGGATTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCT   [500]
Cryptomer         AGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGGATTCCTCCT   [500]
Cunninghamia      AGAAGGTTCTGTTACTAACATGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCT   [500]
Diselma           AGAAGGCTCTGTTACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCT   [500]
Fitzroya          AGAAGGCTCTGTTACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCT   [500]
Fokienia          --------------------------CTTCTATTGTAGGTATTGTATTTGGATTCAAAGCTTTNCGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Glyptostrobus     AGAAGGTTCTGTTACTAACCTGTTGACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Juniperus         AGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Libocedrus        AGAAGGCTCTGTTACTAACCTGTTTACTTCTATNGTAGGTAANGTATTTGGATTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCT   [500]
Pilgerodendron    AGAAGGCTCTGTTACTAACCTGTTTACTTCTATNGTAGGTAANGTATTTGGATTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCT   [500]
Metasequoia       AGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGCTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Microbiota        AGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Neocallitris      AGAAGGCTCTGTTACTAACCTTTTTACTTCTATTGTCGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCT   [500]
Papuacedrus       AGAAGGCTCTGTTACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCT   [500]
Platycladus       AGAGGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Sequoia           AGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Sequoiadendron    AGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Taiwania          AGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Taxodium          AGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCT   [500]
Tetraclinis       AGAAGGCTCTGTGACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Thujopsis         AGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Thuja             AGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Actinostrobus     AGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Widdringtonia     AGAAGGCTCTGTTACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCT   [500]
Austrocedrus      AGAAGGCTCTGTTACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCT   [500]
Xanthocyparis     AGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCT   [500]
Agathis           AGAAGGTTCTGTTACCAACCTGTTCACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCT   [500]
Araucaria         AGAAGGTTCTGTTACCAACCTGTTCACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Wollemia          AGAAGGTTCTGTTACCAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCT   [500]
Torreya           AGAAGGTTCTGTGACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Taxus             AGAAGGTTCTGTGACTAACCTGTTCACTTCCATTGTAGGTAATGTCTTTGGATTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTACGAATTCCTCCT   [500]
Amentotaxus       AGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Pseudotaxus       AGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAACGTATTTGGATTTAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Austrotaxus       AGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCTCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Cephalotaxus      AGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Sciadopitys       GGAAGGTTCTGTTACTAACATGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Pinus             AGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCT   [500]
Picea             AGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCT   [500]
Cathaya           AGAAGGCTCTGTTACTAATTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCT   [500]
Larix             AGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATCCCCCCT   [500]
Abies             AGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCT   [500]
Pseudotsuga       AGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATCCCCCCT   [500]
Tsuga             AGAAGGTTCTGTTACTAACTTATTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCT   [500]
Nothotsuga        AGAAGGTTCTGTTACTAACTTATTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGAGCTCTACGTTTGGAAGATTTGCGGATTCCCCCT   [500]
Cedrus            AGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCT   [500]
Pseudolarix       AGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCT   [500]
Keteleeria        AGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCT   [500]
Phyllocladus      AGAAGGTTCTGTTACTAACCTATTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Lagarostrobos     AGAAGGTTCTGTTACTAACTTGTTCACTTCGATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCT   [500]
Prumnopitys       AGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTTTGGAAGATCTGCGAATTCCTCCT   [500]
Dacrydium         AGAAGGTTCTGTTACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Dacrycarpus       AGAAGGTTCTGTTACTAACCTGTACACCTCTATTGTAGGTAATGTGGTTGGATACAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Podocarpus        AGAAGGTTCTGTTACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGGGCTCTACGTCTAGAAGATCTGCGAATTCCTCCT   [500]
Nageia            AGAAGGTTCTGTTACTAACATGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Microstrobos      AGAAGGCTCTGTTACTAATCTGTTCACTTCCATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Microcachrys      AGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCC   [500]
Saxegothaea       AGAAGGCTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Acmopyle          AGAAGGTTCTGTTACTAACCTGTTCACCTCAATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAARATCTGCGAATTCCTCCT   [500]
Falcatifolium     AGAAGGTTCTGTTACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Manoao            AGAAGGTTCTGTTACTAATTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTMTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Lepidothamnus     AGAAGGTTCTGTGACTAACCTGTTCACTTCTATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Halocarpus        AGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTTATTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Afrocarpus        AGAAGGTTCTGTTACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Retrophyllum      AGAAGGTTCTGTCACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Sundacarpus       AGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Parasitaxus       AGAAAGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTGTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]
Cycas             AGAAGGTTCTGTTACTAACATGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGAGCTCTACGCCTAGAAGATTTGCGAGTTCCTCCT   [500]
Ginkgo            GGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGGAATGTATTTGGATTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCT   [500]

[                          510       520       530       540       550       560       570       580       590       600]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         GCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATTCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAAC   [600]
Callitris         TCTTATTCAAAAACTTTTCAAGGACCCCCACACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTAGGATGTACTATCAAAC   [600]
Cupressus         GCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAAC   [600]
Callitropsis      GCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAAC   [600]
Chamaecyp         GCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Calocedru         TCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Cryptomer         GCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATAAAAC   [600]
Cunninghamia      GCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Diselma           GCTTATTCAAAAGCTTTTCAAGGACCACCACACGNNATNCANGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Fitzroya          GCTTATTCAAAAGCTTTTCAAGGACCACCACACGNNATNCANGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Fokienia          TCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Glyptostrobus     GCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATAAAAC   [600]
Juniperus         GCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAAC   [600]
Libocedrus        GCTTATTCAAAAACTTTTCAAGGACCACCGCACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Pilgerodendron    GCTTATTCAAAAACTTTTCAAGGACCACCGCACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Metasequoia       GCTTATTCAAAAACTTTCCAAGGACCACCACATGGTATTCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Microbiota        GCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Neocallitris      TCTTATTCAAAAACTTTTCAAGGACCCCCACACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTAGGATGTACTATCAAAC   [600]
Papuacedrus       GCTTATTCAAAAGCTTTTCAAGGACCACCACACGNNATNCANGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Platycladus       GCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGGGATAAATTAAATAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Sequoia           GCTTATTCAAAAACTTTCCAAGGACCACCACATGGTATTCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Sequoiadendron    GCTTATTCAAAAACTTTCCAAGGACCACCACATGGTATTCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Taiwania          GCTTATTCAAAAACTTTCCAAGGTCCACCACATGGTATTCAAGTGGAAAGAGACAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Taxodium          GCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAGTATGGTCGTCCTTTGTTGGGATGTACTATAAAAC   [600]
Tetraclinis       GCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Thujopsis         GCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGCTGTACTATCAAAC   [600]
Thuja             GCTTATTCAAAAACTTTNCAAGGNCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATAAAAC   [600]
Actinostrobus     GCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Widdringtonia     GCTTATTCAAAAACTTTTCAAGGACCACCACACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Austrocedrus      GCTTATTCAAAAACTTTTCAAGGACCACCACACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Xanthocyparis     GCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAAC   [600]
Agathis           GCTTATTCCAAAACTTTCCAGGGTCCACCCCATGGTATTCAAGTTGAAAGAGATAAATTAAACAAATATGGCCGTCCCTTGTTGGGGTGTACTATCAAAC   [600]
Araucaria         GCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATTCAAGTTGAAAGAGATAAATTAAACAAATATGGCCGTCCCTTGTTGGGGTGTACTATAAAAC   [600]
Wollemia          GCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATTCAAGTTGAAAGAGATAAATTAAACAAATATGGCCGTCCCTTGTTGGGGTGTACTATCAAAC   [600]
Torreya           GCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCATTGTTGGGATGTACTATCAAAC   [600]
Taxus             GCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGCTGGGATGTACTATAAAAC   [600]
Amentotaxus       GCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGACAAATTAAACAAATATGGTCGTTCTTTGTTGGGATGTACTATCAAAC   [600]
Pseudotaxus       GCTTATTCAAAAACCTTCCAAGGACCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGCTGGGATGTACTATCAAAC   [600]
Austrotaxus       GCTTATTCAAAAACTTTCCAAGGTCCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Cephalotaxus      GCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGATAAACTAAATAAATATGGTCGTCCTTTGTTGGGATGTACAATCAAAC   [600]
Sciadopitys       GCTTATTCAAAAACTTTCCAAGGTCCGCCCCATGGTATCCAAGTTGAAAGAGATAAATTAAACAAATATGGTCGCCCTTTATTGGGGTGTACTATCAAAC   [600]
Pinus             GCTTATTCCAAAACTTTTCAGGGTCCACCTCATGGTATCCAGGTTGAAAGAGATAAATTGAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAAC   [600]
Picea             GCTTATTCCAAAACATTTCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCTTTATTGGGATGTACTATCAAAC   [600]
Cathaya           GCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGACGTCCTTTATTGGGATGTACTATCAAAC   [600]
Larix             GCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTATCCAAGTCGAAAGGGATAAATTGAACAAATATGGCCGTCCTTTATTGGGATGTACTATCAAAC   [600]
Abies             GCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Pseudotsuga       GCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTATCCAAGTTGAAAGGGATAAATTGAACAAATATGGCCGTCCTTTATTGGGATGTACTATCAAAC   [600]
Tsuga             GCTTATTCCAAAACTTTTCAAGGTCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATACGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Nothotsuga        GCTTATTCCAAAACTTTTCAAGGTCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Cedrus            GCTTATTCCAAAACATTTCAAGGTCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Pseudolarix       GCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Keteleeria        GCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTACTCAAGTTGAAAGAGATAAATTGAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Phyllocladus      GCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAAGTTGAAAGAGATAAATTAAATAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Lagarostrobos     GCTTATTCCAATACTTTCCAAGGCCCACCCCATGGTATCCAGGTTGAAAGAGATAAATTAAATAAATATGGCCGTCCCTTGTTGGGATGTACCATCAAAC   [600]
Prumnopitys       GCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCARGTWGAAAGAGATAAATTAAATAAATATGGCCGTCCCTTGTTGGGATGTACTATCAAAC   [600]
Dacrydium         GCTTATTCCAAAACTTTCCAAGGTCCACCACATGGTATCCAGGTTGAAAGAGATAAATTAAATAAATATGGCCGCCCCCTATTGGGATGTACTATCAAAC   [600]
Dacrycarpus       GCTTATTCCAAGACTTTCCAGGGCCCACCCCATGGTATCCAGGTGGGAAGAGATAGATTAAATAAATATGGTCGCCCCCTATTGGGATGCACTATCAAAC   [600]
Podocarpus        GCTTATTCCAAAACTTTCCAAGGTCCACCACATGGTATCCAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCTTATTGGGATGTACCATCAAAC   [600]
Nageia            GCTTATTCCAAAACTTCCCAAGGTCCACCACATGGTATCCAGGTTGAAAGAGATAACTTAAATAAATATGGCCGCCCCTTATTGGGATGTACCATCAAAC   [600]
Microstrobos      GCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCTTTATTGGGATGTACTAACAAAC   [600]
Microcachrys      GCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAAGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCTTATTGGGATGTACTATAAAAC   [600]
Saxegothaea       GCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAAGTCGAAAGAGATAAATTAAATAAATACGGCCGTCCTTTGCTGGGATGTACTATCAAAC   [600]
Acmopyle          GCTTATTCCAAAACTTTCCAAGGTCCGCCGCATGGTATCCAGTTTGAAAGAGATAAATTAAATWAATATGGCCGCCCCTTATTGGGATGTACTATCMAAC   [600]
Falcatifolium     GCTTATTCCAAAACTTTCCAAGGTCCACCACATGGTATCCAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCCTATTGGGATGTACTATCAAAC   [600]
Manoao            GCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAGTTTGAAAGAGATAAATTAAATAAATATGTCCTCCCCTTGTTGGGATGTACTATTAAAC   [600]
Lepidothamnus     GCTTATTCCAAAACTTTCCAAGGTCCACCTCATGGTATCCAGTTTGAAAGAGATAAATTAAATAAATACGGCCGCCCCTTGTTGGGTTGTACCATCAAAC   [600]
Halocarpus        GCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAGGTTGAAAGAGATAAATTAAATAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Afrocarpus        GCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATACAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCTTATTGGGATGTACCATCAAAC   [600]
Retrophyllum      GCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCTTATTGGGATGTACCATCAAAC   [600]
Sundacarpus       GCTTATTCCAAGACTTTCCAAGGTCCACCTCATGGTATCCAAGTAGAAAGAGATAAATTAAATAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAGC   [600]
Parasitaxus       GCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAGGTTGAAAGAGATAAATTAAATAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAAC   [600]
Cycas             GCTTATTCCAAAACTTTCCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTAAACAAATATGGCCGTCCTCTATTGGGATGTACCATTAAAC   [600]
Ginkgo            GCTTATTCCAAAACTTTCCAGGGTCCACCTCATGGTATCCAAGTTGAAAGGGATAAATTGAATAAATATGGCCGTCCCCTATTGGGATGTACTATCAAGC   [600]

[                          610       620       630       640       650       660       670       680       690       700]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTTAATTCCCA   [700]
Callitris         CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTGGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Cupressus         CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Callitropsis      CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Chamaecyp         CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Calocedru         CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Cryptomer         CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Cunninghamia      CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Diselma           CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Fitzroya          CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Fokienia          CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Glyptostrobus     CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Juniperus         CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Libocedrus        CAAAATTGGGTCTATCTGCTAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Pilgerodendron    CAAAATTGGGTCTATCTGCTAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Metasequoia       CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Microbiota        CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Neocallitris      CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Papuacedrus       CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Platycladus       CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Sequoia           CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Sequoiadendron    CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Taiwania          CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Taxodium          CAAAATTGGGTCTATCTGCCAAGAATTACGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAACTCCCA   [700]
Tetraclinis       CAAAATTGGGTCTATCTGCCAAGAATTATCGTAGAGCGGTTTATGAAGGTCTCCGTGGTGGACTGGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Thujopsis         CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Thuja             CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Actinostrobus     CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Widdringtonia     CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGACCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Austrocedrus      CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGACCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Xanthocyparis     CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Agathis           CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAATTCCCA   [700]
Araucaria         CAAAATTGGGTCTATCTGCCAAAAATTATGGTAGAGCAGTTTATGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTGAATTCCCA   [700]
Wollemia          CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAATTCCCA   [700]
Torreya           CAAAATTGGGCTTATCCGCCAAGAATTATGGTAGAGCGGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Taxus             CAAAATTGGGCCTATCTGCCAAAAATTATGGTAGAGCCGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Amentotaxus       CAAAATTGGGCCTATCTGCCAAAAATTATGGTAGAGCGGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Pseudotaxus       CAAAGTTGGGCCTATCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Austrotaxus       CAAAATTGGGCCTATCTGCCAAAAATTATGGTAGAGCGGTTTACGAATGTCTTCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCA   [700]
Cephalotaxus      CAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTACGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAATGTGAATTCCCA   [700]
Sciadopitys       CAAAATGTGGCCTATCTGCCAAAAATTATGGCAGAGCAGTTTACGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCA   [700]
Pinus             CAAAATTGGGTCTATCAGCCAAAAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTCGATTTTACTAAGGATGATGAGAACGTAAATTCCCA   [700]
Picea             CAAAATTGGGTCTATCGGCCAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCA   [700]
Cathaya           CAAAATTGGGTCTATCAGCCAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGCGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCA   [700]
Larix             CAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCA   [700]
Abies             CAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCA   [700]
Pseudotsuga       CAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCA   [700]
Tsuga             CAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTATGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAACTCCCA   [700]
Nothotsuga        CAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTATGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAACTCCCA   [700]
Cedrus            CAAAATTGGGTCTATCGGCTAAAAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAGAACGTAAATTCCCA   [700]
Pseudolarix       CAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAGAACGTAAATTCCCA   [700]
Keteleeria        CAAAATTGGGTCTATCAGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCA   [700]
Phyllocladus      CAAAATTGGGTCTGTCCGCTAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGATGATGAGAACGTAAATTCCCA   [700]
Lagarostrobos     CAAAATTGGGCCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGATGATGAGAACGTGAATTCCCA   [700]
Prumnopitys       CAAAATTGGGTCTGTCCGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACMAAGGATGATGAGAATGTAAATTCCCA   [700]
Dacrydium         CAAAATTGGGTTTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAGGATGATGAGAACGTAAATTCTCA   [700]
Dacrycarpus       CAAAATTGGGCCTGTCTGCCAAGAATTATGGTAGAACAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAAGATGATGAGAACGTAAATTCCCA   [700]
Podocarpus        CAAAATTGGGCCTGTCTGCAAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAGGATGATGAGAATGTAAATTCCCA   [700]
Nageia            CAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTATTCGTGGTGGGCTTGATTTCACGAAGGATGATGAGAATGTAAATTCCAA   [700]
Microstrobos      CAAAATTGGGACTGACTGCCAAAAATTATGGTAGAGCAGTTTACGAATGTCTACGTGGTGGACTTGATTTCACCAAGGATGATGAGAACGTAAATACGCA   [700]
Microcachrys      CAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGCCTACGTGGTGGACTTGATTTCACAAAGGATGATGAGAACGTAAATTCCCA   [700]
Saxegothaea       CAAAATTGGGTCTGTCTGCCAAAAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGATGATGAGAACGTAAATTCCCA   [700]
Acmopyle          CAAAATTGGGTCTGTCTGCCMAGAATTATGKTAGAGCAGTTTACGAATGTCTTCSTGGTGGACTTGATTYCAMGAAKGATGATGAGAACGTAAATTCCCA   [700]
Falcatifolium     CAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGGGGTGGACTTGATTTCACGAAGGATGATGAGAATATNNNNNNNNN   [700]
Manoao            CCAAATTGGGTCCGTCTGCCAAGAATTATGTTAGAGCAGTTTACGAATGCCTTCGTGGTGGACTTGATTTCMCAAAGGATGATGAGAATGTWAATTCCCA   [700]
Lepidothamnus     CAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGAGGATGAGAACGTAAATTCCCA   [700]
Halocarpus        CAAAATTGGGTCTCTCCGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCATGGTGGACTTGATTTCACGAAGGATGATGAGAACGTAAATTCCCA   [700]
Afrocarpus        CAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAGGATGATGAGAATGTAAATTCCCA   [700]
Retrophyllum      CAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAGGATGATGAGAATGTAAATTCCCA   [700]
Sundacarpus       CAAAATTGGGTCTGTCCGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGATGATGAGAATGTAAATTCCCA   [700]
Parasitaxus       CAAACATGGGTCTGTCCGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGATGATGAGAACGTAAATTCCCA   [700]
Cycas             CCAAATTGGGTTTATCTGCCAAAAACTATGGTAGAGCAGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACCAAAGATGATGAGAACGTAAATTCCCA   [700]
Ginkgo            CAAAATTGGGTTTATCTGCCAAAAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTTACTAAAGATGATGAGAACGTAAATTCCCA   [700]

[                          710       720       730       740       750       760       770       780       790       800]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACAGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Callitris         ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCGGAAGCACTTTATAAAGCTCAAGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Cupressus         GCCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCG   [800]
Callitropsis      GCCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCG   [800]
Chamaecyp         ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCG   [800]
Calocedru         ACCATTTATGCGTTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCG   [800]
Cryptomer         ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Cunninghamia      ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Diselma           ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Fitzroya          ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Fokienia          ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTTTAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTATCTGAATGCG   [800]
Glyptostrobus     ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Juniperus         GCCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCG   [800]
Libocedrus        ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAAGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Pilgerodendron    ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAAGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Metasequoia       ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Microbiota        ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCG   [800]
Neocallitris      ACCATTTATGCGCTGGAGAGATCGTTTCTGCNTTTGTGCAGAAGCAATTTATAAAGCTCAAGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Papuacedrus       ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Platycladus       ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCG   [800]
Sequoia           ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Sequoiadendron    ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Taiwania          ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Taxodium          ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Tetraclinis       ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Thujopsis         ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Thuja             ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Actinostrobus     ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCG   [800]
Widdringtonia     ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Austrocedrus      ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCT   [800]
Xanthocyparis     GCCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTATCTGAATGCG   [800]
Agathis           ACCATTCATGCGCTGGAGAGATCGTTTTGTTTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCAGAGACGGGTGAAATTAAGGGGCATTACTTGAATGCT   [800]
Araucaria         ACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCGGAGACGGGTGAAATTAAGGGGCATTACTTGAATGCT   [800]
Wollemia          ACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCGGAGACGGGTGAAATTAAGGGGCATTACTTGAATGCT   [800]
Torreya           ACCATTCATGCGCTGGAGAGATCGTTTCTGTTTTTGTGCAGAAGCAATTTATAAGTCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCT   [800]
Taxus             ACCATTCATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACTTGAATGCT   [800]
Amentotaxus       ACCATTCATGCGCTGGAGAGATCGTTTCTGTTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCT   [800]
Pseudotaxus       ACCATTCATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAATCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACTTGAATGCT   [800]
Austrotaxus       ACCATTCATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACTTGAATGCT   [800]
Cephalotaxus      ACCATTCATGCGCTGGAGAGATCGTTTCTGCTTCTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACTTGAATGCT   [800]
Sciadopitys       ACCATTCATGCGCTGGAGAGACCGTTTTTGCTTTTGTGCTGAAGCAATTTATAAAGCTCAAGCTGAAACGGGTGAAATTAAGGGACATTATTTGAATGCT   [800]
Pinus             ACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCAATTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTATTTGAATGCT   [800]
Picea             ACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCT   [800]
Cathaya           ACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCAATTAATAAGGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCT   [800]
Larix             ACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCACTTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCT   [800]
Abies             ACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCACTTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCT   [800]
Pseudotsuga       ACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCACTTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTATTTGAATGCT   [800]
Tsuga             ACCATTCATGCGTTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCACTTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCT   [800]
Nothotsuga        ACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCACTTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCT   [800]
Cedrus            ACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCAATTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAGGGGCATTACTTGAATGCT   [800]
Pseudolarix       ACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCAATTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCT   [800]
Keteleeria        ACCATTCATGCGCTGGAGACATCGTTTTGTCTTTTGTGCGGAAGCACTTAATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCT   [800]
Phyllocladus      ACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCAGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Lagarostrobos     ACCATTTATGCGCTGGAGAGATCGCTTCTGCTTTTGCGATGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Prumnopitys       ACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCAGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Dacrydium         ACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCAATTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Dacrycarpus       ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Podocarpus        ACCATTTATGCGCTGGAGAGAACGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Nageia            ACCAATTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Microstrobos      ACCATTTATGCGCTGGAGAGAACGTTTTTGCTTCTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Microcachrys      ACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAACCACCTCATAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Saxegothaea       ACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Acmopyle          ACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Falcatifolium     NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGCTCACGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Manoao            ACCATTTATGCGTTGGAGAGATCGCTTCTGCTTTTGCGCCGAAGCACTTTTTAAAGCTCATGCTGAAACAGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Lepidothamnus     ACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCAGAAGCACTTTTTAAAGCTCAGGCCGAAACGGGTGAAATTAAGGGGCATTACCTTAATGCT   [800]
Halocarpus        ACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGATGAAATTAAGGGGCATTACCTGAATGCT   [800]
Afrocarpus        ACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCT   [800]
Retrophyllum      ACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGATCCGGCTGAAACTGGTGAAATTAAAGGGCATTACCTGAATGCT   [800]
Sundacarpus       ACCATTTATGCGCAGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAGTTAAGGGGCATTACCTGAATGCT   [800]
Parasitaxus       ACCATTTATGCGCTGGAGAGACCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTATCTGAATGCT   [800]
Cycas             ACCATTTATGCGCTGGAGAGATCGTTTCTGCTTCTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCT   [800]
Ginkgo            ACCATTCATGCGCTGGAGAGATCGTTTCTTGTTTTGTGCAGAAGCAATTTATAAAGCTCAGACCGAGACGGGTGAAATTAAGGGACATTACTTGAATGCT   [800]

[                          810       820       830       840       850       860       870       880       890       900]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Callitris         ACTGCGGGGACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Cupressus         ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Callitropsis      ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGTAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Chamaecyp         ACTGCAGGGACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Calocedru         ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAATATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Cryptomer         ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Cunninghamia      ACTGCAGGTACAAGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACTGGAGGTTTTACGT   [900]
Diselma           ACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Fitzroya          ACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Fokienia          ACTGCAGGGACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Glyptostrobus     ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Juniperus         ACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Libocedrus        ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Pilgerodendron    ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Metasequoia       ACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Microbiota        ACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Neocallitris      ACTGCGGGNACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Papuacedrus       ACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Platycladus       ACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Sequoia           ACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Sequoiadendron    ACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCGGTATTCGCCAGAGAATTGGGAGTTCCTATCATCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Taiwania          ACTGCGGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGCGCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACGG   [900]
Taxodium          ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAATATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACAGGAGGTTTTACGG   [900]
Tetraclinis       ACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Thujopsis         ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Thuja             ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Actinostrobus     ACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Widdringtonia     ACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACGG   [900]
Austrocedrus      ACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACGG   [900]
Xanthocyparis     ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGG   [900]
Agathis           ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAATGTTCGCCTATGAATTGGGAGTTCCCATAGTCATGCATGACTATCTGACGGGAGGTTTTACGG   [900]
Araucaria         ACCGCAGGTACATGTGAAGAAATGATGAAAAGAGCAAGTTTCGCCTATGAATTGGGAGTTCCCATCGTCATGCATGACTATCTGACGGGAGGTTTTACGG   [900]
Wollemia          ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAAATTTCGCCTATGAATTGGGAGTTCCCATAGTCATGCATGACTATCTGACGGGAGGTTTTACGG   [900]
Torreya           ACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACGG   [900]
Taxus             ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATTTGACTGGAGGTTTCACGG   [900]
Amentotaxus       ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTTATGCATGACTATTTGACTGGAGGTTTTACAG   [900]
Pseudotaxus       ACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTTATGCATGACTATTTGACTGGAGGTTTTACGG   [900]
Austrotaxus       ACTGCAGGTACGTGTGAAGAAATGATAAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACGG   [900]
Cephalotaxus      ACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACCG   [900]
Sciadopitys       ACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTCCCCATAGTCATGCATGACTATCTGACGGGAGGTTTTACGG   [900]
Pinus             ACTGCAGGTACATGTGAAGAAATGATGAAAAGGGTAATATTTGCAAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGAGGTTTTACCG   [900]
Picea             ACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAATATTTGCAAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGAGGTTTTACCG   [900]
Cathaya           ACTGCAGGTACATGTGAAGAAATGATAAAAAGGGCAGTATTTGCAAGAGAATTGGGAGTTCCTATCATTATGCATGACTATCTGACGGGAGGTTTTACTG   [900]
Larix             ACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAGTATTTGCAAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGAGGTTTTACTG   [900]
Abies             ACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAGTATTTGCAAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACGGGGGGTTTTACCG   [900]
Pseudotsuga       ACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAGTATTTGCAAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACAGGAGGTTTTACCG   [900]
Tsuga             ACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAGTATTTGCAAGAGAATTAGGAGTTCCTATCGTTATGCATGACTATCTGACGGGAGGTTTTACCG   [900]
Nothotsuga        ACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAATATTTGCAAGAGAATTAGGAGTTCCTATCGTCATGCATGACTATCTGACGGGAGGTTTTACCG   [900]
Cedrus            ACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAGTCTTTGCAAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATTTGACGGGAGGTTTTACCG   [900]
Pseudolarix       ACTGCAGGTACATGTGAAGAGATGATGAAAAGGGCAATATTTGCAAGAGAATTAGGAGTTCCTATCGTCATGCATGACTATCTGACGGGAGGTTTTACTG   [900]
Keteleeria        ACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAATATTTGCAAGAGAATTAGGAGTTCCTATCGTCATGCATGACTATCTGACGGGGGGTTTTACTG   [900]
Phyllocladus      ACCGCGGGTACATGCGAAGAAATGCTAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGTTTTACTG   [900]
Lagarostrobos     ACCGCAAGTTCATGTCAAGAAATGATTAAAACAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACGG   [900]
Prumnopitys       ACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCCATCGTTATGCATGACTACTTGACGGGGGGGTTTACTG   [900]
Dacrydium         ACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCAGTATTCGCTAGAGAATTGGGGGTTCCTATCATTATGCATGACTATCTGACGGGGGGGTTTACTG   [900]
Dacrycarpus       ACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTCACTG   [900]
Podocarpus        ACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACGG   [900]
Nageia            ACCGCAGGTACATGTGAAGAAATGATGAAAAGGGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACGG   [900]
Microstrobos      ACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTACCTGACGGGGGGGTTTACTG   [900]
Microcachrys      ACCGCGGGTACATGTGAAAAAATGATGAAAAGAGCGGTATTCGCTCGAAAATTGGGAGTTCCTATCATTATGCATGACTATCTGACGGGGGGGTTTACTG   [900]
Saxegothaea       ACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACTG   [900]
Acmopyle          ACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGGGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACTG   [900]
Falcatifolium     ACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCAGTATTCGCTAGAGAATTGGGGGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACTG   [900]
Manoao            ACCGCAGGTACATGCGAAGAAATGCTAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATTGTGATGCATGACTACTTGACGGGGGGTTTTACTG   [900]
Lepidothamnus     ACCGCAAGTACATGTGAACAAATGATGAAAAGATCAGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACTG   [900]
Halocarpus        ACCGCGGGAACATGCGAAGAAATGATAAAAAGGGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGATTACTG   [900]
Afrocarpus        ACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTACTTGACGGGGGGGTTTACGG   [900]
Retrophyllum      ACCGCAGGTACATGTGAACAAATGATAAAAAGAGCGGTATTCGCTATAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACGG   [900]
Sundacarpus       ACCGCAGGTACATGCGAAGAAATGATAAAAAGAGCAGTATTCGCGAGAGAATTGGGAACTCCTATCGTTATGCATGACTACCTGACGGGGGGGTTTACTG   [900]
Parasitaxus       ACCGCGGGTACATGTGAAGAAATGATGAAAAGGGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACTG   [900]
Cycas             ACTGCAGGTACATGCGAAGAAATGATCAAAAGGGCAGTATTTGCCAGAGAATTGGGGGTTCCTATCGTCATGCATGACTACCTGACAGGAGGATTTACTG   [900]
Ginkgo            ACTGCAGGTACATGCGAAGAAATGATGAAAAGGGCAGTATTTGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACGGGAGGTTTTACTG   [900]

[                          910       920       930       940       950       960       970       980       990       1000]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Callitris         CAAATACTTCGTTGGCTCACTATTGCCGCGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Cupressus         CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGTCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Callitropsis      CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Chamaecyp         CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Calocedru         CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Cryptomer         CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Cunninghamia      CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTAT   [1000]
Diselma           CAAATACTTCGTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAGAAATCATGGTAT   [1000]
Fitzroya          CAAATACTTCGTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAGAAATCATGGTAT   [1000]
Fokienia          CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Glyptostrobus     CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Juniperus         CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAATTCATGGTAT   [1000]
Libocedrus        CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Pilgerodendron    CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Metasequoia       CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Microbiota        CAAATACTTCGTTAGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Neocallitris      CAAATACTTCGTTGGCTCACTATTTCCGCGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Papuacedrus       CAAATACTTCGTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAGAAATCATGGTAT   [1000]
Platycladus       CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCRGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Sequoia           CAAATACTTCGTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Sequoiadendron    CAAATACTTCGTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Taiwania          CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Taxodium          CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAGAATTCATGGTAT   [1000]
Tetraclinis       CAAATACTTCGTTGGCTCAYTATTGCCGCGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Thujopsis         CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Thuja             CAAATACKTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Actinostrobus     CAAATACTTCGTTAGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Widdringtonia     CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Austrocedrus      CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Xanthocyparis     CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Agathis           CAAATACTTCGTTGGCTCATTATTGCCGAGACCATGGCCTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAAAATTCATGGTAT   [1000]
Araucaria         CAAATACTTCGTTGGCTCATTATTGCCGAGACCATGGCCTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAAAATTCATGGTAT   [1000]
Wollemia          CAAATACTTCGTTGGCTCATTATTGCCGAGACCATGGCCTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAAAATTCATGGTAT   [1000]
Torreya           CAAATACTACGTTAGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGACAGACAAAAAAATCATGGTAT   [1000]
Taxus             CAAATACTTCGTTGGCTCATTATTGTCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Amentotaxus       CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Pseudotaxus       CGAATACTTCGTTGGCTCATTATTGCCGAGACAACGGACTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGACAGACAAAAAAATCATGGTAT   [1000]
Austrotaxus       CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAAAAATCATGGTAT   [1000]
Cephalotaxus      CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTCCACATTCATCGTGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Sciadopitys       CAAATACTTCGTTGTCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Pinus             CAAATACTTCTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAATTCATGGTAT   [1000]
Picea             CAAATACTTCTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTGATTGACAGACAAAAAAATCATGGTAT   [1000]
Cathaya           CAAATACTTCTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAAAATTCATGGTAT   [1000]
Larix             CAAATACTTCTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGCAT   [1000]
Abies             CAAATACTACTTTGGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATCGACAGACAAAGAAATCATGGTAT   [1000]
Pseudotsuga       CAAATACTTCTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGCAT   [1000]
Tsuga             CAAATACTACTTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Nothotsuga        CAAATACTAGTTTGGCTCATTATTGCCGAGACAATGGCTTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Cedrus            CAAATACTAGTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAATTCATGGTAT   [1000]
Pseudolarix       CAAATACTAGTTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Keteleeria        CAAATACTAGTTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Phyllocladus      CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTAT   [1000]
Lagarostrobos     CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTAT   [1000]
Prumnopitys       CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCATCGCGCAATGCATGCAGTTATCGATAGACAAAAAAATCACGGTAT   [1000]
Dacrydium         CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTAT   [1000]
Dacrycarpus       CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTAT   [1000]
Podocarpus        CGAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTAT   [1000]
Nageia            CGAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTCTTGATAGACAAAAAAATCACGGTAT   [1000]
Microstrobos      CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTAT   [1000]
Microcachrys      CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTGCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTAT   [1000]
Saxegothaea       CAAATACATCGTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAGAAATCACGGTAT   [1000]
Acmopyle          CGAAYACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTKATTGATAGACAAAGAAATCACGGTAT   [1000]
Falcatifolium     CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTAT   [1000]
Manoao            CAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGATTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTAT   [1000]
Lepidothamnus     CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACAAAGAAATCATGGTAT   [1000]
Halocarpus        CAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTAT   [1000]
Afrocarpus        CGAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTAT   [1000]
Retrophyllum      CMAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTAT   [1000]
Sundacarpus       CAAATACTTCGTTGGCTCATTATTGTCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTAT   [1000]
Parasitaxus       CAAATACTTCGTTGGCTCATTATTGCCGGGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTAT   [1000]
Cycas             CAAATACCAGCTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]
Ginkgo            CAAATACTAGCTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTAT   [1000]

[                          1010      1020      1030      1040      1050      1060      1070      1080      1090      1100]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Callitris         GCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTTGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Cupressus         GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Callitropsis      GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Chamaecyp         GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACT   [1100]
Calocedru         GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGGAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Cryptomer         GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGGGAAGTGACT   [1100]
Cunninghamia      ACACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Diselma           GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Fitzroya          GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Fokienia          GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Glyptostrobus     GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Juniperus         GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Libocedrus        GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Pilgerodendron    GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Metasequoia       GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Microbiota        GCACTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Neocallitris      GCATTTCCGTGNNCTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTTGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Papuacedrus       GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Platycladus       GCACTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Sequoia           GCACTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Sequoiadendron    GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Taiwania          GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Taxodium          GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Tetraclinis       GCACTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Thujopsis         GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Thuja             GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Actinostrobus     GCACTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Widdringtonia     GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Austrocedrus      GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Xanthocyparis     GCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Agathis           GCACTTTCGTGTGCTGGCTAAAGCATTGCGTATGTCTGGCGGAGATCATGTTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGTGAACGAGAAGTCACT   [1100]
Araucaria         GCACTTTCGTGTGCTGGCTAAAGCATTGCGTATGTCTGGTGGAGATCATGTTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGTGAACGAGAAGTCACT   [1100]
Wollemia          GCACTTTCGTGTGCTGGCTAAAGCATTGCGTATGTCTGGCGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGTGAACGAGAAGTCACT   [1100]
Torreya           GCACTTCCGTGTGCTAGCTAAAGCACTGCGTATGTCTGGTGGAGATCATATTCACGCTGGTACGGTAGTAGGTAAACTTGAAGGAGAACGAGAGATCACT   [1100]
Taxus             ACATTTCCGTGTACTAGCTAAAGCACTGCGTATGTCTGGTGGAGACCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACT   [1100]
Amentotaxus       GCACTTCCGTGTGCTGGCTAAAGCACTGCGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Pseudotaxus       GCATTTCCGTGTACTAGCTAAAGCGCTGCGTATGTCTGGTGGAGACCATGTTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGCGAAGTAACT   [1100]
Austrotaxus       GCACTTCCGTGTGCTAGCTAAAGCACTGCGTATGTCTGGTGGAGATCATGTTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Cephalotaxus      GCACTTCCGTGTACTGGCTAAAGCACTGCGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Sciadopitys       GCATTTCCGTGTGCTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Pinus             GCATTTCCGGGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTAACT   [1100]
Picea             GCACTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACT   [1100]
Cathaya           GCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGCGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACT   [1100]
Larix             GCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACT   [1100]
Abies             GCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACT   [1100]
Pseudotsuga       GCACTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACT   [1100]
Tsuga             GCATTTTCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Nothotsuga        GCTTTTTCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGACGTCACT   [1100]
Cedrus            GCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGATGTTACT   [1100]
Pseudolarix       GCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGACGTCACT   [1100]
Keteleeria        GCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACT   [1100]
Phyllocladus      GCACTTTCGTGTACTGGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATTCACGCTGGTACGGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Lagarostrobos     GCACTTTCGTGTACTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATTCACGCAGGTACTGTAGTAGGTAAACTTGAAGGAGAGGGAGAAGTAACT   [1100]
Prumnopitys       GCACTTTCGTGTACTGGCTAAAGCMTTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACT   [1100]
Dacrydium         GCACTTTCGTGTACTAGCGAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACT   [1100]
Dacrycarpus       GCACTTTCGTGTACTAGCGAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACT   [1100]
Podocarpus        GCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGGGATCATATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACT   [1100]
Nageia            GCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCATGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACT   [1100]
Microstrobos      GCACTTTCGTGTACTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACT   [1100]
Microcachrys      GCACTTTCGTGTACTACCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACC   [1100]
Saxegothaea       GCATTTTCGTGTACTGGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATCCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGACAAGTAACT   [1100]
Acmopyle          GCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCAGATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAATAACT   [1100]
Falcatifolium     GCACTTTCGTGTACGAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACT   [1100]
Manoao            GCACTTTCGTGTACTGGCTAAAGCATTGCGTATGTCCGGGGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAGCGAGAAGTAACT   [1100]
Lepidothamnus     GCACTTTCGTGTACTGGCTAAAGCATTGCGTATGTCTGGGGGGGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACT   [1100]
Halocarpus        GCACTTTCCTGTACTGGCTAAAGCGTTGCGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTGGAAGGAGAACGAGAAGTAACT   [1100]
Afrocarpus        GCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCATGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACT   [1100]
Retrophyllum      GCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCATGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACT   [1100]
Sundacarpus       GCACTTTCGTGTACTGGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACT   [1100]
Parasitaxus       GCACTTTCGTGTACTGGCTAAAGCMTTGCGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]
Cycas             GCACTTCCGTGTGCTAGCTAAAGCATTGCGAATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGACGTAACT   [1100]
Ginkgo            GCATTTCCGTGTACTAGCTAAAGCATTGCGTATGTCTGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACT   [1100]

[                          1110      1120      1130      1140      1150      1160      1170      1180      1190      1200]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         TTGGGTTTTGTTGATTTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGC   [1200]
Callitris         TTGGGTTTTGTTGATTTATTGCGTGATGATTTTATTCAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGC   [1200]
Cupressus         TTGGGTTTTGTGGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Callitropsis      TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Chamaecyp         TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAGGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Calocedru         TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTTTGC   [1200]
Cryptomer         TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Cunninghamia      TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Diselma           TTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Fitzroya          TTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Fokienia          TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAGGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Glyptostrobus     TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGC   [1200]
Juniperus         TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Libocedrus        TTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTTTGC   [1200]
Pilgerodendron    TTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTTTGC   [1200]
Metasequoia       TTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTTTGC   [1200]
Microbiota        TTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTATGC   [1200]
Neocallitris      TTGGGTTTTGTTGATTTATTGCGTGATGATTTTATTCAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATGC   [1200]
Papuacedrus       TTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Platycladus       TTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Sequoia           TTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Sequoiadendron    TTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Taiwania          CTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Taxodium          TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGC   [1200]
Tetraclinis       TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTCAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTCCTGC   [1200]
Thujopsis         TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGC   [1200]
Thuja             TTAGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGC   [1200]
Actinostrobus     TTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTATGC   [1200]
Widdringtonia     TTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Austrocedrus      TTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Xanthocyparis     TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGC   [1200]
Agathis           TTAGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTGTTTATTTTACTCAAGATTGGGTATCTATGCCAGGTGTTTTGC   [1200]
Araucaria         TTAGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTTACTCAAGATTGGGTATCTATGCCAGGTGTTTTGC   [1200]
Wollemia          TTAGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTTACTCAAGATTGGGTATCTATGCCAGGTGTTTTGC   [1200]
Torreya           TTAGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTCTTGC   [1200]
Taxus             TTGGGTTTTGTTGATTTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGC   [1200]
Amentotaxus       CTAGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACCCAAGATTGGGTCTCTATGCCAGGTGTCTTGC   [1200]
Pseudotaxus       TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCTTGC   [1200]
Austrotaxus       TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTGTCTATGCCGGGTGTCCTGC   [1200]
Cephalotaxus      TTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGC   [1200]
Sciadopitys       TTGGGTTTTGTTGATTTACTGCGTGATGATTTTATTGAAAAAGATCGAAGCCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTTTTGC   [1200]
Pinus             TTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGC   [1200]
Picea             TTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGC   [1200]
Cathaya           TTAGGGTTTGTGGATCTACTGCGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGC   [1200]
Larix             TTAGGGTTTGTTGATCTACTGCGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGACTGGGTATCTATGCCAGGTGTTCTGC   [1200]
Abies             TTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGC   [1200]
Pseudotsuga       TTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTTTGC   [1200]
Tsuga             TTAGGGTTTGTTGATCTACTGCGTGATAATTATATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGC   [1200]
Nothotsuga        TTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGC   [1200]
Cedrus            TTAGGATTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTTTGC   [1200]
Pseudolarix       TTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGC   [1200]
Keteleeria        TTAGGGTTTGTTGATCTACTGCGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGC   [1200]
Phyllocladus      TTGGGTTTTGTGGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGCCGTGGTATTTATTTCACTCAAGACTGGGTATCTATGCCAGGTGTCCTGC   [1200]
Lagarostrobos     TTGGGTTTTGTTGATCTACTACGTGATAATTTTATTGAAAAAGACCGAAGCCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGC   [1200]
Prumnopitys       TTGGGTTTTGTGGATCTAATACGTGATAATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCATAC   [1200]
Dacrydium         TTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTTTCTATGCCAGGTGTCCTGC   [1200]
Dacrycarpus       TTGGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGC   [1200]
Podocarpus        TTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTAC   [1200]
Nageia            TTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCTTAC   [1200]
Microstrobos      TTGGGTTTTGTGGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCATAC   [1200]
Microcachrys      TTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCTTGC   [1200]
Saxegothaea       TTAGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATCTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCTTGC   [1200]
Acmopyle          TTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGC   [1200]
Falcatifolium     TTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTTTCTATGCCAGGTGTCCTGC   [1200]
Manoao            TTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGCCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGC   [1200]
Lepidothamnus     TTGGGTTTTGTTGATCTACTACGTGATGATTMTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGC   [1200]
Halocarpus        TTGGGTTTTGTTGACCTACTACGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCGGGTGTCCTGC   [1200]
Afrocarpus        TTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGAATGGGTATCTATGCCAGGTGTCATAC   [1200]
Retrophyllum      TTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCCTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCYTAC   [1200]
Sundacarpus       TTGGGTTTTGTTGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTAC   [1200]
Parasitaxus       TTGGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCGGGTGTCCTGC   [1200]
Cycas             TTGGGTTTTGTTGATCTACTGCGTGACGATTTTATTGAAAGAGACCGAAGTCGTGGTATTTATTTCACCCAAGATTGGGTATCTATGCCAGGTGTTCTGC   [1200]
Ginkgo            CTGGGTTTTGTTGATCTACTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGC   [1200]

[                          1210      1220      1230      1240      1250      1260      1270      1280      1290      1300]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Callitris         CTGTAGCTTCAGGAGGGATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCA   [1300]
Cupressus         CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Callitropsis      CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Chamaecyp         CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Calocedru         CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Cryptomer         CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTCGGTGGAGGGACTTTGGGGCA   [1300]
Cunninghamia      CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Diselma           CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGAACTTTGGGGCA   [1300]
Fitzroya          CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGAACTTTGGGGCA   [1300]
Fokienia          CTGTAGCTTCAGSAGGTATTCACGTTTGNCATATGCCTGCTCTGACCGAGATCTTTGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN   [1300]
Glyptostrobus     CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTAACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Juniperus         CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Libocedrus        CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCA   [1300]
Pilgerodendron    CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCA   [1300]
Metasequoia       CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGAACTTTGGGGCA   [1300]
Microbiota        CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Neocallitris      CTGTAGCTTCAGGAGGGATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCA   [1300]
Papuacedrus       CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGAACTTTGGGGCA   [1300]
Platycladus       CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Sequoia           CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Sequoiadendron    CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Taiwania          CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Taxodium          CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Tetraclinis       CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Thujopsis         CTGTAGCTTCAGGAGGTATCCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Thuja             CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Actinostrobus     CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Widdringtonia     CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGAACTTTGGGGCA   [1300]
Austrocedrus      CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGAACTTTGGGGCA   [1300]
Xanthocyparis     CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Agathis           CTGTAGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGGGGAACTTTGGGGCA   [1300]
Araucaria         CTGTAGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGGGGAACTTTGGGACA   [1300]
Wollemia          CTGTAGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGGGGAACTTTGGGGCA   [1300]
Torreya           CTGTAGCTTCAGGAGGCATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Taxus             CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGCACTTTGGGACA   [1300]
Amentotaxus       CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGGACTTTGGGGCA   [1300]
Pseudotaxus       CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAGTTTGGTGGAGGGACTTTGGGACA   [1300]
Austrotaxus       CTGTAGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAAATTTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGCACTTTGGGGCA   [1300]
Cephalotaxus      CTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGTGATGATTCTGTATTACAGTTTGGTGGAGGGACTTTGGGACA   [1300]
Sciadopitys       CTGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGACGATTCTGTATTACAGTTCGGTGGGGGAACTTTGGGGCA   [1300]
Pinus             CCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTNCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACA   [1300]
Picea             CCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACA   [1300]
Cathaya           CCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAAATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGGCA   [1300]
Larix             CCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGGCA   [1300]
Abies             CCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACA   [1300]
Pseudotsuga       CCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGGGGAACTTTAGGGCA   [1300]
Tsuga             CCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTACTACAGTTTGGTGGGGGAACTTTGGGACA   [1300]
Nothotsuga        CGGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTACTACAGTTTGGTGGGGGAACTTTGGGACA   [1300]
Cedrus            CCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACA   [1300]
Pseudolarix       CCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTACTACAGTTTGGTGGGGGAACTTTGGGACA   [1300]
Keteleeria        CCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACA   [1300]
Phyllocladus      CTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCA   [1300]
Lagarostrobos     CTGTAGCTTCMGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTTTTACAGTTTGGTGGAGGAACTTTGGGGCA   [1300]
Prumnopitys       CTGTAGCTTCGGGGGGTATTCATGTTAAACATATGCATGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGCGGAGGAACTTTGGGGCA   [1300]
Dacrydium         CTGTAGCTTCGGGAGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCA   [1300]
Dacrycarpus       CTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTACTACAGTTTGGTGGAGGAACTTTGGGACA   [1300]
Podocarpus        CTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCA   [1300]
Nageia            CTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCA   [1300]
Microstrobos      CTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTCACCGAAATATTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCA   [1300]
Microcachrys      CTGTAGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGTTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCA   [1300]
Saxegothaea       CTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCA   [1300]
Acmopyle          CTGTAGCTYCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGRATGATTCTGTATTACAGTTTGGTGGARGAACTTTGGGGCA   [1300]
Falcatifolium     CTGTAGCTTCSGGGGGTATTCATGTTTGGCATATGCCCGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCA   [1300]
Manoao            CTGTAGCTTCAGGGGTTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTAGGGCA   [1300]
Lepidothamnus     CTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATTTTTGGGGATGATTCTGTATTACAGTTCGGTGGAGGAACTGTGGGGCA   [1300]
Halocarpus        CTGTAGCTTCAGGGGGTATACATGTTTGGCATATGCCTGCTCTGACGGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCA   [1300]
Afrocarpus        CTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCA   [1300]
Retrophyllum      CTGTAGCTTCGGGGGGTATTCATKTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTCGTGGAGGAACTTTGGGGCA   [1300]
Sundacarpus       CTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGCGGAGGAACTTTGGGGCA   [1300]
Parasitaxus       CTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACGGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCA   [1300]
Cycas             CCGTAGCTTCGGGGGGTATTCACGTTTGGCATATGCCTGCTCTAACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGGGGAACTTTGGGACA   [1300]
Ginkgo            CCGTAGCTTCAGGGGGTATTCACGTCTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTACTACAGTTTGGTGGGGGAACTTTGGGACA   [1300]

[                          1310      1320      1330      1340      1350      1360      1370      1380      1390      1400]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAAT   [1400]
Callitris         TCCTTGGGGAAATGCACCGGGTGCAGTGGCCAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGGCGCGACCTTGCGCGTGAAGGTAAT   [1400]
Cupressus         CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTA--   [1400]
Callitropsis      CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATC-----------------   [1400]
Chamaecyp         CCCTTGGGGAAATGCACCTGGTGCGGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGT---------   [1400]
Calocedru         CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGT---------   [1400]
Cryptomer         CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAAT   [1400]
Cunninghamia      TCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCACGTGAAGGTAAC   [1400]
Diselma           TCCTTGGGGAAATGCACCTGGTGGAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCGCGTGAAGGTAAT   [1400]
Fitzroya          TCCTTGGGGAAATGCACCTGGTGGAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCGCGTGAAGGTAAT   [1400]
Fokienia          NNNNNNNNNNNNNNNNNNNNNNNNNGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAAT   [1400]
Glyptostrobus     CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAAT   [1400]
Juniperus         CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCG----------   [1400]
Libocedrus        TCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACNTTGCGCGTGAAGGTAAT   [1400]
Pilgerodendron    TCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACNTTGCGCGTGAAGGTAAT   [1400]
Metasequoia       CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCCCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAAT   [1400]
Microbiota        CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAAT   [1400]
Neocallitris      TCCTTGGGGAAATGCACCGGGTGCAGTGGCCAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGGCGCGACCTTCCGGTTGAAGGTAAT   [1400]
Papuacedrus       TCCTTGGGGAAATGCACCTGGTGGAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCGCGTGAAGGTAAT   [1400]
Platycladus       CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAAT   [1400]
Sequoia           CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCCCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAAT   [1400]
Sequoiadendron    CCCTTGGGGAAATGCACCTGGTGCAGNGGCTAATCGAGTCGCTTTANAANCTTGTGTNCAAGCTCNTAATGAANGACNTGATCTTGCGCNTGAAGGTAAT   [1400]
Taiwania          TCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAAT   [1400]
Taxodium          CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAACCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAAT   [1400]
Tetraclinis       CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAAT   [1400]
Thujopsis         CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGGCGTGATCTTGCGCGTGAAGGTAAT   [1400]
Thuja             CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGGCGTGATCTTGCGCGTGAAGGTAAT   [1400]
Actinostrobus     CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAAT   [1400]
Widdringtonia     TCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCGCGTGAAGGTAAT   [1400]
Austrocedrus      TCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCGCGTGAAGGTAAT   [1400]
Xanthocyparis     CCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGT---------   [1400]
Agathis           CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Araucaria         CCCTTGGGGAAATGCACCTGGTGAGGTAGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Wollemia          CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTGAAGGTAAT   [1400]
Torreya           CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCTTTANAAGCTTGTGTACAAGCGCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Taxus             TCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCATTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTCGCTCGTGAAGGTAAT   [1400]
Amentotaxus       CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTCGCTTTAGAAGCCTGTGTGCAAGCTCGTAATGAAGG-------------------------   [1400]
Pseudotaxus       CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTCGCATTAGAAGCTTGTGTACAAGCTCGTAACGAAGGACGTGATCTCGCTCGTGAAGGTAAT   [1400]
Austrotaxus       CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTCGCATTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Cephalotaxus      CCCTTGGGGAAATGCACCAGGTGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Sciadopitys       TCCGTGGGGAAATGCGCCTGGTGCAGTAGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTGAAGGTAAT   [1400]
Pinus             TCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Picea             CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Cathaya           CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Larix             CCCTTGGGGAAATGCGCCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Abies             CCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Pseudotsuga       TCCTTGGGGAAATGCACCCGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGG####   [1396]
Tsuga             CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTCGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Nothotsuga        CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Cedrus            CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Pseudolarix       CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Keteleeria        CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTGTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Phyllocladus      CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Lagarostrobos     CCCTTGGGGAAATGCCCCTGGTGCAGTAGCTAATCGGGTTGC----------------------------------------------------------   [1400]
Prumnopitys       CCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Dacrydium         CCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Dacrycarpus       CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGGCGTGATCTTGCTCGTGAAGGTAAT   [1400]
Podocarpus        CCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCACGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Nageia            CCCTTGGGGAAATGCACCTGGTGCAGCAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Microstrobos      CCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Microcachrys      CCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Saxegothaea       CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Acmopyle          CCCTTGGGGAAATGCACCTGGTGCAGTAGCGAATCSGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGSCGTKATCTTGCTMGTGAAGGTAAT   [1400]
Falcatifolium     CCCTTGGGGAAATGCGCCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Manoao            CCCTTGGGGAAATGCACCTGGTGGAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTATT   [1400]
Lepidothamnus     CCCTTGGGGAAATGCACCTGGGGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGAGACGAGATCTTGCACGTGAAGGTAAT   [1400]
Halocarpus        CCCTTGGGGAAATGCACCGGGTGCAGCCGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Afrocarpus        CCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCCTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Retrophyllum      CCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTAGTAATGAGGGACGAGATCTTGCTCGTGAAGGTGAT   [1400]
Sundacarpus       CCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGGGTTGCTTTACAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Parasitaxus       CCCTTGGGGAAATGCACCGGGTGGAGTCGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGACCTTGCTCGTGAAGGTAAT   [1400]
Cycas             CCCTTGGGGAAATGCACCTGGTGCAGTAGCGAATCGAGTTGCCTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]
Ginkgo            CCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCCCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAAT   [1400]

[                          1410      1420      1430      1440      1450      1460      1470      1480      1490      1500]
[                          .         .         .         .         .         .         .         .         .         .]

Athrotaxi         GAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATAAAATTTGAATTTGAT----------------   [1500]
Callitris         ----------------------------------------------------------------------------------------------------   [1500]
Cupressus         ----------------------------------------------------------------------------------------------------   [1500]
Callitropsis      ----------------------------------------------------------------------------------------------------   [1500]
Chamaecyp         ----------------------------------------------------------------------------------------------------   [1500]
Calocedru         ----------------------------------------------------------------------------------------------------   [1500]
Cryptomer         CAAGTGATCCGCGAAGCTACTAAATGGAGCCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGATACGATTGATCGCTTGT   [1500]
Cunninghamia      GAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGATACGATTGATCGCTTGT   [1500]
Diselma           GAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGATACGATTGATCGCTTGT   [1500]
Fitzroya          GAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGATACGATTGATCGCTTGT   [1500]
Fokienia          GAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAATATGGAAGGAAATCAAATTTGAATTTGATACGATTGATCGCTTGT   [1500]
Glyptostrobus     GAAGTGATCCGCGAAGCTACTAAATGGAGCCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGAT----------------   [1500]
Juniperus         ----------------------------------------------------------------------------------------------------   [1500]
Libocedrus        GAAGTGATCCNCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTCAATTTGATACGATTGATCGCTTGT   [1500]
Pilgerodendron    GAAGTGATCCNCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTCAATTTGATACGATTGATCGCTTGT   [1500]
Metasequoia       GAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTA-------------------------------------------------------------   [1500]
Microbiota        GAAGTTATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGATACGATTGATCGCTTGT   [1500]
Neocallitris      GAAGTGANCC------------------------------------------------------------------------------------------   [1500]
Papuacedrus       GAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGATACGATTGATCGCTTGT   [1500]
Platycladus       GAAGTGATCCGAGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGCGAAGTATGGAAGGAAATCAAATTTGAATTTGATACGATTGATCGCTTGT   [1500]
Sequoia           GAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGAT----------------   [1500]
Sequoiadendron    GAAGTGATCCGAGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAATATGGAAAGAAATCAAATTTGAATTTGATACGATTGATCGCTTGT   [1500]
Taiwania          GAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGAT----------------   [1500]
Taxodium          GAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTA-------------------------------------------------------------   [1500]
Tetraclinis       GAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGATACGATTGATCGCTTGT   [1500]
Thujopsis         GAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGATACGATTGATCGCTTGT   [1500]
Thuja             GAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGATACGATTGATCGCTTAT   [1500]
Actinostrobus     GAAGTTATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGATACGATTGATCGCTTGT   [1500]
Widdringtonia     GAAGTGAT--------------------------------------------------------------------------------------------   [1500]
Austrocedrus      GAAGTGAT--------------------------------------------------------------------------------------------   [1500]
Xanthocyparis     ----------------------------------------------------------------------------------------------------   [1500]
Agathis           GATATTATCCGTGAAGCAGCTAA-----------------------------------------------------------------------------   [1500]
Araucaria         GAAATTATCCGTGAAGCAACTAAATGGAGTCCTGAACTAGCTGCTGC-----------------------------------------------------   [1500]
Wollemia          GAGATTATCCGTGAAGCAGCTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCACATTTGTATTTGATACGATTGATACCTTAT   [1500]
Torreya           GAAGTGATTAGCGAAGCAGCTAAATGGAGTCCTGAACTAGCTGCTGCT----------------------------------------------------   [1500]
Taxus             GAAGTGATCCGCGAACGTACTAAAT---------------------------------------------------------------------------   [1500]
Amentotaxus       ----------------------------------------------------------------------------------------------------   [1500]
Pseudotaxus       GAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCTGC-----------------------------------------------------   [1500]
Austrotaxus       GAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGC-----------------------------------------------------   [1500]
Cephalotaxus      GAAGTGATCCGAGAAGCCACTAAATGGAGTCCTGAACTA-------------------------------------------------------------   [1500]
Sciadopitys       GAAGTGATCCGTGAAGCTTGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCAAATTTGAATTTGAT----------------   [1500]
Pinus             GAAGTGATCCGTGAAGCTTCTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAATATGGAAGGAGATCAAATTTGAATTTGATGCGATTGATGTCTTGT   [1500]
Picea             GAAGTGATCCGTGAAGCTAGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAATATGGAAGGAGATCAAATTTGAATTTGAGGCAATGGATACCTTGT   [1500]
Cathaya           GAAATTATCCGGGAAGCTTCTAAATG##########################################################################   [1426]
Larix             GAAGTGATCCGTGAAGCTACTAAATG--------------------------------------------------------------------------   [1500]
Abies             GAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATTTGATACGATTGATTACTTGT   [1500]
Pseudotsuga       ####################################################################################################   [1396]
Tsuga             GAAGTTGTTCGTGAAGCTTGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATTTGATACGATTGATTACTTGT   [1500]
Nothotsuga        GAAATTATTCGTGAAGCTTCTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAATATGGAAGGAAATCAAATTTGAATTTGATACGAT-----------   [1500]
Cedrus            GAAGTGATCCGTGAAGCTAGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCAAATTTGAATTTGAGGCGATTGATGTCTTGT   [1500]
Pseudolarix       GAAGTGATCCGTGAAGCTAGTAAATG--------------------------------------------------------------------------   [1500]
Keteleeria        GAAGTGATCCGTGAAGCTGCTAAATG--------------------------------------------------------------------------   [1500]
Phyllocladus      GAAGTGATCCGTGAAGCTTGTAAATGGAGTCCCGAACTAGCTGCTGC-----------------------------------------------------   [1500]
Lagarostrobos     ----------------------------------------------------------------------------------------------------   [1500]
Prumnopitys       GAAGTGATCCGTGAAGCTGGTAAGCGGAGTCCCGAACTTG------------------------------------------------------------   [1500]
Dacrydium         GAAGTGATCCGTGAAGCTTGTAAATGGAGT----------------------------------------------------------------------   [1500]
Dacrycarpus       GAAGTGATCCGTGAAGCTAGCAAATGGAGTCCCGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCATATT--------------------------   [1500]
Podocarpus        GAAGTGATCCGTGAAGCTAGTAAATGGAGTCCCGAACT--------------------------------------------------------------   [1500]
Nageia            GAAGTGATCCGTGAAGGTAGCAAATGGTGTCCAGACCTAGC-----------------------------------------------------------   [1500]
Microstrobos      GAAGTGATCCGTGAAGCTAGTAAATGGAGTCCCGAACG--------------------------------------------------------------   [1500]
Microcachrys      GAAGTGATCCGAGA--------------------------------------------------------------------------------------   [1500]
Saxegothaea       GAAGTGATCCGTGAAGCTTGTAAATGGAGTCTCGAACTGGCTGCTGCT----------------------------------------------------   [1500]
Acmopyle          GAAGTGATCCGTGAAGCTAGTAAATGGAGTCCC-------------------------------------------------------------------   [1500]
Falcatifolium     GAAGTGATCCGTGAAGCTTGTATTTGGAGTGCCGAACTAG------------------------------------------------------------   [1500]
Manoao            GAAGTGATCCGTGAAGCTAACAA-----------------------------------------------------------------------------   [1500]
Lepidothamnus     GAAGTGATCGGTGAAGCTGGCCAAGAGAGT----------------------------------------------------------------------   [1500]
Halocarpus        GAAGTGATCCGTGAAGCTAGTAAATGGAGTCCCGAG----------------------------------------------------------------   [1500]
Afrocarpus        GAAGTGATCCGTGAAGCTAGCAAATGGAGTCCCGAACT--------------------------------------------------------------   [1500]
Retrophyllum      GAAGTGATCCGTGAAGCTAGTGAACGGAGTCCAG------------------------------------------------------------------   [1500]
Sundacarpus       CAAGTGATCCGCGAAGCTGCTACATGGAGTCCAGAATTA-------------------------------------------------------------   [1500]
Parasitaxus       GAAGTGATTCGTGAAGCTACTAAATGGAGTCCCG------------------------------------------------------------------   [1500]
Cycas             GAAGTGATCCGCGAAGCTAGTAAATGGAGTCCCGAATTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATTTGAGGCAATGGATGTCTTGT   [1500]
Ginkgo            GAAGTGATCCGTGAAGCTAGTAAATGGAGTCCCGAACTAGCCGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATTTGATACGGTTGATGTCTTG-   [1500]

[                   ]
[                   ]

Athrotaxi         --   [1502]
Callitris         --   [1502]
Cupressus         --   [1502]
Callitropsis      --   [1502]
Chamaecyp         --   [1502]
Calocedru         --   [1502]
Cryptomer         AA   [1502]
Cunninghamia      AA   [1502]
Diselma           AA   [1502]
Fitzroya          AA   [1502]
Fokienia          AA   [1502]
Glyptostrobus     --   [1502]
Juniperus         --   [1502]
Libocedrus        AA   [1502]
Pilgerodendron    AA   [1502]
Metasequoia       --   [1502]
Microbiota        AA   [1502]
Neocallitris      --   [1502]
Papuacedrus       AA   [1502]
Platycladus       AA   [1502]
Sequoia           --   [1502]
Sequoiadendron    AA   [1502]
Taiwania          --   [1502]
Taxodium          --   [1502]
Tetraclinis       AA   [1502]
Thujopsis         AA   [1502]
Thuja             AA   [1502]
Actinostrobus     AA   [1502]
Widdringtonia     --   [1502]
Austrocedrus      --   [1502]
Xanthocyparis     --   [1502]
Agathis           --   [1502]
Araucaria         --   [1502]
Wollemia          AA   [1502]
Torreya           --   [1502]
Taxus             --   [1502]
Amentotaxus       --   [1502]
Pseudotaxus       --   [1502]
Austrotaxus       --   [1502]
Cephalotaxus      --   [1502]
Sciadopitys       --   [1502]
Pinus             AA   [1502]
Picea             GA   [1502]
Cathaya           ##   [1426]
Larix             --   [1502]
Abies             AA   [1502]
Pseudotsuga       ##   [1396]
Tsuga             AA   [1502]
Nothotsuga        --   [1502]
Cedrus            AA   [1502]
Pseudolarix       --   [1502]
Keteleeria        --   [1502]
Phyllocladus      --   [1502]
Lagarostrobos     --   [1502]
Prumnopitys       --   [1502]
Dacrydium         --   [1502]
Dacrycarpus       --   [1502]
Podocarpus        --   [1502]
Nageia            --   [1502]
Microstrobos      --   [1502]
Microcachrys      --   [1502]
Saxegothaea       --   [1502]
Acmopyle          --   [1502]
Falcatifolium     --   [1502]
Manoao            --   [1502]
Lepidothamnus     --   [1502]
Halocarpus        --   [1502]
Afrocarpus        --   [1502]
Retrophyllum      --   [1502]
Sundacarpus       --   [1502]
Parasitaxus       --   [1502]
Cycas             AA   [1502]
Ginkgo            --   [1502]
;
END;

BEGIN paup;

exclude 1-95;
outgroup Ginkgo;
END;