phyP20140910.nex

#NEXUS

[written Wed Sep 10 15:56:30 CDT 2014 by Mesquite  version 3.0 (build 644) at Davids-MacBook-Pro.local/192.168.100.8]


BEGIN TAXA;

TITLE Taxa;

DIMENSIONS NTAX=38;

TAXLABELS

Ginkgo_biloba_SM Sciadopitys_verticillata Araucaria_columnaris_JX559989 Podocarpus_macrophyllus_JX560047 Cephalotaxus_sinensis_JX559896 Cryptomeria_japonica Abies_contorta_P1 Abies_lasiocarpa_P1 Abies_mariesii_P1 Cathaya_argyrophylla_P1 Cedrus_deodara_P1 Keteleeria_evelyniana_P1 Larix_decidua_P1 Larix_occidentalis_P1 Nothotsuga_longibracteata_P1 Picea_abies_P1 Picea_glauca_P1 Picea_sitchensis_P1 Pinus_contorta_P1 Pinus_krempfii_P1 Pinus_lambertiana_P1 Pinus_monophylla_P1 Pinus_nelsonii_P1 Pinus_pinea_P1 Pinus_ponderosa_P1 Pinus_thunbergii_P1 Pseudolarix_amabilis_P1 Pseudotsuga_menziesii_P1 Tsuga_canadensis_P1 Abies_concolor_P2 Abies_lasiocarpa_P2 Cathaya_argyrophylla_P2 Larix_laricina_P2 Picea_abies_P2 Picea_glauca_P2 Pinus_strobus_P2 Tsuga_chinensis_P2 Tsuga_heterophylla_P2 

;


END;



BEGIN CHARACTERS;

TITLE  'Matrix in file "phyP-20140910.nex"';

DIMENSIONS  NCHAR=1980;

FORMAT DATATYPE = DNA GAP = - MISSING = ?;

MATRIX

Ginkgo_biloba_SM                  ??ATATTTATCTCGTATGCAAAGAGGAGGCGCAATACAACCCTTTGGATGTATGCTGACGGTGGAGGACATTACATTTAGAATTATAGCTTACAGTGAAAACGCAGTAGAAATGCTGGATCTCATTCCTAATTCG------------------------------GTCCCA------TCCATGGAGCAACAACAA------------------------CAAGAAGAAGTCCTAGCCATTGGGACCGATGTTCGAACCCTATTCACTCCTTCCAGTGCTCTGTCTTTAGAAAAAGCTGCAGCTGCCAAGGAAATTTCCCTGATGAACCCCATTTGGATGCACTGTAAACACTCTGGCAAGCCCTTCTATGCAATTGTTCATAGGATTGATGTTGGCATGGTGATAGATTTTGAGCCTGTCAAGACT---------------GGCGATGCTTCATTGTCAGCA------------------------GCAGGTGCAGTTCAATCACAGAAGCTTGCTGTCAGAGCCATTTCGCGCTTGCAGTCTATTCCGGGTGGTGATATTAGTCTGCTTTGTGATACTGTTGTTGAGGATGTCAGGGACCTCACTGGTTATGATAGAGTTATGGTATACAAGTTTCATGAGGACGAGCATGGCGAAGTTGTTGCAGAAATTAGGCGGTCGGATTTAGAACCTTATCTTGGGTTGCATTATCCTGCCACTGATATCCCTCAGGCTTCTCGGTTTCTTTTTATGCAGAACAGAGTGAGAATGATCTGTGATTGCTGTGCAACTCCTGTTAAGGTTATTCAAGATGAGGAATTGAGGCAGCCCCTCTGTTTGGTAGGTTCAACACTACGGGSGCCCCATGGGTGTCATGCACAATACATGGCAAATATGGGTTCGATTGCTTCCCTTGTTATGGCTGTGATAATCAATGGAACT------GATGAAGAAGSA------------------TTAAGCGGGCGTARTTCAATGAAGCTTTGGGGTYTGGTTGTGTGCCATCACACCTCCCCTCGTGCGGTCCCATTTCCTCTCCGTTATGCTTGTGAATTTCTGATGCAAGCATTTGGCCTTCRGCTGAACATGGAATTACAATTGGGGGCCCAATTGMMMGAGAAACACATTCTTAGAACTCAAACACTTTTGTGTGAYATGCTTCTCCGAGATGCCCCAATTGGAATTGTGACTCAGTCTCCGAGTATTATGGATCTTGTCAARTGTGACGGCGCWGCTTTGTACTATGGGGGCATGTTTTGGTTGCTAGGAGTGACCCCAACTGAAGCTCAAATAAAGGATATTGCAGATTGGTTACTTGAATACCATGCGGATTCGACAGGCCTGAGCACAGACAGTTTGGCAGATGCTGGTTATCCAGGTGCTCCTTCTCTTGGGGATGCAGTCTGTGGCATGGCTGCTGCCAGAATTACATCAAAAGACTTTTTGTTTTGGTTTAGATCCCATACTGCAAAAGAGATGAAGTGGGGAGGGGCAAAACATCATCCAGATGATAAGGATGATGGGCGGAGAATGCATCCTCGCTCCTCATTCAAGGCGTTTCTAGAAGTGGTGAAGAGAAGAAGTCTGCCTTGGGAAAATGTGGAAATGGATGCAATTCACTCCCTACAGCTTATTCTACGAGGTTCATTTCAAGATATTGACGACAGTGATACTAAAACCATGGTTCATGCTCGGCTAAATGATTTAAAATTGCAGGGCATAGATGAGCTTAGTTCCGTCGCAAGTGAGATGGTGCGGTTGATYGAAACAGCAACAGCACCTATTTTGGCTGTAGATTCTGGTGGGCTTGTTAATGGGTGGAATGCAAAAGTTGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCTATGGGGAAGTCCTTAGTTCATGATCTTGTCTTTGAAGAATCCGTGGAAACTGTTGAAAAGTTGCTCTACCACGCTTTAAGAGGTACACTTTTT

Sciadopitys_verticillata          ?????????????????????????????????????????????GGATGCATGTTGGCGGTTGAGGAAAGCAGCTTCAATATCATTGCGTACAGTGAGAATGCAGTAGAGATGCTGGATCTCATGCCACATTAT------------------------------GTTCCTGTTAACAACATGGAAATGGAA---------------------------GGAGGAGGAGTGCTGAGAATAGGGACAGACGCGAGGAGCTTGTTCAGTCCGTCAAGTGCGAGGGCCATGGAGAAGGCTGCGATGGCGCAGGAGATAAGCCTGATGAACCCCATCTGGATGCACTGCAAGAAGAGTGGGAAGCCCTTCTATGCAATTCTCCATAGGATTGATGTTGGACTGGTCATAGATTTTGAGCCAGTGAGAACAGGG------------GGGGATGCGTCCCTGTCAGCA------------------------GCAGGGGGAGTGCAATCACAGAAGCTTGCAGTGAGGGCAATCTCACGCCTCCAGTCTCTCCCTGCGGGGGACATTGGGCTTCTTTGTGACACTGTTGTTGAGGACGTGAGAGAGCTGACTGGTTATGATAGGGTTATGGTTTATAAATTTCACGAAGATGAACACGGGGAAGTTGTTTCCGAAATCAGGAGGTCTGACTTGGAACCCTATCTAGGATTGCATTATCCTGCTACCGATATTCCTCAGGCTTCCAGGTTTCTCTTCATGCAGAACAGGGTAAGAATGATCTGTGATTGCTGTGCAACTCCTGTCAAGGTCGTACAGGCTGAGGAATTGAAGCAACCTCTATGTTTGGTGGGTTCCACATTACGGGCACCCCATGGATGCCATGCCCAGTACATGGCCAATATGGGTTCCATTGCTTCTCTTGTCATGGCTGTTATTATAAATGGGAAT------GATGAGGAAGGCGCA------------------AGTGGGAGAAGTTCCATGAAGCTCTGGGGATTGGTTGTTTGCCATCACACCTCCCCGCGAGCAGTGCCATTTCCTCTTCGCTATGCTTGTGAATTTCTGATGCAAGCATTTGGCCTTCAGCTTAACATGGAATTGCAATTGGCTGCTCAATTGACGGAGAAGCACATTCTTAGGACTCAGACTCTTCTCTGTGATATGCTTCTCCGAGATGCCCCCATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGCGCTGCTCTATATTATGGGGGCATGTTCTGGTTGCTTGGAGTGACACCAACTGAAGCTCAAATAAAGGATATTGCACACTGGTTGCTCGAATACCATGGGGATTCAACGGGTCTGAGCACAGACAGTTTGGCGGATGCTGGTTATCCGGGTGCAGCGTCTCTTGGGGATGCTGTTTGTGGTATGGCTGCTGCTAGAATCACATCAAAAGACTTCTTGTTCTGGTTTAGATCCCACACTGCAAAAGAGATGAAGTGGGGAGGTGCAAAGCATCATCCAGATGATAAAGATGATGGTCGAAGAATGCACCCTCGTTCCTCATTTAAGGCATTCCTAGAAGTTGTCAAAAGAAGAAGCTTGCCATGGGAAAATGTTGAAATGGATGCAATTCACTCGCTACAGCTTATTCTGCGCGGGTCCTTTCAAGACATCGATGACAGTGATACTAAAACCATGGTTCATGCTCGGCTAAATGATTTGAAATTGCAAGGCATAGATGAGCTTAGCTCTGTGGCAAGTGAGATGGTGCGTTTGATCGAAACTGCTACAGCACCTATTTTGGCTGTTGATTCTAGTGGGCTTATAAACGGATGGAATGCAAAGGTGGCAGAATTGACAGGCCTTCCAGTTAGAGAAGCTATGGGAAAGTCACTCGTTCATGACCTTGTTTTTGAAGAATCTGCAGAGGCTGCGGAGAAAATGCTCTATCACGCCCTAAGAGGA?????????

Araucaria_columnaris_JX559989     GCATATCTGTCGCGAATGCAAAGGGGGGGCACCATTCAGCCTTTCGGATGCATGCTCGCCGTGGAGGAGACCACTTTCCTAATCATCGCATACAGCGAGAACGCGGTGGAAATGCTGGATCTCATGCCTCAGTCT------------------------------GTACCC------AACATGGACATGGACAGAGACGAAGCCATGACAAGTCACGGCGGAGGAAGGGTTATGACAATTGGGACGGATGTACGGACTTTGTTCACTACGTCGAGCGCCCGCGCGCTGGAGAGAGCAGCGATGGCCCATGAAATAAGCCTGATGAATCCCATCTGGGTCCACTCTAAGAATACGAACAAGCCCTTCTACGCCATCGTCCACAGGATTGATGTTGGCATGGTCATGGACTTGGAGCCCGTCAGGACTGGCAGCGGCGGCGGAGGCGATGCAGCGTTGTCGGCG------------------------GCGGGTGCCGTGCAGTCACAGAAGCTGGCGGTGCGGGCCATCTCCCGCCTCCAGTCGCTGCCTGCGGGGGACATTGGTCTTCTATGCGACACCGTCGTCGAAGACGTCAGAGAGCTCACTGGCTACGACAGGGTTATGGTCTACAAGTTTCACGAAGACGAGCATGGGGAAGTCCTTGCAGAAATCAGGCGCTCTGACTTGGAACCCTATCTGGGACTTCATTATCCGGCTACTGATATCCCTCAGGCATCTCGCTTTCTTTTCATGCAGAACAGGGTCCGGATGATCTGTGATTGCCGTGCCGCTCCTGTTAAAGTCATACAGGCGGAGGAACTGAAGCAGCCCCTGTGTTTGGTGGGTTCTACATTGCGGGCGCCCCATGGATGTCATGCCCAGTACATGGCCAACATGGGTTCCATCGCCTCGCTTGTTATGGCTGTCGTCATCAATGGAAACGAAGACGAAGGAGGAGGGGGAGGTGGAAGCGGAAGCGGAAGCGGGCGAGGTTCCATGAAGCTGTGGGGGTTGGTTGTTTGCCATCACACGTCCCCGCGGGCGGTTCCGTTTCCTCTGCGGTACGCGTGTGAGTTTCTGATGCAGGCATTCGGACTCCAGCTGAATATGGAATTGCAATTGGCTGCTCAGCTGACGGAGAAACACATTCTGAGGACGCAGACGCTGCTGTGCGACATGCTGCTGCGAGATGCACCCATCGGAATCGTCACTCATTCTCCGAGCATCATGGACCCTGTCAAGTGTGATGGCGCTGCCCTTTACTACGGGGGAATGTGCTGGATGCTGGGAGTGACGCCCACCGAGGCTCAAATAAAAGACATCGCGGACTGGTTGCTGGAATATCATGTGGATTCTACAGGCCTCAGCACTGATAGTTTGGCTGATGCGGGCTATCCCGGTGCAGCCTCTCTTGGGGATGCCGTCTGTGGCATGGCTGCTGCCAGAATTACATCAAAGGACTTTCTCTTCTGGTTTAGATCCCACACTGCAAAAGAGATGAAGTGGGGAGGTGCAAAGCACCATCCCGACGATAAAGACGACGGTCGAAGAATGCACCCTCGATCTTCTTTCAAGGCATTCCTGGAAGTCGTCAAAAGAAGAAGTTTGCCATGGGAAAACGTAGAAATGGATGCCATTCATTCATTGCAGCTGATTCTGCGCGGTTCTTTTCAAGACATTGATGACAGCAATACTAAAACCATGGTTCATGCTCGCCTAAATGATTTGAAATTGCAGGGCATAGACGAGCTTAGCTGTGTGGCAAGTGAGATGGTGCGTCTGATCGAAACGGCTACGGCACCTATTTTGGCTGTGGATTCAAACGGACTCATAAATGGATGGAATGCAAAGGTGGCGGAATTAACAGGTCTTCCTGTTGGAGAAGCTATGGGCAAGTCACTTGTTCATGACCTTATCTTCGAGGAATCTGCCAATACTGTGGACAAAATGCTCTATCACGCCCTACGAGGTACACTA???

Podocarpus_macrophyllus_JX560047  GCATATCTCTCTCGAATGCAGAGAGGAGGAACCATCCAACCCTTCGGCTGTGTGCTCGCAGTGGAGGAAACCAACTTCAAAATCATAGCTTATAGCCAAAACGCACTCGAAATGCTGGACCTCATGCCTCAGTCT------------------------------GTCCCC------ACTATGGAGCTGGGAAAA------------------CATGGAGGAGGAGAAGTACTTACTATAGGCACAGATGTACGTACCCTTTTCACACCCTCTAGCGCGCGAGCTCTGGAGAAGGCAGCCATGGCCCCAGACATAAGCTTGATGAACCCCATCTGGGTCCATTCCCATTACAGTGGAAAACCCTTCAACGCCATTGTTCACAGAATTGATGTGGGTATGGTGATAGATTTGGAGCCTCGGAGAACT---------------GGGGACGCTGCTATGTCAACA------------------------GCAGGAGCGGTGCAGTCCCAGAAGTTTGCTGTGAGAGCAATCTCCAGACTCCAGTCACTACCAACTGGTGACATTGGGCTGCTCTGCGATACTGTTGTGGAGGATGTGAGAGAGCTAACTGGGTATGACAGAGTCATGGTTTATAAATTCCATGAGGATGAGCATGGGGAAGTTGTTGCGGAGATTAGGCGTGCTGACTTGGAACCCTACCTAGGGTTGCATTACCCTGCGACGGATATACCCCAGGCTTCGAGGTTTCTGTTCATGCAGAACAGGGTGAGGATGATATGTGATTGCAGTGCAACTCCTGTGAAGATGATTCAGTCCGAAGAATTGAGGCAACCGCTTTGTTTGGTTGGGTCCACACTGCGAGCACCCCACGGATGCCATGCCCAGTATATGGCAAACATGGGATCCATTGCTTCGTTGGTAATGGCTGTGGTGATTAATGGAAAT------GATGAGGAAGGGGGAGGA------------ACAAGTGGCCGAAGTTCCATGAAGCTCTGGGGGTTAGTTGTTTGCCATCATACTTCGTCTAGGGCTGTATCTTTTCCCCTGCGCTATGCTTGTGAATTCCTGATGCAGGCATTTGGGCTTCAGCTCAATATGGAATTGCAATTGGCTGCGCAGTTGACTGAGAAACACATTCTTCGGACTCAGACACTTCTTTGTGACATGCTTCTGAGGGATGCACCCATTGGAATTGTGACTCAGTCTCCAAGTATTATGGACCTTGTTAAGTGTGATGGAGCTGCTCTATACTATGGGGGCACCACCTGGTGTCTTGGGGTGACTCCCACAGAAGCTCAGATCAAGGATATTGCAGAATGGTTGCTGGAATACCATGGGGATTCAACTGGTCTCAGCACTGATAGTTTGGCTGATGCTGGTTATCCTGGAGCAGCTACACTTGGGGATGCTGTTTGTGGAATGGCAGCAGCTCGAATTACATCAAAGGATTTTTTGTTCTGGTTTCGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAGCATCATCCTGATGATAAGGATGATGGCCGAAGAATGCATCCTCGATCATCATTTAAGGCATTCTTAGAAGTTGTCAAGAGAAGAAGTTTGCCGTGGGAGAATGTGGAAATGGATGCCATTCACTCACTACAGCTTATTCTACGAGGTTCATTTCAAGACATTGATGACAGCGGTACTAAAACGATGGTCCATGCTCGGTTGACTGACTTGAAATTACAGGGCATTGATGAGCTTAGCTCTGTGGCCAGTGAGATGGTCCGATTGATCGAAACAGCTACAGCACCAATTCTGGCTATAGATTCTAACGGGCTTGTTAATGGATGGAATGCTAAGGTGGCAGAATTGACAGGTCTTCCAGTTGGAGAAGCTATGGGCAAATCACTAGTTCATGACGTTGTTTTGGAAGAATCTGCAGAGTGTGTGGAGAAAATGCTTTATCGAGCTTTAAGAGGTACGCTTTTC

Cephalotaxus_sinensis_JX559896    GCATACCTCTCTCGTATGCAAAGAGGAGGAAGCATTCAGCCATTCGGATGCATGCTTGCTGTTGAGGAAACCAGCTTCAAAATCATTGCATACAGTGAAAACGCACTTGAAATGCTGGATGTGATGCCGCACTCTCACTCTCACTCTCACTCTCACTCCCACTCTGTTCCC------ACCATGGAAGGAGGAGAA------------------------AGTGAAGGCATCGTGACAATCGGGAGTGATGTGCGGAGGCTGTTCACCCCATCCAGTGGGCGCAACTTGGAGAGGGCTGCGATGTCCCAGGAAATAAGCCTGGCCAACCCAATTGCCATGGACTCC---AGCAGTGGCAAGCCCTTCTATGCAATTGTGCACAGGATTGATGTTGGCATAGTCATAGATTTAGAGCTGGTGAGGAGA---------------GGTGATGCGGCAGCTTTGGTGTCATGGGGAGGGGGTGGCCTGGGGGGAGGGACTGTGCCATCCCAGAGACTTGCGGTGAGGGCAACGTCGAGACTGCAGGCAGTGCCAAGTGGGGACATTGGTCTGCTGTGTGACACTGTTGTGGAGGAAGTCAGGGAGCTCACTGGCTATGACAGGGTTATGGTTTACAAGTTTCATGAAGACGAGCATGGTGAAGTTGTGGCAGAAATCAGGCGCTCTGACTTGGAGCCCTACCTTGGACTACATTATCCTGCCACTGATATTCCTCAGGCATCTCGCTTTCTATTCATGCAGAACCGGGTACGGATGATCTGTGATTGCCGTGCCACTCCTGTCAAAGTTATACAGGCGGAAGAATTGAAGCAGCCCCTCTGTTTGGTGGGTTCCACATTGCGGGCGCCCCATGGTTGTCATGCTCAGTACATGGCCAATATGGGTTCCATTGCTTCTCTTGTTATGGCTGTCATCGTCAATGGTAATGGAAATGATGAAGATGGG------------GTAAGTGGAAGTGGCCGAAGTTCGATGAAGCTTTGGGGGCTGGTTGTTTGCCATCATACTTCACCGCGAGCTGTTCCATTTCCTCTTCGCTCTGCATGCGAATTTCTGATGCAGACATTTGGCCTTCAGATTAACATGGAATTGCAATTGGCTGCTCAATTAACAGAAAACAACATTCTTAGGACTCAGACACTTCTGTGCGATATGCTTCTCCGAGATGCACCTATTGGAATTGTAAGCCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGCGCTGCTCTGTACTATGGGGGCATGCTCTGGTTGCTGGGAGTGACCCCTGTGGAGGCTCAAATAAAGGATATTGCAGACTGGTTGCTTGAATGCCACGGGGATTCAACAGGTTTGAGCACGGATAGTTTAGCAGATGCTGGTTATCCCGGTGCAGCATCTCTTGGGGACGCTGTCTGTGGTATGGCTGCTGCTAGAATCACATCAAAAGATTTTTTGTTCTGGTTTAGATCCCACACTGCAAAAGAGATGAAGTGGGGAGGTGCGAAGCATCATCCTGATGATAAAGATGATGGCAGGAGAATGCACCCACGTTCCTCATTTAAGGCATTCCTAGAAGTCGTCAAGAGAAGAAGTTTGCCATGGGAAAATGTAGAAATGGATGCAATTCACTCTCTACAGCTTATTCTACGTGGTTCATTTGAAGGCATTGATGACAGTGATACGAAAACCATGGTTCATGCTCGGTTAAATGATTTAAAATTGCAGGGTATAGATGAGCTTAGCTCTGTGGCAAGTGAGATGGTACGTTTGATCGAAACAGCTACAGCACCTATTTTGGCTGTGGATTCTACCGGGATTGTAAATGGATGGAATGCAAAGGTGGGAGAATTGACAGGCCTT????????????????????????????????????????????????????????????????????????????????????????????????????????????

Cryptomeria_japonica              ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------??????------???????????????---------------------------???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------GAGGCGGCGGCTTTTGGGGCGTGGGGAGGAGCAGAGGGCGTCGCAGGAGGGGCTGTGCCGTCGCAGAGACTGGCCGTGAGGGCAACGTCGAGGCTGCAGGCTGTGCCCAACGGGGATATCGGTCTGCTTTGCGATGCTGTTGTTGAGGAAGTCAGGGAACTCACTGGGTATGACAGGGTTATGGTTTACAAGTTTCATGAAGATGAGCATGGGGAGGTTGTTGCAGAAATTAGGCGCTCTGACTTGGAGCCCTACCTTGGACTACATTATCCTGCCACTGATATTCCCCAGGCATCCCGGTTTCTTTTCATGCAGAACAGGGTGCGTGTGATCTGTGATTGCCGTGCTAATCCTGTCGGAGTCATACAGGTGGAGGAATTAAAGCAGCCCCTCTGTTTGGTGGGTTCTACGCTAAGGGCACCCCACGGTTGTCATGCTCAGTACATGGCTAATATGGGCTCAATTGCTTCTCTTGTTATGGCTGTAATTGTCAATGGAAATGGAAACGATGAAGAAGGC------------------AGCAGCGGGCGA------GTGAAGCTTTGGGGTTTGGTTGTTTGTCATCACACTTCACCTCGAGCCGTTCCCTTTCCCCTTCGCTCCGCTTGTGAATTTCTGATGCAGACATTTGGTCTTCAGATTAATATGGAAATGCAATTGGCTGCTCAATTGACAGAGAATAACATTCTTAGGACTCAAACACTTCTCTGTGATATGCTTCTCCGAGACGCACCTATTGGAATTGTAACCCAGTCTCCTAGTATCATGGATCTTGTTAAGTGTGATGGTGCTGCCCTTTACTACGGGGGTAAGTTCTGGTTGCTCGGAGTGACCCCCACGGGAGCTCAAATTAAGGACATTGCAGACTGGTTGCTTGAATACCACGGGGATTCAACAGGTTTGAGCACAGATAGTTTAGCAGATGCTGGCTACCCGGGTGCAGCATCCCTTGGGGATGCTGTCTGTGGTATGGCTGCTGCTAGAATCACATCAAAAGATTTTTTGTTCTGGTTTAGATCTCACACTGCAAAAGAGATGAAATGGGGAGGAGCAAAGCATCATCCCGATGATAAAGATGATGGTCGGAGAATGCACCCTCGTTCTTCATTCAAGGCATTCCTAGAAGTTGTCAAAAGAAGAAGCTTGCCATGGGAAAATGTAGAAATGGATGCAATTCACTCTCTGCAGCTTATCCTACGTGGTTCATTTCAAGACATTGATGACAGTGAAACTAAAACTATGGTTCATGTTCAGCTACATGATTTAAAATTGCAGGGCATTGATGAGCTTAGCTCCGTGGCAAATGAGATGGTGCGATTGATTGAAACAGCTACTGCACCTATTTTAGCTGTAGATTCTGCTGGAATTGTGAATGGATGGAATGCAAAGGCGGCAGAATTGACAGGACTTCCAGTTGGAGAAGCTATGGGCAAGTCATTAGTTCATGACCTTGTTTTTGAAGAATCTATGGAGACTGTGGAAAAAATGCTCTATCATGCTCTGAGAGGTACATTTTTT

Abies_contorta_P1                 GCATATTTATCTCGAATTCAAAGAGGGGGAAGAGTACAGCCGTTTGGGTGTGTGCCGGCAGTGGAGGAGACCACTTTTAGGATCATCGCCTACAGTGAGAACGCACTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCATGGAACAGCCT---------------------------CAACAAGAAGTTCTGACAATCGGGACTGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTAACTCATTGGAAAAGGCAGCGGTGGCCCACGAAATAAGCCTTATGAACCCTATATGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGAATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAGGATT---------------GGGGATGCGTTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTACCTTCCGGTGATATCGGACTGCTGTGTGACACTGTTGTGGAGAATGTGAGAGAGCTGACTGGGTATGATAGGGTAATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTCGCGGAAATTAGGCGTTCAAACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTTCTCGCTTTTCTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCATGCGCAATACATGGGCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGCGGGAGGT---------------ACTGGACGAAATTCCTTGAAGCTCTGGGGTTTGGTTGTTTGCCACCATACCTCCCCGCGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTGAAGACTCAAACACTTCTGTGTGATATGCTTCTCCGAGATGCCCCTATTGGAATTGTAACTCAGTCTCCCAGTATAATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTCATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGACATTGCAGATTGGTTGCTTGAACACCATGGGGATTCAACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCGAGTGCCGCCTCTCTTGGGGATGCTGTCTGTGGCATGGCTTCCGCTAGAATCACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGATAAGGACGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTCATTCTACGAGGTTCATTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGCGCTTGCAGGGCATAGATGAACTTAGCTCTGTGGCTAGTGAGATGGTGCGTTTGATCGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCAAATGGACTTGTAAATGGGATGGAATGCAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTAGTTCAGGATCTTCTTTTTGAAGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATTCCTTTT

Abies_lasiocarpa_P1               GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTGGCAGTGGAGGAGACCACTTTTAGGATCATCGCCTACAGTGAGAACGCACTGGAAATGTTGGATCTGGCGCCACAGTCT------------------------------GTCCTG------AGCATGGAACAGCCT---------------------------CAACAAGAAGTTCTGACAATCGGGACTGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTAACTCATTGGAAAAGGCAGCGGTGGCCCACGAAATAAGCCTTATGAACCCTATATGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGAATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTACCTTCCGGTGATATCGGACTGCTGTGTGACACTGTTGTGGAGAATGTGAGAGAGCTGACTGGGTATGATAGGGTAATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATTAGGCGTTCAAACTTGGAGCCCTATCTGGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAAGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCATGCGCAATACATGGGCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGCGGGAGGT---------------ACTGGACGAAATTCCTTGAAGCTCTGGGGTTTGGTTGTTTGCCACCATACCTCCCCGCGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTGAAGACTCAAACACTTCTGTGTGATATGCTTCTCCGAGATGCCCCTATTGGAATTGTAACTCAGTCTCCCAGTATAATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTCATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGACATTGCAGATTGGTTGCTTGAACACCATGGGGATTCAGCGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCGGGTGCCGCCTCTCTTGGGGATGCTGTCTGTGGCATGGCTTCCGCTAGAATCACTTCAAAGGAATTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGATAAGGACGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCACTTCTAGAAGTGGTCAAAAGAAGAAGCTCACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTCATTCTACGAGGTTCATTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGCGCTTGCAGGGCATAGATGAACTTAGCTCTGTGGCTAGTGAGATGGTGCGTTTGATCGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCAAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTAGTTCAGGATCCTCTTTTTGAAGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATTCCTTTT

Abies_mariesii_P1                 GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGGTGCGTGCTGGCAGTGGAGGAGACCACTTTTAGGATCATCGCCTACAGTGAGAACGCACTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCGTGGAACAGCCT---------------------------CAACAAGAAGTTCTGACAATCGGGACTGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTAACTCATTGGAAAAGGCAGCGGTGGCCCACGAAATAAGCCTTATGAACCCTATATGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGAATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAGGAAT---------------GGGGATGCGTTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTACCTTCCGGTGATATCGGACTGCTGTGTGACACTGTTGTGGAGAATGTGAGACAGCTGACTGGGTATGATAGGGTAATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATTAGGCGTTCAAACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAAGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCATGCGCAATACATGGGCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGCGGGAGGT---------------ACTGGACGAAATTCCTTGAAGCTCTGGGGTTTGGTTGTTTGCCACCATACCTCCCCGCGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAAAACATTCTGAAGACTCAAACACTTCTGTGTGATATGCTTCTCCGAGATGCCCCTATTGGAATTGTAACTCAGTCTCCCAGTATAATGGATCTTGTCAGGTGTGATGGTGCTGCTCTTCATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGACATTGCAGATTGGTTGCTTGAACACCATGGGGATTCAACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCGGGTGCCGCCTCTCTTGGGGATGCTGTCTGTGGCATGGCTTCCGCTAGAATCACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAAGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGATAAGGACGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCGTGGGACAATGTGGAGATTGATGCAATTCACTCGCTACAGCTCATTCTACGAGGTTCATTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGCGCTTGCAGGGCATAGATGAACTTAGCTCTGTGGCTAGTGAGATGGTGCGTTTGATCGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCAAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTAGTTCAGGATCTTCTTTTTGAAGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATTCCTTTT

Cathaya_argyrophylla_P1           ??????TTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTCGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGCGAACGCAGTGGAAATGCTGGATCTGGCGCCACAATCT------------------------------GTCCCG------AGCATGGAGCAACCT---------------------------CAACCAGAAGTTCTGACAATCGGGACCGACGTTCGAATCCTGTTCACTGCTGCCAGTGCTCACTCATTGGAAAAAGCAGCCGTAGCCCAAGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGAATGGTGATAGATTTTGAGCCCTTGAAGAGT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCGGTACAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATATCGGCTTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAATTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTCTCGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCAGCCACAGATATCCCACAGGCATCTCGATTTCTTTTTATGCAAAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCAGTGAAGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCACCCCACGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTCATGGCTGTGATTATTAATGGGAAT------GATGACGAAGGAGGATGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCTCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACGGAAAAACACATCCTTAGGACTCAAACTCTTCTCTGTGATATGCTTCTCCGAGATGCCCCAATTGGGATTGTAACTCAGTCTCCTAGTATCATGGATCTTGTCAAATGTGATGGTGCTTCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCCACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCAGGTGCCCCTTCTCTTGGGGATGCGGTCTGCGGCATGGCTTCCGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGCGGAGCAAAACATCACCCAGATGATAAGGACGATGGCCGGAGGATGCACCCTCGATCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTGAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCAGCTAAATGATTTGAGATTACAGGGCATAGACGAACTTAGCTCTGTGGCTAGCGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACCGGCCTTTCAGTTGGAGAAGCTATGGGCATGCCCCTTGTTCAGGATCTTGTTTTAGGGGACTCTGTGGAGAGGGTTGAAAAAATGCTATACAATGCCTTAAGAGGG?????????

Cedrus_deodara_P1                 GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCCTTTGGGTGTGTGCTCGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGTGTCACAGTCT------------------------------GTCCCC------AGCATGGAACAACCT---------------------------CAGTCAGAAGTTCTGACAATTGGGACCGACGTTCGAACTCTGTTCACTGCGGCCAGTGCTCACTCATTGGAAAAGGCAGCCATGGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAAGACT---------------GGGGATGCGTTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCAATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATATTGGTCTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAGCTGACTGGGTATGATAGGGTTATGGTATACAAGTTCCATGAAGACGAACACGGGGAGGTTGTTGCGGAAATTAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTTCTCGCTTTCTCTTTATGCAGAACAGGGTACGAATGATCTGTGATTGCATGGCAACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTCTGTTTAGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCACGCGCAATATATGGCCAACATGGGTTCCGTTGCTTCACTTGTTATGGCGGTGATTATTAATGGGAAC------GATGATGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCCTTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATACTTAGGACTCAAACGCTTCTGTGTGACATGCTTCTCCGAGATGCCCCAATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAACCCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACTGCGATTCAACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCGGGTGCCGCCTCTCTTGGGGATGCAGTCTGTGGCATGGCTTCCGCTAGAATTACTTCGAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGATAAGGATGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCATTCGCTACAGCTTATTCTACGAGGTTCATTGCAAGATATTGATGACAGTAGTACTAAAACTATGGTTCATGCCCGGCTAAATGATTTGAGATTGCAGGGCATAGATGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTAGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTGGAGGAGTCTGTGGAGAGGGTTGACAAAATGCTCGACAATGCCATAAGAGGTATTCATTTT

Keteleeria_evelyniana_P1          GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCCTTTGGGTGTGTGCTGGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCACTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCATGGAACATCCT---------------------------CAACCAGAAGTACTGAAAATCGGGACGGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTCATTCATTGGAAAAGGCAGCGGTAGCCCATGAAATAAGCCTTATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTAGGGATGGTGATAGATTTTGAGCCCCTCAGGACT---------------GGGGACGCGTTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATGTCGGACTGCTGTGTGATACTGTTGTGGAGAATGTGAGAGAGCTGACTGGGTATGATAGGGTCATGGTATACAAATTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATCAGACGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGACATCCCTCAGGCTTCTCGCTTTCTATTTATGCAGAATAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAGGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGCGGCAGGA---------------AGTGGACGAAATTCTATGAAGCTCTGGGGTTTGGTCGTTTGCCACCATACCTCCCCGCGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTTAAGACTCAAACACTTCTGTGTGATATGCTTCTCCGAGATGCCCCAATCGGAATCGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGATTGGTTGCTTGAACACCATGGTGATTCAACAGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCCGGTGCCGCCTCTCTTGGGGATGCAGTCTGTGGCATGGCTTCCGCTAGAATTACTTCAAAAGATTATCTTTTTTGGTTTAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGACGATAAGGACGATGGCCGGAGGATGCACCCTCGCTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGTTTACCATGGGACAATGTGGAAATTGATGCGATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGATATCGATGACAGCGGTACTAAAACTATGGTTCATAATCGGCTAAATGACTTGAGATTGCAGGGCATAGATGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATCGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCAAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAACTGACAGGCCTTCCAGTTAGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATTCCTTTA

Larix_decidua_P1                  GCATATTTATCCCGAATTCAAAGGGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTTGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACCAGAATTTCTGACAATCGGGACCGACGTTCGAACCCTGTTCACCGCCGCCAGTGCTCACTCATTGGAAAAGGCAGCCGTGGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGGATGGTGATAGATTTTGAGCCCTTGAAGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTACAGTCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATATCGGCCTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAGCTGACTGGGTATGAAAGGGTCATGGTATATAAGTTTCATGAAGACGAACACGGGGAAGTTGTCGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCGGCCACCGATATCCCTCAGGCTTCCCGCTTTCTGTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAAGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGCGCGCCCCATGGGTGCCACGCCCAATACATGGCTAACATGGGTTCTGTTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGGAGGAGGG---------------AGTGGGCGAAATTCAATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCACGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGATATGCTACTCCGAGATGCCCCGATGGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGACGGTGCTGCTCTTTACTATGGAGGTATGTGCTGGATGTTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTACTTGAACACCACGGGGATTCAACAGGCCTGAGCACGGATAGTTTGGCAGATGCAGGTTATCCAGGTGCCGCCTCTCTTGGAGATGCAGTCTGCGGCATGGCTTCCGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGATAAGGACGACGGCCGGAGGATGCACCCTCGTTCATCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTGCCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAAGGCATGGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCAAGTCACTTGTTCAGGATCTTGTGTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATACCTTAC

Larix_occidentalis_P1             ??ATATTTATCTCGAATTCAAAGGGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTTGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACCAGAATTTCTGACAATCGGGACCGACGTTCGAACCCTGTTCACCGCCGCCAGTGCTCACTCATTGGAAAAGGCAGCCGTGGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGGATGGTGATAGATTTTGAGCCCTTGAAGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTACAGTCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATATCGGCCTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAGCTGACTGGGTATGAAAGGGTCATGGTATATAAGTTTCATGAAGACGAACACGGGGAAGTTGTCGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCGGCCACCGATATCCCTCAGGCTTCCCGCTTTCTGTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAAGGTTATCCAG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------??????????????????---------------???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????

Nothotsuga_longibracteata_P1      GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCCTTTGGGTGTGTCCTGGCAGTGGAGGAGGCCACTTTTAGGATTATTGCGTACAGTGAGAACGCAGTGGAATTGCTGGATCTGGCGCCACAGCCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACCAGAAGGTCTGACAATCGGGACTGACGTTCGAACCCTGTTCACTGCCGCCAGTTCTCACTCACTGGAAAAGGCAGCCGTGGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATATCGGGTTGCTGTGTGATACGGTTGTCGAGAATGTGAGAGAGCTGACTGGGTATGATAGGGTCATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATTCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTAAAGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATCAATGGGAAT------GATGACGAAGCGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTTTGCCACCATACCTCCCCGCGGGCTGTTCCGTTTCCTCTCCGTTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTTAAGACCCAAACACTTCTGTGTGATATACTTCTCCGAGATGCCCCAATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCATGGGGATTCAACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCGGGTGCCGCATCTCTTGGGGATGCAGTGTGTGGCATGGCTTCCGCTAGAATAACTTCAAACGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGACAAGGACGATGGTCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTAGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGATATTGACGACAGTGGTACCAAAACTATGGTTCATGCACGGCTAAATGATTTGAGATTGCAGGGCATAGATGAACTTAGCTCTGTGGCTAGTGAGATGGTGCGTTTAATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCTAATGGACTTATAAATGGATGGAATGCAAAAGTAGCAGAATTGACAGGCCTTCAAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCACGATCTCATTTTTGAGGAGTCTGTCGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATTCCTTTT

Picea_abies_P1                    GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTCGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCACAATCT------------------------------GTACCG------AGCATGGAACAACCT---------------------------CAACTAGAAGTTCTGACAATCGGTACCGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTCACTCATTGGAAAAGGCAGCCGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGAATGGTGATAGATTTTGAGCCCTTGAAGACT---------------GGGGATGCGTTCGTGTCAGCG------------------------GCTGGTGCAGTACAATCTCAGAAGCTTGCTGTGCGGGCGATTTCTCGTCTGCAGTCACTTCCTTGTGGTGATATCGAGCTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAATTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTACATTACCCGGCCACCGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGCAGGTTATCCAGTCCGAGGAATTAATGCAGCCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCTCTTGTTATGGCCGTGATTATTAACGGGAAT------GATGATGAAGGTGCGGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTATGATGCAAGCGTTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACGGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGATATGCTTCTCCGAGATGCCCCAATTGGAATTGTAACCCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTACGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCCGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCACCCAGACGATAAGGACGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTAGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTTTACGAGGTTCGTTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGACGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTATGCAATGCCTTAAAAGGTATACCTTTT

Picea_glauca_P1                   GCTTATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTCGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCACAATCT------------------------------GTACCG------AGCATGGAACAACCT---------------------------CAACTAGAAGTTCTGACAATCGGTACCGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTCACTCATTGGAAAAGGCAGCCGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGAATGGTGATAGATTTTGAGCCCTTGAAGACT---------------GGGGATGCGTTCGTGTCAGCG------------------------GCTGGTGCAGTACAATCTCAGAAGCTTGCTGTGCGGGCGATTTCTCGTCTGCAGTCACTTCCTTGTGGTGATATCGAGCTGCTGTGTGATTCTGTTGTGGAGAATGTGAGGGAATTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTACATTACCCGGCCACTGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGCAGGTTATCCAGTCCGAGGAATTGATGCAGCCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCTCTTGTTATGGCCGTGATTATTAACGGGAAT------GATGATGAAGGTGCGGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTATGATGCAAGCGTTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACGGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGATATGCTTCTCCGAGATGCCCCAATTGGAATTGTAACCCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTACGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCCGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCACCCAGACGATAAGGACGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTAGTCAAAAGAAGAAGTTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTTTACGAGGTTCGTTTCAAGATATCGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATAGACGAGCTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTAAAAAAATGCTATGCAATGCCATAAGAGGTATACCTTTT

Picea_sitchensis_P1               GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTCGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCGGTGGAAATGCTGGATCTGGCGCCACAATCT------------------------------GTACCG------AGCATGGAACAACCT---------------------------CAACTAGAAGTTCTGACAATCGGTACCGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTCACTCATTGGAAAAGGCAGCCGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGAATGGTGATAGATTTTGAGCCCTTGAAGACT---------------GGGGATGCGTTCGTGTCAGCG------------------------GCTGGTGCAGTACAATCTCAGAAGCTTGCTGTGCGGGCGATTTCTCGTCCGCAGTCACTTCCTTGTGGTGATATCGAGCTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAATTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTACATTACCCGGCCACCGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGCAGGTTATCCAGTCCGAGGAATTGATGCAGCCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCTCTTGTTATGGCCGTGATTATTAACGGGAAT------GATGATGAAGGTGCGGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTATGATGCAAGCGTTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACGGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGATATGCTTCTCCGAGATGCCCCAATTGGAATTGTAACCCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTACGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCCGCTATAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCACCCAGACGATAAGGACGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTAGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTTTACGAGGTTCGTTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTATGCAATGCCTTAAGAGGTATACCTTTT

Pinus_contorta_P1                 ????????????????????????????????AATACAGCCGTTTGGCTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCCCAATCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACAAGACGTTCTGACAATCGGGACCGATGTTCGAACCCTGTTCACTGCTGCTAGTGCTCACTCATTGGAGAAGGCAGCAGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCATTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTAGGCATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTCCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGGCTGCAGTCACTTCCTTGCGGTGATGTTGGCTTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTTTACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTGCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGAGGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGAGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTAGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAGTTAACAGAGAAACACATTCTTAAGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCAATGGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGTTGGGAGTGACCCCAACTGAAGCTCAAATCAAAGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACAGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCATCCGGACGACAAGGACGATGCTCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTTGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGTCTCCCGGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTACACAATGCCTTAAGAGGTATACCTTTT

Pinus_krempfii_P1                 ??ATATTTATCTCGAATTCAAAGAGGGGGAATAATACAGCCGTTTGGGTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCTCCCCAATCG------------------------------GTCCCG------AGCATGGAACAATCT---------------------------CAACAAGAAGTTCTGACAATCGGGACCGATGTTCGAACCCTGTTCACTGCTGCTAGTTCTCACTCATTGGAAAAGGCAGCGGTAGCTCAGGAAATAAGCCTCATGAACCCTATCTGCGTTCATTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTGGGGATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGCCTGCAGTCACTTCCTTGCGGTGATATTGGATTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTTCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCGCCCCATGGATGCCACGCCCAGTACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGATGAAGGGGGAGGG---------------AGTGCACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTTGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACAGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCAATGGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGAAAGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCCACGGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCTGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCACCCGGATGACAAGGACGATGGCCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTCGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCCCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCAGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTCCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTAAAGAGTCTGTGGAGAGGGTTGAAAAAATGCTATACAATGCCTTAAGAGGTATACCTTTT

Pinus_lambertiana_P1              ??ATATTTATCTCGAATTCAAAGAGGGGGAATAATACAGCCGTTTGGGTGTGTACTAGCAGTGGAGGAGACCACTTTTAGCATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCTCCCCAATCG------------------------------GTCCCG------AGCATGGAACAATCT---------------------------CAACAAGAAGTTCTGACAATCGGGACCGATGTTCGAACCCTGTTCACTGCTGCTAGTTCTCACTCATTGGAAAAGGCAGCGTTAGCTCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCATTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTGGGGATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCGGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGCCTGCAGTCACTTCCTTGCGGTGATATTGGATTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTTCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCGCCCCATGGATGCCACGCCCAGTACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGATGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGTCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTTGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACAGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGACATGCTTCTCCGACATGCCCCAATGGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGAAAGTGCTGGATGCTGGGAGTAACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCCACGGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCTGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCACCCGGATGACAAGGACGATGGCCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTCGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCCCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCAGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGATGTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTCCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAAGAGTCTGTGGAGAGTGTTGAAAAAATGCTATACAATGCCTTAAGAGGTATACCTTTT

Pinus_monophylla_P1               ??????????????????????????????ATAATACAGCCGTTTGGGTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCACCCCAATCG------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACAAGAAGTTCTGACAATCGGGACCGATGTTCGAACCCTTTTCACTGCTGTTAGTTCTCACTCACTGGAAAAGGCAGCGGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCATTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTGGGGATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGCCTGCAGTCACTTCCTTGCGGTGACATTGGGTTGTTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTGCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCAGCCCATGGGTGCCACGCCCAGTACATGGCCAACATT---TCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGATGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCGTGCGAATTTCTGATGCAAGCATTTGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACAGAAAAACACATTCTTAGGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCAATTGGTATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGAATGTGCTGGATGCTTGGAGTGACCCCAACTGAAGCTCAAGTCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCCACGGGCCTGAGCACGGATAGCTTGGCAGATGCTGGATATCCAGGTGCCGCTTCTCTTGGGGATGCTGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCACCCGGATGACAAGGACGATGGCCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTCGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCCCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCAGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCCAGTGAAAGGGGCCAATTGATTGAA?CAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTCCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAAGAGTCTGTGGAGAGGGTTGAAAAAATGCTATACAATGCCTTAAGAGGTATACCTTTT

Pinus_nelsonii_P1                 ??ATATTTATCTCGAATTCAAAGAGGGGGAATAATACAGCCGTTTGGGTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCACCCCAATCG------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACAAGAAGTTCTGACAATCGGGACCGATGTTCGGACCCTTTTCACTGCTGCTAGTTCTCACTCATTGGAAAAGGCAGCGGTAGCCCAGGAAATAAGCCTTATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTGGGGATGGTGATAGATTTGGAGCCATTGAGTACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGCCTGCAGTCACTTCCTTGCGGTGACATTGGGTTGTTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTTTACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTGCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACGGATATTCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCACGCCCAGTACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGATGAAGGGGGCGGG---------------AATGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTTCGCTATGCGTGCGAATTTCTGATGCAAGCATTTGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACAGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCGATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGAATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAGTCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCCACGGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCCGCTTCTCTTGGGGATGCTGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAAATGAAGTGGGGAGGAGCAAAACATCACCCGGATGACAAGGACGATGGCCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTCGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCCCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCAGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGATTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTCCCAGTTGGAGAAGCCATGGGCATGCCCCTTGTTCACGATCTTGTTTTTGAAGAGTCTGTGGTGAGGGTTGAAAAAATGCTATACAATGCCTTAAGAGGTATACCTTTT

Pinus_pinea_P1                    GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCATTTGGCTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCCCAATCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACAAGACGTTCTGACAATCGGGACCGATGTTCGAACCCTGTTCACTGCTGCTAGTGCTCACTCATTGGAGAAGGCAGCAGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGG?TCATTGTAAAAACTCCAGAAAA?CCTTTTATGCAATTGTGCATAGGATTGATGTAGGCATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTCCAATCGCAGAAGCTCGCTGTGAGGGCGATTTCTCGGCTGC?GTCACTTCCTTGCGGTGATGTTGGGTTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTTTACAAGTTTCATGAAGATGAACACGGGG?AGTTGTTGCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGG?TATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCA?TGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGATGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGAGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTAGGTCTTCAGCTGAACATGGAATTGCAATTGGCAG?TCAATTAACAGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCAATGGGAATTGTAACTCAG?CTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGTTGGGAGTGACCCCAACTGAAGCTCAAATCAAAGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACAGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATC?CACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCATCCGGATGACAAGGACGATGCTCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTTGAAGTGGTCAAAAGAAGAAGCTTAC?ATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGACTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTCCCGGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATG?TAAACAATGCCTTAAGAGGTATACCTTTT

Pinus_ponderosa_P1                ??ATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGCTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCCCAATCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACAAGACGTTCTGACAATCGGGACCGATGTTCGAACCCTGTTCACTGCTGCTAGTGCTCACTCATTGGAGAAGGCAGCAGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCATTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTAGGCATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTCCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGGCTGCAGTCACTTCCTTGCGGTGATGTTGGCTTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTTTACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTGCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTACATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGAGGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGAGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTAGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAGTTAACAGAGAAACACATTCTTAAGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCAATGGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGTTGGGAGTGACCCCAACTGAAGCTCAAATCAAAGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACAGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCATCCGGACGACAAGGACGATGCTCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTTGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTCCCGGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTACACAATGCCTTAAGAGGTATACCTTTT

Pinus_thunbergii_P1               ??ATATTTATCTCGAATTCAAAGGGGGGGAAGAATACAGCCGTTTGGCTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCCCAATCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACAAGACGTTCTGACAATCGGGACCGATGTTCGAACCCTGTTCACTGCTGCTAGTGCTCACTCATTGGAGAAGGCAGCAGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCATTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTAGGCATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTCCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGGCTGCAGTCACTTCCTTGCGGTGATGTTGGGTTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTTTACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTGCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGATGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGAGGGCGGTCCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTAGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACGGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCAATGGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGTTGGGAGTGACCCCAACTGAAGCTCAAATCAAAGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACAGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCTGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCATCCGGATGACAAGGACGATGCTCGACGGATGCATCCTCGTTCCTCTTTCAAGGCATTCCTTGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTTCCGGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGCAGTCTGTGGAGAGGGTTGAAAAAATGCTACAGAATGCCTTAAGAGGTATACCTTTT

Pseudolarix_amabilis_P1           GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCCTTTGGGTGTGTGCTGGCAGTGGAGGAGATCACTTTTAGGATCATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCACAGTCA------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACCAGAAACTCTGACAATCGGGACTGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTCACTCATTGGAAAAGGCAGCCTTGGCCCAGGAAATAAGCCTCCTGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCTGCG------------------------GCTGGCGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATATCGGACTGCTGTGTGATACTGTTGTGGAGAATGTGAGAGAACTGACCGGGTATGATAGGGTCATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACCCCCGTGAAGGTTATTCAGTCCGAGGAGTTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCATGCGCAATACATGTCCAACATGGGTTCCGTTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGCGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTTTGCCACCATACCTCTCCGCGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTTAAGACTCAAACACTTCTGTGTGATATGCTTCTCCGAGATGCCCCGATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAGCTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCATGGAGATTCAACGGGCCTGAGCACAGATAGTTTGGCAGATGCTGGTTATCCAGGTGCCGCCACTCTTGGGGATGCAGTCTGTGGCATGGCTTCCGCTAGAATAACTTCAAAAGATTTTCTTTTCTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGATAAGGACGACGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCATGGGATAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCGAGATATTGATGACAGTGGTACTAAAACGATGGTTCATGCTCGGCTAAATGATTTGAGATTGCAGGGCATAGATGAACTTAGCTCCGTGGCCAGTGAGATGGTGCGTTTGATTGAAACAGCCACAGCACCTATTTTGGCTGTAGATCCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACGATGCCTTAAGAGGTATTCCTTTT

Pseudotsuga_menziesii_P1          GCTTATTTATCTCGAATTCAAAGGGGAGGAAGAATACAGCCATTTGGGTGTGTGCTCGCAGTGGAGGAGACCACTTTTAGGATTATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACCAGAAGTTCTGACAATCGGGACCGACGTTCGAACCCTGTTCACCGCCGCCAGTGCTAACTCATTGGAAAAGGCAGCTGTGGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGGATGGTGATAGATTTTGAGCCCTTGAAGACC---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTACAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTACAGTCACTTCCTTGCGGTGATATCGGTCTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAGCTGACTGGGTATGACAGGGTCATGGTATACAAGTTTCATGAAGATGAGCACGGGGAAGTTGTCGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCGGCCACCGATATCCCTCAGGCTTCTCGCTTTCTGTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAAGCTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCGTTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGGAGGAGGA---------------AGTGGGCGAAATTCAATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAGTTGGCAGCTCAATTGACGGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGATATGCTACTCCGAGATGCCCCAATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGACGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTACTTGAACACCACGGAGATTCAACAGGCCTGAGCACGGATAGTTTGGCAGATGCAGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCCGCTATAATTACTTCAAAGGAATTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAATGGGGAGGTGCAAAACATCACCCAGATGACAAGGATGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTTCCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATGGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCTAATGGACTCGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGAGCATGTCACTTGTTCAGGATCTTGTGTTTGAGGAGTCTGTGCAGAGGGTTGAAAAAATGCTCAACAATGCCTTAAGAGGTATACCTTTT

Tsuga_canadensis_P1               GCATATTTATCTCGAATTCAAAGAGGGGGGAGAATACAGCCCTTTGGGTGTGTCCTGGCAGTGGAGGAGACCACTTTTACGATCATCGCGTACAGTGAAAACGCAGTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACCAGAAGCTCTGACAATCGGGACTGACGTTCGAACCCTGTTCACTGCGGCCAGTGCTCACTCATTGGAAAAGGCAGCAGTGGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTTCATAGGATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTAAGGACT---------------GGGGATGCGGTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCCGCAGTCACTTCCTTGCGGTGATATCGGGCTGCTGTGTGATACGGTTGTCGAGAATGTGAGAGAGCTGACTGGGTATGATAGGGTCATGGTATACAAGTTTCATGAGGACGAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATTTGCGATTGCATGGCAACCCCCGTAAAGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCGTTGCTTCGCTTGTCATGGCTGTGATTATCAATGGGAAT------GATGACGAAGCGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTTTGCCACCATACTTCCCCGCGGGCTGTTCCGTTTCCTCTTCGTTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTTAAGACTCAAACACTTCTGTGTGATATGCTTCTCCGAGATGCTCCAATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGACGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCATGGGGATTCAACGGGTCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTGTGTGGCATGGCTTCCGCTAGAATAACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGACAAGGACGATGGTCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTAGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGATATTGACGACAGTGGTACCAAAACTATGGTTCATGCTCGGCTAAATGATTTGAGATTGCAGGGCATAGATGAACTTAGCTCTGTGGCTAGTGAGATGGTGCGTTTAATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCTAATGGACTTGTAAATGGATGGAATGGAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATTCCTTTT

Abies_concolor_P2                 GCATATTTATCTCGAATTCAAAGAGGGGGAATAATACAGCCCCACGGGTGTGTGCTCATAGTGGAGGAAACTACTTTTAGAATTATCGCTTACAGCGAGAACGCAGTAGAAATGCTGGATCTGGCGCAACAGTTT------------------------------GTCCCT------AGTATGGAAAAACCT---------------------------CCACCCCAAATTCTGACCATAGAGACCGACGTTCGAAACCTGTTGACTTCCGCCAGTGCTCAGTCCTTGGAAAAGGCTGCCGCGGCCCAGAAATTAAGCCTCATGAACCCCATCCGTGTTCACTGTAAAAGCTCCGGAAAGCCCTTTTATGCAATTGTCCACAGGATTGATGTGGGGATGGTGATAGATTTTGAGCCCTTGAACACT---------------GGGGATTTTGAGCCCTTGAAC------------------------ACTGGTGTAGTGCAATCTGAGAAGCTTGCTATGATGGCGATTTCTCGTCTGCAGTCACTTCCCCGCGGAGATATCGGCTTGCTGTGTAATACTGTTGTGGAGAATGTGCGGGAGCTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGACAAACATGGGGAAGTCTTTGCGGAAATTAAGCGGTCAGACTTGGAACCCTATGTTGGGTTGCATTACCCTGCCACCGATATTCCTCAGGCTGCTCGCTTTCTCTTTATGCAGAACAGGGTGCGAATGATCTGCGATTACACGGCAGCTCCCGTGAAGGTTATCCAGTCCGAGGAATTGATGCAACCTGTCTGTTTAGTGGGTTCCACGCTCCGGGCGCCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAAAGAGAAT------GATGGCGATCGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTGTGGGGTTTGGTTGTGTGCCACCATACTTCCCCGCGGGCAGTTCCGTTTCCTCTTCGCCATGCTTGCGAGTTTCTGATGCAAGCTTTCGGTCTTCAGTTGAGCATGGAATTGCAGCTGGCAGCTCAATTGACGGCGAAACATATTATTAGGATTCATACGCTTCTGTGTGATATGTTTCTCCGAGATGGCCCAGTTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAATTGTGATGGTGCTGCTGTCTATTATGGAGGTATGTGCAGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGAATATTGCAGAATGGTTGCTTGAATACCATGGGGATTCAATCGGCCTGAAAACGGATAGTTTGATAGATGCTGGTTATCCTAGTGCCCCCTACCTTGGGGATGCAGTCTGTGGTATGGCTGCTGCTAGAATTGGTTCAAAAGACTTTATGTTTTGGTTTAGATCCCACACTGCAAAGGAGTTGAAGTGGGGAGGTGCAAAACATCATCCAGATGATAAAGATGATGGCCGGAGGATGCAGCCTTCTATCTCTTTCAAGGCATTTCTAGACGTGGTCAAAAGAAGAAGCCTACCATGGGAAAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTACTCTACGAGGTTCATTTCAAAACATTGATGACAGTGGCGCTAAAGCTATGGTTTATGCTTGGCGAAATGATTTGATATTCCAGGGCATAGATAAACTTAGGTCTGTGGCTACTGAGACGGTGCATGTGATTGAAACAGCCACAGCACCTATTTTTGCCGTAAATTCTAATGGACTTGTAAATGGATGGAATGCAAAGGTGGCAGAATTGACAGGCCTTCCTGTTGGAGAAGCCATGGGCAAGTCTATTGTTCAGAATCTTGTTTCTGAAGAATCTGTGGAGACAGCCGAAAAAATGCTCTACAATGCCTTAAGAGGTATGTTTTTT

Abies_lasiocarpa_P2               ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------??????------???????????????---------------------------???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------?????????????????????------------------------?????????????????TGAGAAGCTTGCTATGATGGCGATTTCTCGTCTGCAGTCACTTCCCCGCGGAGATATCGGCTTGCTGTGTAATACTGTTGTGGAGAATGTGCGGGAGCTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGACAATCATGGGGAAGTCTTTGCGGAAATTAAGCGTTCAGACTTGGAACCCTATGTTGGATTGCATTACCCTGCCACCGATATTCCTCAGGCTGCTCGCTTTCTCTTTATGCAGAACAGGGTGCGAATGATCTGCGATTTCACGGCAGCTCCCGTGAAGGTTATCCAGTCCGAGGAATTGATGCAACCTGTCTGTTTAGTGGGTTCCACGCTCCGGGCGCCCCATGGGTGCCATGCGCAATACATGGGCAACATGGGTTCCATTTCTTCGCTTGTTATGGCTGTGATTATTAAAGAGAAT------GATGGCGATCGGGGAGAG---------------AGTGGACGAAATTCCATGAAGCTGTGGGGTTTGGTTGTGTGCCACCATACTTCCCCGCGGGCAGTTCCGTTTCCTCTTCGCCATGCTTGCGAATTTCTGATGCAAGCTTTCGGTCTTCAGTTGAGCATGGAATTGCAGCTGGCTGCTCAATTGACGGCGAAACATATTATTAGGATTCATACGCTTCTGTGTGATATGTTTCTCCGAGATGGCCCAGTTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAATTGTGATGGTGCTGCTGTCTATTATGGAGGTATGTGCAGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGAATATTGCAGAATGGTTGCTTGAATACCATGGGGATTCAATCGGCCTGAAAACGGATAGTTTGATAGATGCTGGTTATCCTAGTGCCCCCTACCTTGGGGATGCAGTCTGTGGTATGGCTGCTGCTAGAATTGGTTCAAAAGACTTTATGTTTTGGTTTAGATCCCACACTGCAAAGGAGTTGAAGTGGGGAGGTGCAAAACATCATCCAGATGATAAAGATGATGGCCGGAGGATGCACCCTTCTATCTCTTTAAAGGCATTTCTAGACATGGTCAAAAGAAGAAGCCTACCATGGGAAAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAAACATTGATGACAGTGGCGCTAAAGCTATGGTTTATGCTTGGCGAAATGATTTGATATTCCAGGGCATAGATAAACTTAGGTCTGTGGCTACTGAGACGGTGCATGTGATTGAAACAGCCACAGCACCTATTTTTGCCGTAAATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCTGTTGGAGAAGCCATGGGCAAGTCTCTTGTTCAGAATCTTGTTTCTGAAGAATCTGTGGAGACAGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATGTTTTTT

Cathaya_argyrophylla_P2           GCATATTTATCTCGAATTCAGAGAGGGGAAAGAATACAACCCCATGGGTGTATGCTCGCAGTGGAGGAAAGCACTTTTAGGATCATCGCTTACAGCGAGAACGCAGTAGAAATGTTGGATCTGGCGCCACAGTCT------------------------------GTCCCC------AGCATGGAAGAACCT---------------------------CAATCCCAAGTTCTGACCATTGGGACCGATGTCCGAACCCTGTTCACTTCCGCCAGTGCTCACTCCTTGGAAAAGGCTGCAACAGTCCAAAACTTAAGTCTCATCAACCCAATTTGTGTTCATTGTAAAAACTCAGGAAAGCCCTACGATGCAATTGTCCATAGGATTGATGTGGCGATGGTGATAGATTTTGAGCCCTCAAGGTTC---------------GGGGATGCGTCCATGTCTGTT------------------------GCTGGTCCACTGCATTCTGAGAAGCTTGCTATGAGGGTGATATCTCGTATGCAGTCACTTCGCCGCTGTGATATCGGCTTACTGTGTGATACTGTTGTGGAGAGTGTGCGAGAGCTGACCGGGTATGACAGGGCCATGGTTTACAAGTTTCACGAAGACGAACACGGGGAAATTGTTTCAGAAATTAGGCGTTCAGACATGGAGCCCTATTTTGGATTGCATTACGCTGCCACCAATATCCCTCAGGCTGCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCAGGGCAACTCCCGTGAAGGTTATCCAGTCAGAGGAGTTGGTGCAACCTCTCTGTTTAGTGGGTTCCACGCTCAGGGCCTCCCATGCGTGCCATGCGCAATACATGGCCAACATGGGCTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAACGGGAAT------GATGGCGAAGGTGGAGGG---------------AATGGACGAAATTCCATGAAACTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCCGTTCCGTTTCCTCTTCGCTATACTTGCGAATTTCTGATGCAAGCATTCAGTCTTCAGCTGAGCATGGAATTACAGTTTACAGCGCAAGTGATGGAGAAACGCATTTTTAGGATTCAAACGCTTCTGCGCGATATGCTTCTCCGAGATGGCCCATTTGGAATTGTAACCCAGTCTCCCAGTATCATGGATCTTGTTAAGTGTGATGGTGCTGCTCTCTATTACGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAACCTCAAATAAAGAATATTGCAGATTGGTTGCTTGAAAACCATGGGGATTCAACAGGACCGAACACAGATAGTTTGACAGATGCTGGTTATCCTGGTGCCGCCTATCTTGGAGATGCAGTCTGTGGCATGGCTGCTGCTAGAATTACTTCAAAAGATTTTCTATTTTGGTTCAGATCCCAAACTGCAAAGGAGTTGAAGTGGGGAAGTGCAGAACATCATCCAGGTGAAAAAGATGATGGACGG---ATGCACCCTGTTTACTCTTACGGGGCATTTCTAGAAGTGGTCCAAAAAAGAAGCCTACCATGGGAAAATGTGGAAATTGATGCAATTCAGTCGCTACAGCTTATTCTACGAGATTTATTTCAAGGCATTGATGACAGAGGCACTAAATCTATGGTTCATGCTCAACTAAAGGATTCAAGATTGCAGGGCTTAGATAAATTTAGGTCTGTGGCTACTGAGATGGTGCGTGTGATCGAAACGGCACCAGCACCTATTTTTTGCGTAGATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCAAGTCTCTTGTTCAGGATCTTGTTTTTGAAGAATCTGTGGAGACGGTTAAAAAAATGCTCTACAGTGCCTTAAGAGGTATGCTTTTT

Larix_laricina_P2                 ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------??????------???????????????---------------------------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GCAATTGTCCATAGGATTGATGTAGGGATGATGATAGATTTTGAGCCCTTGATGACT---------------GGGGATGCGTTCATGTCTGCG------------------------CCTGCTGCAGTGCATTCTGAGAAGCTTGCTATGAGAGCGATTTCTCGTCTGCAGTCACTTCCTGGCGGCGATATCGGCCGCCTGTGTGATGCTGTCGTAGAGAATGTGCGAGAGCTGACTGGGTATGATAGGACCATGGTATACAAGTTTCATGAAGACGAACACGGTGAAGTTGTTACGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGTTTGCATTACCCTGCCACCGATATCCCGCAGGCTGCTCGCTTTCTTTTTATGCAGAACAAGGTGCGAATGATCTGCAATTGCAGGGCAACTCCCGTGAAGGTTATTCAGTCCGAGAAATTGACGCAACCTCTCTGTTTAGTGGGTTCCACCCTGCGGGCGCCCCATGAGTGCCATGCGCAATACATGGCGAACATGGGTTCTATTGCTTCGCTTGTTATGGCTGTGATTATTAATGAGAAT------GACGGCGAAGGGGGAGGG---------------AGTGGACGACATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCATCATACCACCCCGCGGGCGGTTCCGTTTCCTGTCCGCTATGCTTGCGAAGTTCTGATGCAAGCATTCGGTGTTCATCTGAGCATGGAATTGCAGTTGGCAGCTCAATTGACGGAGAAACGCATTTTAAGGGTTCAAACGCTTCTGTGTGATATGCTTCTCCGAGATGCCCCAACTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATCGAGATAAATGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCTGGCTGGTTGCTTGAATACCACGGGGATTCAACGGGTCTGACCACGGATAGTTTGACAGATGCTGGTTATCCTGGTGCCGCCTATCTTGGGGATGCAGTCTGTGGCATGGCTGCTGCTAGAATTACTTCAAAAGATTTTCTATTTTGGTTCAGATCCCACACTGCGAAGGAGTTGACGTGGGGAGGTGCAGAACAGTATCCAGGTGATAAAGATGGTGGCCTG---ATGCACCCGTGTTCCTCTTTCAAGGCATTTCTAGAGGGAGTCAAAAGAAGAAGCCTACCATGGGAAAATGTGGAAATTGATGCAATTCACTCGCTACAACTTAATCTACGAGGTTCATTTCAAGACATCGATGGCAGTGGTACTAAAGGTGTGGTTTGTTCTCGGCCAAATGATTCTAGATTGCAGGGCTTAGATAAACTTAGGTATGTGGCTACTGAAATG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????

Picea_abies_P2                    ???TATTTATGTCGAATTCAAAGAGGGGGAAGAATACAACCCCATGGGTGTGTGCTCGCAGTGGAGGAAAGCACTTTTAGGATCATCGCTTACAGCGAGAACGCAGTAGAAATGTTGGAACCGACGCCACAGTCT------------------------------CTCCCC------AGCATGGAAAAATCT---------------------------CAACCCCAACTTTTGACCATCGGGACCGATGTTCGAACTCTGTTCACTTCCGCCAGTGTTCACTCCTTGGAAAATGCTTTCGCGGCCCAGAAATTAAGCCTCATGAACCCAATCTGTGTTCATTGTAAAACCTCTGGAAAGCCCTTCCATGCAATTGTCCATTGGATTGATGTGGGGATGGTGATAGATTTTGAGCCCTTGAGCACT---------------GGGGATGCGTTCATGTCGGCT------------------------GGTGGTGCAGTGCATTCTGAGAAGCTTGCTATGAGGGCGATTTCTCGTCTGCAGTCACTTCCCCGCGGTGATATCGGCTTACTGTGTGATACTGTTGTGGAGAATGTGCGAGCGCTGACTGGGTATGACAGGGCCATGGTATACAAGTTTCACGAAGACGAACACGGGGAAATTGTTGCTGAAATTAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTGCTCGTTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCAGGGCAACTCCCGTGAAGGTTATCCAGTCCGAGGAATTAACACAACCTCTCTGTTTAGTGGGTTCCACGCTCCGGGCGCCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTTCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGGCGAAGCGGGAGGG---------------AATGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTCCCTCTTCGTTATGCTTGCGAATTTTTGATGCAAGCATTCGGTCTTCAGCTGAGCATGGAATTGCAGTTGGCAGAACAATTGACGGAGAAACGCATTTTTAGGATTCAAGTGCTTCTGTCTGATATGCTTCTCCGAGATGGCTCAATTGGAATAGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTCTATTATGGAGGTATATGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCGGATTGGTTGTGTGAATACCATGGGGATTCAACGGGCCTGACCACAGATAGTTTGACAGATGCTGGTTATCCTGGTGTCGCCTATCTTGGGGATGCAGTCTGTGGCATGGCTGCTGCTAGAATTACTTCTAAAGATTTTCTATTTTGGTTCAGATCCCAAACTGCAAAGGAGTTGAAGTGGGGAGGTGCAGAACATCATTCAGGTGATAAAGATGATGGCCGG---ATGCACCCTCGTTCCTCTTTCAAGGCATTTCTAGAACGGGTCAAAAGAAGAAGCCTACCATGGGAAAATTTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGACATTGATGACAGTGTCACTAAACCTGTGGTTCATGCTCGGCTAAAGGATTTGAGAATGCAGGGCTTAGGTAAACTTAGGTCTGTGGCTACTGAGATGGGGCGTGTGATTGAAACGGCTACAGCACCTATTTTTGCTGTAGATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGCTGAAGAAGCCATGGGCAAGTCTCTTGTTCAGGATCTTGTTTTTGAAGAATCTGTGGAGACGATCAAAAAAATGCTCTACAATGCGTTGAGAG???????????

Picea_glauca_P2                   GCATATTTATCTCGAATTCAAAGAGGGGGGAGAATACAACCCCATGGGTGTGTGCTCGCAGTGGAGGAAAGCACTTTTAGGATCATCGCTTACAGCGAGAACGCAGTAGAAATGTTGGAACCGACGCCACAGTCT------------------------------GTCTCC------AGCATGGAAAAATCT---------------------------CAACCCCAACTTTTGACCATCGGGACCGATGTTCGAACTCTGTTCACTTCTGCCAGTGTTCACTCCTTGGAAAATGCTTTCGCGGCCCAGAAATTAAGCCTCATGAACCCAATCTGTGTTCATTGTAAAACCTCTGGAAAGCCCTTCCATGCAATTGTCCATTGGATTGATGTGGGGATGGTGATAGATTTTGAGCCCTTGAGCACT---------------GGGGATGCGTTCATGTCGGTT------------------------GCTGGTGCAGTGCATTCTGAGAAGCTTGCTATGAGGGCGATTTCTCGTCTGCAGTCACTTCCCCGCGGTGATATCGGCTTACTGTGTGATACTGTTGTGGAGGATGTGCGAGCGCTGACTGGGTATGACAGGGCCATGGTATACAAGTTTCACGAAGACGAACACGGGGAAATTGTTGCTGAAATTAGGCGTTCAGACTTGGAGCCCTATTTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTGCTCGTTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCAGGGCAACTCCCGTGAAGGTTATCCAGTTCGAGGAATTAACACAACCTCTCTGTTTAGTGGGTTCCACGCTCCGGGCGCCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGGCGAAGCCGGAGGG---------------AATGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTTCGTTATGCTTGCGAATTTTTGATGCAAGCATTCGGTCTTCAGCTGAGCATGGAATTGCAGTTGGCAGAACAATTGGCGGAGAAACGCATTTTTAGGATTCAAGCGCTTCTGTCTGATATGCTTCTCCGAGATGGCTCAATTGGAATAGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTCTATTATGGAGGTATATGCTGGATGCTGGGGGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCGGATTGGTTGTGTGAATACCATGGGGATTCAACGGGCCTGACCACAGATAGTTTGACAGATGCTGGTTATCCTGGTGCCGCCTATCTTGGGGATGCAGTCTGTGGCATGGCTGCTGCTAGAATTACTTCTAAAGATTTTCTATTTTGGTTCAGATCCCAAACTGCAAAGGAGTTGAAGTGGGGAGGTGCAGAACATCATTCAGGTGATAAAGATGATGGCCGG---ATGCACCCTCGTTCCTCTTTCAAGGCATTTCTAGAACGGGTCAAAAGAAGAAGCCTACCATGGGAAAATTTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGACATTGATTACAGTGTCACTAAACCTGTGGTTCATGCTCGGCTAAAGGATTTGAGAATGCAGGGCTTAGGTAAACTTAGGTCTGTGGCTACTGAGATGGGGCGTGTGATTGAAACGGCTACAGCACCTATTTTTGCTATAGATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGCTGAAGAAGCCATGGGCAAGTCTCTTGTTCAGGATCTTGTTTTTGAAGAATCTGTGGAGACGATCAAAAAAATGCTCTACAATGCGTTGAGAGGTATGCCTTTT

Pinus_strobus_P2                  ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------??????------???????????????---------------------------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GCAATTGTCCACAGAATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAGAATA---------------GGGGATGCGTTCATGTCTGCT------------------------GCTGGTGCAGTGTATTCTGAGAAGCTGGCCATGAGGGTGATTTCTTGTCTGCAGTCACTTCCCCGCGGTGATATCGGTCTACTGTGTGATACCGTTGTGCAGAATGTGAGAGAGCTGACTGGGTATGACAGGGCCATGATATACAAGTTTCACGAAGACGAACATGGGGAAATTATTGCAGAAATTAAGCGACCAGACTTGGAGCCTTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTGTTCGCTTTCTTTTTATGCAGAACAAGGTGCGAATGATTTGCGGTTGCAGGGCAAGTCCTGTGAATGTTATCCAGTCACAGGAATTGACGCAACCTCTCTGTTTAGTGGGTTCCACGCTCCGGGCGTCCCATGAGTGCCATTCGCAATTCATGGTCAACATGGGTTCCATTGCTTCGCTTGTTATGTCTGTGATTATTAACGGAAAT------GATGCCGCAGTGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCACACCTCGCCGCGGGCGGTCCCGTTTCCTCATCGCTATGCTTGTGAATATCTGATGCAAGCATTTGGTCTTCAGCTGAGCATGGAATTGCAGTTGGCGGCTCAATTGAAGGAGAAACGCATTTTTAGGATTCAAACGCTTCTCTGTGAAAGGCTTCTCCGAGATGGCCCAATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTCTATTACAGAGGTATGTGCTGGATGCTGGGAATGACCCCAACTGAAGCTCTAATCGTGGATATTGCAGATTGGTTGCTTGAATACCACGGGGATTCAACAGGCATTAACACAGATAGTTTGACAGATGCTGGTTATCCTGGTGCCACCTATCTTGGGGATGCAGTCTGTGGCATGGCTGCAGCTAGAATTAATTCAAAAGATTTTGTATTTTGGTTCAGATCCCAAACTGCAAAAGAGTTGAAGTGGGGAGATACAGAAAATCATTCAAGTGCTGAAGATGATGGTCGG---ATGCATCCTTCTTCCTCTTTCAAGGCATTTCTAGAAGTGGTCCAAAGAAGAAGCCTACAATGGGAAGATGTGGAAATTGATGCAATTCACTCGCTGCAGCTTATTCTACGAGGTTCATTTCAAGACATTGATGACAGTGGCACTGAAGCTATGACTCATTCTCAGTTGAAGGATTCAAGATTGCATGGCTTAGATAAACTTAGGTTTGTGGCTACTGAGATGATGCGTGTGATTGAAACGGCTGCAGCACCTATTTTTGCCGTAGATTCTGATGGACTTGTAACTGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCAAGTCTCTTGTCCAGGATCTTGTTTTTGAAGAATCTGTGGAGACAGTTAAAAAAATGCTCTACAGAGCCTTAAGAGGG?????????

Tsuga_chinensis_P2                GCATATTTATCTCGAATTCAAAGAGGGGGAATTATACAGTCTCACGGGTGTGTGCTCGTAGTGGAGGAGAGTACTTATAGAATTATCGCTTACAGCGAGAATGCAGTAGAAATGCTGGATCTGGTGCTACAGTCT------------------------------GTCCCC------AGCATGGAAAAACCT---------------------------CAACCCCAAATTCTGACCATAGGGACCGACGTTCGAACGCTGTTCACTTCCGCTAGTGCTCGGTTCTTGGAAAAGGCTACCACGGCCCAGAAATTAAGCTTCTTGAACCCCATCTGTGTTCATTGTAAAAACTCTGGAAAGCCCTTTAATGCAATTCTCCATAGGATTGATGTGGGGATGGTGATAGATTTTGAGCCTTTGGAGACT---------------GGGGATGCGTTCATGTCTTCA------------------------GCTGGTGCAGTGCACTCTGAGAAGCTTGCTATGATGGCGATTTCTCGTCTGCAGTCACTTCCTAGCGGTGATATCGGCTTGCTGTGTGATACTGTTGTGGAGAATGTGCGAGAGCTGACTGGGTATGATAGGGTTATGGTATACAAGTTTCATGAAGACAAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACATGGAACCCTATCTTGGGTTGCATTACCCTGCGACCGATATCCCTCAGGCTGCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGTGATTGCACGGCAAATCCTGTGAAGGTTATCCAGTCTGAGGAATTGAGGCAACCTGTCTGTTTAGTGGGTTCTACGCTCCGGGCGTCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAAAGGGAAT------GATGGCGAGGGGGGAGGG---------------AGTGGACGAAATTTCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACTTCCCCGCGGGCAGTTCCTTTTCCTCTTCGCCATGCTTGCGAATTTATGATGCAAGCATTTGGTCTTCAGTTGAGCATGGAATTGCAATTGGCAGCTCAATTGATGGAGAAACGCATTCTTAGAATTCAAACGCTTCTGTGTGATATGTTTCTCCGAGAAGGCCCTGTTGGAATTGTAACTCAGTCTCCCAGCATCATGGATCTTGTTGAGTGTGATGGTGCTGCTCTTTATTATGGATGTAAGTGTTGGATGCTAGGAGTGAGCCCGACTGAAGCTGAAATCAAGGATATTGCAGAATGGTTGCTTGAATACCATGGGGATTCATTGGACCTGAGCACGGATAGTTTGATAGATGCTGGTTATCCTGGTGCCGCCGATCTTGGGGATGCAGTCTGTGGCATGGCTGCTGCTAGAATTGCTGCAGAAGACTTTCTGTTTTGGTTTAGATCCCACACTGCAAAGGAGTTGAAGTGGGGAGGTGCAAAACATCATCCAGATGATAAAGATGATGGCCGGAGGATGCACCCTCGTATCTCTTTCAAGGCATTTCTAGAAGTGGTCAAAAGAAGAAGCCTACCATGGGGAAATCAGGAAATTGATTCAATTCACTCGCTACAGCTTATTCTACGAGGTTTATTTCAAGACATTGATGACAGTGGTACTAAAGCTATGGTTTATGCTCGGCGAAATGATTTGATATTTCAGGGCTTAGATAAACTTAGGTCTGTGACTACTGAGATGGTGCGTGCGATTGAAACAGCTACAGCACCTATTTTTTCCGTAGATACTAATGGACTTGTAAATGGATGGAATGCACAATTGGCAGAATTGACAGGCCTTCCAGTTCGAGAAGCCATGGGCAAGTCTCTTGTTCAGGATCTTGTTTTTGAAGAATCTGTGGAGACGGTTGAAAAACTGCTCTACAATGCCTTAAGAGGTATGCTTTTC

Tsuga_heterophylla_P2             GCATATTTATCTCGAATTCAAAGAGGGGGGATAATACAGTCTCACGGGTGTGTCCTCGTGGTGGAGGAGACTACTTATAGAATTATCGCTTACAGCGAGAATGCAGTAGAAATGCTGGATCTGGTGCCACAGTCT------------------------------GTCCCC------AGCATGGAAAAATCT---------------------------CAGCCCCAAATTCTGACCATAGGGACCGACGTTCGAACGCTGTTCACTTCCGCTAGTGCTCGGTTCTTGGAAAAGGCTACCGCGGCCCAGAAATTAAGCTTCTTGAACCCCATCTGTGTTCATTGTAAAAACTCTGGAAAGCCCTTTAATGCAATTCTCCATAGGATTGATGTGGGGATGGTGATCGATTTTGAGCCTTTGGAGACT---------------GGGGATGCGTTCATGTCTTCA------------------------GCTGGTGCAGTGCACTCTGAGAAGCTTGCTATGATGGCGATTTCTCGTCTGCAGTCACTTCCTAGCGGTGATATCGGCTTGCTGTGTGATACTGTTGTGGAGAATGTGCGAGAGCTGACTGGGTATGATAGGGTTATGGTATACAAGTTTCATGAAGACAAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACATGGAACCCTATCTTGGGTTGCATTACCCTGCGACCGATATCCCTCAGGCTGCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGTGATTGCACGGCAAATCCTGTGAAGGTTATCCAGTCTGAGGAATTGAGGCAACCTGTCTGTTTAGTGGGTTCTACGCTCCGGGCGTCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAAAGGGAAT------GATGGCGAGGGGGGAGGG---------------AGTGGACGAAATTTCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACTTCCCCGCGGGCAGTTCCTTTTCCTCTTCGCCATGCTTGCGAATTTCTGATGCAAGCATTTGGTCTTCAGTTGAGCATGGAATTGCAATTGGCAGCTCAATTGATGGAGAAACGCATTCTTAGAATTCAAACGCTTCTGTGTGATATGTTTCTCCAAGAAGGCCCTGTTGGAATTGTAACTCAGTCTCCCAGCATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTAAGTGTTGGATGCTGGGAGTGAGCCCGACTGAAGCTGAAATCAAGGATATTGCAGAATGGTTGCTTGAATACCATGGAGATTCATTGGGCCTGAGCACGGATAGTTTGATAGATGCTGGTTATCCTGGTGCCGCCGATCTTGGGGATGCAGTCTGTGGCATGGCTGCTGCTAGAATTGCTTCAGAAGACTTTCTGTTTTGGTTTAGATCCCACACTGCAAAGGAGTTGAAGTGGGGAGGCGCAAAACATCATCCAGATGATAAAGATGATGGCCGGAGGATGCACCCTCGTATCTCTTTCAAGGCATTTCTAGAAGTGGTCAAAAGAAGAAGCCTACCATGGGGAAATCAGGAAATTGATTCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGACATTGATGACAGTGGTACTAAAGCTATGGTTTATGCTCGGCTAAATGATTCGATATTTCAGGGCTTAGATAAACTTAGGTCTGTGACTACTGAGATGGTGCGTGCGATTGAAACAGCTACAGCACCTATTTTTTCCGTAGATACTAATGGACTTGTAAATGGATGGAATGCACAAGTGGCAGAATTGACAGGCCTTCCAGTTCGAGAAGCCATGGGCAAGTCTCTTGTTCAGGATCTTGTTTTTGAAGAATCTGTGGAGACGGTTGAAAAACTGCTCTACAATGCCTTAAGAGGTATGCTTTTC


;

END;