Pinaceae-phyP-20140910-10M.xml

<?xml version="1.0" standalone="yes"?>


<!-- Generated by BEAUTi v1.8.1                                              -->

<!--       by Alexei J. Drummond, Andrew Rambaut and Marc A. Suchard         -->

<!--       Department of Computer Science, University of Auckland and        -->

<!--       Institute of Evolutionary Biology, University of Edinburgh        -->

<!--       David Geffen School of Medicine, University of California, Los Angeles-->

<!--       http://beast.bio.ed.ac.uk/                                        -->

<beast>


<!-- The list of taxa to be analysed (can also include dates/ages).          -->

<!-- ntax=38                                                                 -->

<taxa id="taxa">

<taxon id="Ginkgo_biloba_SM"/>

<taxon id="Sciadopitys_verticillata"/>

<taxon id="Araucaria_columnaris_JX559989"/>

<taxon id="Podocarpus_macrophyllus_JX560047"/>

<taxon id="Cephalotaxus_sinensis_JX559896"/>

<taxon id="Cryptomeria_japonica"/>

<taxon id="Abies_contorta_P1"/>

<taxon id="Abies_lasiocarpa_P1"/>

<taxon id="Abies_mariesii_P1"/>

<taxon id="Cathaya_argyrophylla_P1"/>

<taxon id="Cedrus_deodara_P1"/>

<taxon id="Keteleeria_evelyniana_P1"/>

<taxon id="Larix_decidua_P1"/>

<taxon id="Larix_occidentalis_P1"/>

<taxon id="Nothotsuga_longibracteata_P1"/>

<taxon id="Picea_abies_P1"/>

<taxon id="Picea_glauca_P1"/>

<taxon id="Picea_sitchensis_P1"/>

<taxon id="Pinus_contorta_P1"/>

<taxon id="Pinus_krempfii_P1"/>

<taxon id="Pinus_lambertiana_P1"/>

<taxon id="Pinus_monophylla_P1"/>

<taxon id="Pinus_nelsonii_P1"/>

<taxon id="Pinus_pinea_P1"/>

<taxon id="Pinus_ponderosa_P1"/>

<taxon id="Pinus_thunbergii_P1"/>

<taxon id="Pseudolarix_amabilis_P1"/>

<taxon id="Pseudotsuga_menziesii_P1"/>

<taxon id="Tsuga_canadensis_P1"/>

<taxon id="Abies_concolor_P2"/>

<taxon id="Abies_lasiocarpa_P2"/>

<taxon id="Cathaya_argyrophylla_P2"/>

<taxon id="Larix_laricina_P2"/>

<taxon id="Picea_abies_P2"/>

<taxon id="Picea_glauca_P2"/>

<taxon id="Pinus_strobus_P2"/>

<taxon id="Tsuga_chinensis_P2"/>

<taxon id="Tsuga_heterophylla_P2"/>

</taxa>

<taxa id="Conifers">

<taxon idref="Abies_concolor_P2"/>

<taxon idref="Abies_contorta_P1"/>

<taxon idref="Abies_lasiocarpa_P1"/>

<taxon idref="Abies_lasiocarpa_P2"/>

<taxon idref="Abies_mariesii_P1"/>

<taxon idref="Araucaria_columnaris_JX559989"/>

<taxon idref="Cathaya_argyrophylla_P1"/>

<taxon idref="Cathaya_argyrophylla_P2"/>

<taxon idref="Cedrus_deodara_P1"/>

<taxon idref="Cephalotaxus_sinensis_JX559896"/>

<taxon idref="Cryptomeria_japonica"/>

<taxon idref="Keteleeria_evelyniana_P1"/>

<taxon idref="Larix_decidua_P1"/>

<taxon idref="Larix_laricina_P2"/>

<taxon idref="Larix_occidentalis_P1"/>

<taxon idref="Nothotsuga_longibracteata_P1"/>

<taxon idref="Picea_abies_P1"/>

<taxon idref="Picea_abies_P2"/>

<taxon idref="Picea_glauca_P1"/>

<taxon idref="Picea_glauca_P2"/>

<taxon idref="Picea_sitchensis_P1"/>

<taxon idref="Pinus_contorta_P1"/>

<taxon idref="Pinus_krempfii_P1"/>

<taxon idref="Pinus_lambertiana_P1"/>

<taxon idref="Pinus_monophylla_P1"/>

<taxon idref="Pinus_nelsonii_P1"/>

<taxon idref="Pinus_pinea_P1"/>

<taxon idref="Pinus_ponderosa_P1"/>

<taxon idref="Pinus_strobus_P2"/>

<taxon idref="Pinus_thunbergii_P1"/>

<taxon idref="Podocarpus_macrophyllus_JX560047"/>

<taxon idref="Pseudolarix_amabilis_P1"/>

<taxon idref="Pseudotsuga_menziesii_P1"/>

<taxon idref="Sciadopitys_verticillata"/>

<taxon idref="Tsuga_canadensis_P1"/>

<taxon idref="Tsuga_chinensis_P2"/>

<taxon idref="Tsuga_heterophylla_P2"/>

</taxa>

<taxa id="P1">

<taxon idref="Abies_contorta_P1"/>

<taxon idref="Abies_lasiocarpa_P1"/>

<taxon idref="Abies_mariesii_P1"/>

<taxon idref="Cathaya_argyrophylla_P1"/>

<taxon idref="Cedrus_deodara_P1"/>

<taxon idref="Keteleeria_evelyniana_P1"/>

<taxon idref="Larix_decidua_P1"/>

<taxon idref="Larix_occidentalis_P1"/>

<taxon idref="Nothotsuga_longibracteata_P1"/>

<taxon idref="Picea_abies_P1"/>

<taxon idref="Picea_glauca_P1"/>

<taxon idref="Picea_sitchensis_P1"/>

<taxon idref="Pinus_contorta_P1"/>

<taxon idref="Pinus_krempfii_P1"/>

<taxon idref="Pinus_lambertiana_P1"/>

<taxon idref="Pinus_monophylla_P1"/>

<taxon idref="Pinus_nelsonii_P1"/>

<taxon idref="Pinus_pinea_P1"/>

<taxon idref="Pinus_ponderosa_P1"/>

<taxon idref="Pinus_thunbergii_P1"/>

<taxon idref="Pseudolarix_amabilis_P1"/>

<taxon idref="Pseudotsuga_menziesii_P1"/>

<taxon idref="Tsuga_canadensis_P1"/>

</taxa>

<taxa id="Pinus">

<taxon idref="Pinus_contorta_P1"/>

<taxon idref="Pinus_krempfii_P1"/>

<taxon idref="Pinus_lambertiana_P1"/>

<taxon idref="Pinus_monophylla_P1"/>

<taxon idref="Pinus_nelsonii_P1"/>

<taxon idref="Pinus_pinea_P1"/>

<taxon idref="Pinus_ponderosa_P1"/>

<taxon idref="Pinus_thunbergii_P1"/>

</taxa>


<!-- The sequence alignment (each sequence refers to a taxon above).         -->

<!-- ntax=38 nchar=1980                                                      -->

<alignment id="alignment" dataType="nucleotide">

<sequence>

<taxon idref="Ginkgo_biloba_SM"/>

??ATATTTATCTCGTATGCAAAGAGGAGGCGCAATACAACCCTTTGGATGTATGCTGACGGTGGAGGACATTACATTTAGAATTATAGCTTACAGTGAAAACGCAGTAGAAATGCTGGATCTCATTCCTAATTCG------------------------------GTCCCA------TCCATGGAGCAACAACAA------------------------CAAGAAGAAGTCCTAGCCATTGGGACCGATGTTCGAACCCTATTCACTCCTTCCAGTGCTCTGTCTTTAGAAAAAGCTGCAGCTGCCAAGGAAATTTCCCTGATGAACCCCATTTGGATGCACTGTAAACACTCTGGCAAGCCCTTCTATGCAATTGTTCATAGGATTGATGTTGGCATGGTGATAGATTTTGAGCCTGTCAAGACT---------------GGCGATGCTTCATTGTCAGCA------------------------GCAGGTGCAGTTCAATCACAGAAGCTTGCTGTCAGAGCCATTTCGCGCTTGCAGTCTATTCCGGGTGGTGATATTAGTCTGCTTTGTGATACTGTTGTTGAGGATGTCAGGGACCTCACTGGTTATGATAGAGTTATGGTATACAAGTTTCATGAGGACGAGCATGGCGAAGTTGTTGCAGAAATTAGGCGGTCGGATTTAGAACCTTATCTTGGGTTGCATTATCCTGCCACTGATATCCCTCAGGCTTCTCGGTTTCTTTTTATGCAGAACAGAGTGAGAATGATCTGTGATTGCTGTGCAACTCCTGTTAAGGTTATTCAAGATGAGGAATTGAGGCAGCCCCTCTGTTTGGTAGGTTCAACACTACGGGSGCCCCATGGGTGTCATGCACAATACATGGCAAATATGGGTTCGATTGCTTCCCTTGTTATGGCTGTGATAATCAATGGAACT------GATGAAGAAGSA------------------TTAAGCGGGCGTARTTCAATGAAGCTTTGGGGTYTGGTTGTGTGCCATCACACCTCCCCTCGTGCGGTCCCATTTCCTCTCCGTTATGCTTGTGAATTTCTGATGCAAGCATTTGGCCTTCRGCTGAACATGGAATTACAATTGGGGGCCCAATTGMMMGAGAAACACATTCTTAGAACTCAAACACTTTTGTGTGAYATGCTTCTCCGAGATGCCCCAATTGGAATTGTGACTCAGTCTCCGAGTATTATGGATCTTGTCAARTGTGACGGCGCWGCTTTGTACTATGGGGGCATGTTTTGGTTGCTAGGAGTGACCCCAACTGAAGCTCAAATAAAGGATATTGCAGATTGGTTACTTGAATACCATGCGGATTCGACAGGCCTGAGCACAGACAGTTTGGCAGATGCTGGTTATCCAGGTGCTCCTTCTCTTGGGGATGCAGTCTGTGGCATGGCTGCTGCCAGAATTACATCAAAAGACTTTTTGTTTTGGTTTAGATCCCATACTGCAAAAGAGATGAAGTGGGGAGGGGCAAAACATCATCCAGATGATAAGGATGATGGGCGGAGAATGCATCCTCGCTCCTCATTCAAGGCGTTTCTAGAAGTGGTGAAGAGAAGAAGTCTGCCTTGGGAAAATGTGGAAATGGATGCAATTCACTCCCTACAGCTTATTCTACGAGGTTCATTTCAAGATATTGACGACAGTGATACTAAAACCATGGTTCATGCTCGGCTAAATGATTTAAAATTGCAGGGCATAGATGAGCTTAGTTCCGTCGCAAGTGAGATGGTGCGGTTGATYGAAACAGCAACAGCACCTATTTTGGCTGTAGATTCTGGTGGGCTTGTTAATGGGTGGAATGCAAAAGTTGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCTATGGGGAAGTCCTTAGTTCATGATCTTGTCTTTGAAGAATCCGTGGAAACTGTTGAAAAGTTGCTCTACCACGCTTTAAGAGGTACACTTTTT

</sequence>

<sequence>

<taxon idref="Sciadopitys_verticillata"/>

?????????????????????????????????????????????GGATGCATGTTGGCGGTTGAGGAAAGCAGCTTCAATATCATTGCGTACAGTGAGAATGCAGTAGAGATGCTGGATCTCATGCCACATTAT------------------------------GTTCCTGTTAACAACATGGAAATGGAA---------------------------GGAGGAGGAGTGCTGAGAATAGGGACAGACGCGAGGAGCTTGTTCAGTCCGTCAAGTGCGAGGGCCATGGAGAAGGCTGCGATGGCGCAGGAGATAAGCCTGATGAACCCCATCTGGATGCACTGCAAGAAGAGTGGGAAGCCCTTCTATGCAATTCTCCATAGGATTGATGTTGGACTGGTCATAGATTTTGAGCCAGTGAGAACAGGG------------GGGGATGCGTCCCTGTCAGCA------------------------GCAGGGGGAGTGCAATCACAGAAGCTTGCAGTGAGGGCAATCTCACGCCTCCAGTCTCTCCCTGCGGGGGACATTGGGCTTCTTTGTGACACTGTTGTTGAGGACGTGAGAGAGCTGACTGGTTATGATAGGGTTATGGTTTATAAATTTCACGAAGATGAACACGGGGAAGTTGTTTCCGAAATCAGGAGGTCTGACTTGGAACCCTATCTAGGATTGCATTATCCTGCTACCGATATTCCTCAGGCTTCCAGGTTTCTCTTCATGCAGAACAGGGTAAGAATGATCTGTGATTGCTGTGCAACTCCTGTCAAGGTCGTACAGGCTGAGGAATTGAAGCAACCTCTATGTTTGGTGGGTTCCACATTACGGGCACCCCATGGATGCCATGCCCAGTACATGGCCAATATGGGTTCCATTGCTTCTCTTGTCATGGCTGTTATTATAAATGGGAAT------GATGAGGAAGGCGCA------------------AGTGGGAGAAGTTCCATGAAGCTCTGGGGATTGGTTGTTTGCCATCACACCTCCCCGCGAGCAGTGCCATTTCCTCTTCGCTATGCTTGTGAATTTCTGATGCAAGCATTTGGCCTTCAGCTTAACATGGAATTGCAATTGGCTGCTCAATTGACGGAGAAGCACATTCTTAGGACTCAGACTCTTCTCTGTGATATGCTTCTCCGAGATGCCCCCATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGCGCTGCTCTATATTATGGGGGCATGTTCTGGTTGCTTGGAGTGACACCAACTGAAGCTCAAATAAAGGATATTGCACACTGGTTGCTCGAATACCATGGGGATTCAACGGGTCTGAGCACAGACAGTTTGGCGGATGCTGGTTATCCGGGTGCAGCGTCTCTTGGGGATGCTGTTTGTGGTATGGCTGCTGCTAGAATCACATCAAAAGACTTCTTGTTCTGGTTTAGATCCCACACTGCAAAAGAGATGAAGTGGGGAGGTGCAAAGCATCATCCAGATGATAAAGATGATGGTCGAAGAATGCACCCTCGTTCCTCATTTAAGGCATTCCTAGAAGTTGTCAAAAGAAGAAGCTTGCCATGGGAAAATGTTGAAATGGATGCAATTCACTCGCTACAGCTTATTCTGCGCGGGTCCTTTCAAGACATCGATGACAGTGATACTAAAACCATGGTTCATGCTCGGCTAAATGATTTGAAATTGCAAGGCATAGATGAGCTTAGCTCTGTGGCAAGTGAGATGGTGCGTTTGATCGAAACTGCTACAGCACCTATTTTGGCTGTTGATTCTAGTGGGCTTATAAACGGATGGAATGCAAAGGTGGCAGAATTGACAGGCCTTCCAGTTAGAGAAGCTATGGGAAAGTCACTCGTTCATGACCTTGTTTTTGAAGAATCTGCAGAGGCTGCGGAGAAAATGCTCTATCACGCCCTAAGAGGA?????????

</sequence>

<sequence>

<taxon idref="Araucaria_columnaris_JX559989"/>

GCATATCTGTCGCGAATGCAAAGGGGGGGCACCATTCAGCCTTTCGGATGCATGCTCGCCGTGGAGGAGACCACTTTCCTAATCATCGCATACAGCGAGAACGCGGTGGAAATGCTGGATCTCATGCCTCAGTCT------------------------------GTACCC------AACATGGACATGGACAGAGACGAAGCCATGACAAGTCACGGCGGAGGAAGGGTTATGACAATTGGGACGGATGTACGGACTTTGTTCACTACGTCGAGCGCCCGCGCGCTGGAGAGAGCAGCGATGGCCCATGAAATAAGCCTGATGAATCCCATCTGGGTCCACTCTAAGAATACGAACAAGCCCTTCTACGCCATCGTCCACAGGATTGATGTTGGCATGGTCATGGACTTGGAGCCCGTCAGGACTGGCAGCGGCGGCGGAGGCGATGCAGCGTTGTCGGCG------------------------GCGGGTGCCGTGCAGTCACAGAAGCTGGCGGTGCGGGCCATCTCCCGCCTCCAGTCGCTGCCTGCGGGGGACATTGGTCTTCTATGCGACACCGTCGTCGAAGACGTCAGAGAGCTCACTGGCTACGACAGGGTTATGGTCTACAAGTTTCACGAAGACGAGCATGGGGAAGTCCTTGCAGAAATCAGGCGCTCTGACTTGGAACCCTATCTGGGACTTCATTATCCGGCTACTGATATCCCTCAGGCATCTCGCTTTCTTTTCATGCAGAACAGGGTCCGGATGATCTGTGATTGCCGTGCCGCTCCTGTTAAAGTCATACAGGCGGAGGAACTGAAGCAGCCCCTGTGTTTGGTGGGTTCTACATTGCGGGCGCCCCATGGATGTCATGCCCAGTACATGGCCAACATGGGTTCCATCGCCTCGCTTGTTATGGCTGTCGTCATCAATGGAAACGAAGACGAAGGAGGAGGGGGAGGTGGAAGCGGAAGCGGAAGCGGGCGAGGTTCCATGAAGCTGTGGGGGTTGGTTGTTTGCCATCACACGTCCCCGCGGGCGGTTCCGTTTCCTCTGCGGTACGCGTGTGAGTTTCTGATGCAGGCATTCGGACTCCAGCTGAATATGGAATTGCAATTGGCTGCTCAGCTGACGGAGAAACACATTCTGAGGACGCAGACGCTGCTGTGCGACATGCTGCTGCGAGATGCACCCATCGGAATCGTCACTCATTCTCCGAGCATCATGGACCCTGTCAAGTGTGATGGCGCTGCCCTTTACTACGGGGGAATGTGCTGGATGCTGGGAGTGACGCCCACCGAGGCTCAAATAAAAGACATCGCGGACTGGTTGCTGGAATATCATGTGGATTCTACAGGCCTCAGCACTGATAGTTTGGCTGATGCGGGCTATCCCGGTGCAGCCTCTCTTGGGGATGCCGTCTGTGGCATGGCTGCTGCCAGAATTACATCAAAGGACTTTCTCTTCTGGTTTAGATCCCACACTGCAAAAGAGATGAAGTGGGGAGGTGCAAAGCACCATCCCGACGATAAAGACGACGGTCGAAGAATGCACCCTCGATCTTCTTTCAAGGCATTCCTGGAAGTCGTCAAAAGAAGAAGTTTGCCATGGGAAAACGTAGAAATGGATGCCATTCATTCATTGCAGCTGATTCTGCGCGGTTCTTTTCAAGACATTGATGACAGCAATACTAAAACCATGGTTCATGCTCGCCTAAATGATTTGAAATTGCAGGGCATAGACGAGCTTAGCTGTGTGGCAAGTGAGATGGTGCGTCTGATCGAAACGGCTACGGCACCTATTTTGGCTGTGGATTCAAACGGACTCATAAATGGATGGAATGCAAAGGTGGCGGAATTAACAGGTCTTCCTGTTGGAGAAGCTATGGGCAAGTCACTTGTTCATGACCTTATCTTCGAGGAATCTGCCAATACTGTGGACAAAATGCTCTATCACGCCCTACGAGGTACACTA???

</sequence>

<sequence>

<taxon idref="Podocarpus_macrophyllus_JX560047"/>

GCATATCTCTCTCGAATGCAGAGAGGAGGAACCATCCAACCCTTCGGCTGTGTGCTCGCAGTGGAGGAAACCAACTTCAAAATCATAGCTTATAGCCAAAACGCACTCGAAATGCTGGACCTCATGCCTCAGTCT------------------------------GTCCCC------ACTATGGAGCTGGGAAAA------------------CATGGAGGAGGAGAAGTACTTACTATAGGCACAGATGTACGTACCCTTTTCACACCCTCTAGCGCGCGAGCTCTGGAGAAGGCAGCCATGGCCCCAGACATAAGCTTGATGAACCCCATCTGGGTCCATTCCCATTACAGTGGAAAACCCTTCAACGCCATTGTTCACAGAATTGATGTGGGTATGGTGATAGATTTGGAGCCTCGGAGAACT---------------GGGGACGCTGCTATGTCAACA------------------------GCAGGAGCGGTGCAGTCCCAGAAGTTTGCTGTGAGAGCAATCTCCAGACTCCAGTCACTACCAACTGGTGACATTGGGCTGCTCTGCGATACTGTTGTGGAGGATGTGAGAGAGCTAACTGGGTATGACAGAGTCATGGTTTATAAATTCCATGAGGATGAGCATGGGGAAGTTGTTGCGGAGATTAGGCGTGCTGACTTGGAACCCTACCTAGGGTTGCATTACCCTGCGACGGATATACCCCAGGCTTCGAGGTTTCTGTTCATGCAGAACAGGGTGAGGATGATATGTGATTGCAGTGCAACTCCTGTGAAGATGATTCAGTCCGAAGAATTGAGGCAACCGCTTTGTTTGGTTGGGTCCACACTGCGAGCACCCCACGGATGCCATGCCCAGTATATGGCAAACATGGGATCCATTGCTTCGTTGGTAATGGCTGTGGTGATTAATGGAAAT------GATGAGGAAGGGGGAGGA------------ACAAGTGGCCGAAGTTCCATGAAGCTCTGGGGGTTAGTTGTTTGCCATCATACTTCGTCTAGGGCTGTATCTTTTCCCCTGCGCTATGCTTGTGAATTCCTGATGCAGGCATTTGGGCTTCAGCTCAATATGGAATTGCAATTGGCTGCGCAGTTGACTGAGAAACACATTCTTCGGACTCAGACACTTCTTTGTGACATGCTTCTGAGGGATGCACCCATTGGAATTGTGACTCAGTCTCCAAGTATTATGGACCTTGTTAAGTGTGATGGAGCTGCTCTATACTATGGGGGCACCACCTGGTGTCTTGGGGTGACTCCCACAGAAGCTCAGATCAAGGATATTGCAGAATGGTTGCTGGAATACCATGGGGATTCAACTGGTCTCAGCACTGATAGTTTGGCTGATGCTGGTTATCCTGGAGCAGCTACACTTGGGGATGCTGTTTGTGGAATGGCAGCAGCTCGAATTACATCAAAGGATTTTTTGTTCTGGTTTCGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAGCATCATCCTGATGATAAGGATGATGGCCGAAGAATGCATCCTCGATCATCATTTAAGGCATTCTTAGAAGTTGTCAAGAGAAGAAGTTTGCCGTGGGAGAATGTGGAAATGGATGCCATTCACTCACTACAGCTTATTCTACGAGGTTCATTTCAAGACATTGATGACAGCGGTACTAAAACGATGGTCCATGCTCGGTTGACTGACTTGAAATTACAGGGCATTGATGAGCTTAGCTCTGTGGCCAGTGAGATGGTCCGATTGATCGAAACAGCTACAGCACCAATTCTGGCTATAGATTCTAACGGGCTTGTTAATGGATGGAATGCTAAGGTGGCAGAATTGACAGGTCTTCCAGTTGGAGAAGCTATGGGCAAATCACTAGTTCATGACGTTGTTTTGGAAGAATCTGCAGAGTGTGTGGAGAAAATGCTTTATCGAGCTTTAAGAGGTACGCTTTTC

</sequence>

<sequence>

<taxon idref="Cephalotaxus_sinensis_JX559896"/>

GCATACCTCTCTCGTATGCAAAGAGGAGGAAGCATTCAGCCATTCGGATGCATGCTTGCTGTTGAGGAAACCAGCTTCAAAATCATTGCATACAGTGAAAACGCACTTGAAATGCTGGATGTGATGCCGCACTCTCACTCTCACTCTCACTCTCACTCCCACTCTGTTCCC------ACCATGGAAGGAGGAGAA------------------------AGTGAAGGCATCGTGACAATCGGGAGTGATGTGCGGAGGCTGTTCACCCCATCCAGTGGGCGCAACTTGGAGAGGGCTGCGATGTCCCAGGAAATAAGCCTGGCCAACCCAATTGCCATGGACTCC---AGCAGTGGCAAGCCCTTCTATGCAATTGTGCACAGGATTGATGTTGGCATAGTCATAGATTTAGAGCTGGTGAGGAGA---------------GGTGATGCGGCAGCTTTGGTGTCATGGGGAGGGGGTGGCCTGGGGGGAGGGACTGTGCCATCCCAGAGACTTGCGGTGAGGGCAACGTCGAGACTGCAGGCAGTGCCAAGTGGGGACATTGGTCTGCTGTGTGACACTGTTGTGGAGGAAGTCAGGGAGCTCACTGGCTATGACAGGGTTATGGTTTACAAGTTTCATGAAGACGAGCATGGTGAAGTTGTGGCAGAAATCAGGCGCTCTGACTTGGAGCCCTACCTTGGACTACATTATCCTGCCACTGATATTCCTCAGGCATCTCGCTTTCTATTCATGCAGAACCGGGTACGGATGATCTGTGATTGCCGTGCCACTCCTGTCAAAGTTATACAGGCGGAAGAATTGAAGCAGCCCCTCTGTTTGGTGGGTTCCACATTGCGGGCGCCCCATGGTTGTCATGCTCAGTACATGGCCAATATGGGTTCCATTGCTTCTCTTGTTATGGCTGTCATCGTCAATGGTAATGGAAATGATGAAGATGGG------------GTAAGTGGAAGTGGCCGAAGTTCGATGAAGCTTTGGGGGCTGGTTGTTTGCCATCATACTTCACCGCGAGCTGTTCCATTTCCTCTTCGCTCTGCATGCGAATTTCTGATGCAGACATTTGGCCTTCAGATTAACATGGAATTGCAATTGGCTGCTCAATTAACAGAAAACAACATTCTTAGGACTCAGACACTTCTGTGCGATATGCTTCTCCGAGATGCACCTATTGGAATTGTAAGCCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGCGCTGCTCTGTACTATGGGGGCATGCTCTGGTTGCTGGGAGTGACCCCTGTGGAGGCTCAAATAAAGGATATTGCAGACTGGTTGCTTGAATGCCACGGGGATTCAACAGGTTTGAGCACGGATAGTTTAGCAGATGCTGGTTATCCCGGTGCAGCATCTCTTGGGGACGCTGTCTGTGGTATGGCTGCTGCTAGAATCACATCAAAAGATTTTTTGTTCTGGTTTAGATCCCACACTGCAAAAGAGATGAAGTGGGGAGGTGCGAAGCATCATCCTGATGATAAAGATGATGGCAGGAGAATGCACCCACGTTCCTCATTTAAGGCATTCCTAGAAGTCGTCAAGAGAAGAAGTTTGCCATGGGAAAATGTAGAAATGGATGCAATTCACTCTCTACAGCTTATTCTACGTGGTTCATTTGAAGGCATTGATGACAGTGATACGAAAACCATGGTTCATGCTCGGTTAAATGATTTAAAATTGCAGGGTATAGATGAGCTTAGCTCTGTGGCAAGTGAGATGGTACGTTTGATCGAAACAGCTACAGCACCTATTTTGGCTGTGGATTCTACCGGGATTGTAAATGGATGGAATGCAAAGGTGGGAGAATTGACAGGCCTT????????????????????????????????????????????????????????????????????????????????????????????????????????????

</sequence>

<sequence>

<taxon idref="Cryptomeria_japonica"/>

???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------??????------???????????????---------------------------???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------GAGGCGGCGGCTTTTGGGGCGTGGGGAGGAGCAGAGGGCGTCGCAGGAGGGGCTGTGCCGTCGCAGAGACTGGCCGTGAGGGCAACGTCGAGGCTGCAGGCTGTGCCCAACGGGGATATCGGTCTGCTTTGCGATGCTGTTGTTGAGGAAGTCAGGGAACTCACTGGGTATGACAGGGTTATGGTTTACAAGTTTCATGAAGATGAGCATGGGGAGGTTGTTGCAGAAATTAGGCGCTCTGACTTGGAGCCCTACCTTGGACTACATTATCCTGCCACTGATATTCCCCAGGCATCCCGGTTTCTTTTCATGCAGAACAGGGTGCGTGTGATCTGTGATTGCCGTGCTAATCCTGTCGGAGTCATACAGGTGGAGGAATTAAAGCAGCCCCTCTGTTTGGTGGGTTCTACGCTAAGGGCACCCCACGGTTGTCATGCTCAGTACATGGCTAATATGGGCTCAATTGCTTCTCTTGTTATGGCTGTAATTGTCAATGGAAATGGAAACGATGAAGAAGGC------------------AGCAGCGGGCGA------GTGAAGCTTTGGGGTTTGGTTGTTTGTCATCACACTTCACCTCGAGCCGTTCCCTTTCCCCTTCGCTCCGCTTGTGAATTTCTGATGCAGACATTTGGTCTTCAGATTAATATGGAAATGCAATTGGCTGCTCAATTGACAGAGAATAACATTCTTAGGACTCAAACACTTCTCTGTGATATGCTTCTCCGAGACGCACCTATTGGAATTGTAACCCAGTCTCCTAGTATCATGGATCTTGTTAAGTGTGATGGTGCTGCCCTTTACTACGGGGGTAAGTTCTGGTTGCTCGGAGTGACCCCCACGGGAGCTCAAATTAAGGACATTGCAGACTGGTTGCTTGAATACCACGGGGATTCAACAGGTTTGAGCACAGATAGTTTAGCAGATGCTGGCTACCCGGGTGCAGCATCCCTTGGGGATGCTGTCTGTGGTATGGCTGCTGCTAGAATCACATCAAAAGATTTTTTGTTCTGGTTTAGATCTCACACTGCAAAAGAGATGAAATGGGGAGGAGCAAAGCATCATCCCGATGATAAAGATGATGGTCGGAGAATGCACCCTCGTTCTTCATTCAAGGCATTCCTAGAAGTTGTCAAAAGAAGAAGCTTGCCATGGGAAAATGTAGAAATGGATGCAATTCACTCTCTGCAGCTTATCCTACGTGGTTCATTTCAAGACATTGATGACAGTGAAACTAAAACTATGGTTCATGTTCAGCTACATGATTTAAAATTGCAGGGCATTGATGAGCTTAGCTCCGTGGCAAATGAGATGGTGCGATTGATTGAAACAGCTACTGCACCTATTTTAGCTGTAGATTCTGCTGGAATTGTGAATGGATGGAATGCAAAGGCGGCAGAATTGACAGGACTTCCAGTTGGAGAAGCTATGGGCAAGTCATTAGTTCATGACCTTGTTTTTGAAGAATCTATGGAGACTGTGGAAAAAATGCTCTATCATGCTCTGAGAGGTACATTTTTT

</sequence>

<sequence>

<taxon idref="Abies_contorta_P1"/>

GCATATTTATCTCGAATTCAAAGAGGGGGAAGAGTACAGCCGTTTGGGTGTGTGCCGGCAGTGGAGGAGACCACTTTTAGGATCATCGCCTACAGTGAGAACGCACTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCATGGAACAGCCT---------------------------CAACAAGAAGTTCTGACAATCGGGACTGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTAACTCATTGGAAAAGGCAGCGGTGGCCCACGAAATAAGCCTTATGAACCCTATATGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGAATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAGGATT---------------GGGGATGCGTTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTACCTTCCGGTGATATCGGACTGCTGTGTGACACTGTTGTGGAGAATGTGAGAGAGCTGACTGGGTATGATAGGGTAATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTCGCGGAAATTAGGCGTTCAAACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTTCTCGCTTTTCTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCATGCGCAATACATGGGCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGCGGGAGGT---------------ACTGGACGAAATTCCTTGAAGCTCTGGGGTTTGGTTGTTTGCCACCATACCTCCCCGCGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTGAAGACTCAAACACTTCTGTGTGATATGCTTCTCCGAGATGCCCCTATTGGAATTGTAACTCAGTCTCCCAGTATAATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTCATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGACATTGCAGATTGGTTGCTTGAACACCATGGGGATTCAACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCGAGTGCCGCCTCTCTTGGGGATGCTGTCTGTGGCATGGCTTCCGCTAGAATCACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGATAAGGACGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTCATTCTACGAGGTTCATTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGCGCTTGCAGGGCATAGATGAACTTAGCTCTGTGGCTAGTGAGATGGTGCGTTTGATCGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCAAATGGACTTGTAAATGGGATGGAATGCAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTAGTTCAGGATCTTCTTTTTGAAGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATTCCTTTT

</sequence>

<sequence>

<taxon idref="Abies_lasiocarpa_P1"/>

GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTGGCAGTGGAGGAGACCACTTTTAGGATCATCGCCTACAGTGAGAACGCACTGGAAATGTTGGATCTGGCGCCACAGTCT------------------------------GTCCTG------AGCATGGAACAGCCT---------------------------CAACAAGAAGTTCTGACAATCGGGACTGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTAACTCATTGGAAAAGGCAGCGGTGGCCCACGAAATAAGCCTTATGAACCCTATATGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGAATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTACCTTCCGGTGATATCGGACTGCTGTGTGACACTGTTGTGGAGAATGTGAGAGAGCTGACTGGGTATGATAGGGTAATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATTAGGCGTTCAAACTTGGAGCCCTATCTGGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAAGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCATGCGCAATACATGGGCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGCGGGAGGT---------------ACTGGACGAAATTCCTTGAAGCTCTGGGGTTTGGTTGTTTGCCACCATACCTCCCCGCGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTGAAGACTCAAACACTTCTGTGTGATATGCTTCTCCGAGATGCCCCTATTGGAATTGTAACTCAGTCTCCCAGTATAATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTCATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGACATTGCAGATTGGTTGCTTGAACACCATGGGGATTCAGCGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCGGGTGCCGCCTCTCTTGGGGATGCTGTCTGTGGCATGGCTTCCGCTAGAATCACTTCAAAGGAATTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGATAAGGACGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCACTTCTAGAAGTGGTCAAAAGAAGAAGCTCACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTCATTCTACGAGGTTCATTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGCGCTTGCAGGGCATAGATGAACTTAGCTCTGTGGCTAGTGAGATGGTGCGTTTGATCGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCAAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTAGTTCAGGATCCTCTTTTTGAAGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATTCCTTTT

</sequence>

<sequence>

<taxon idref="Abies_mariesii_P1"/>

GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGGTGCGTGCTGGCAGTGGAGGAGACCACTTTTAGGATCATCGCCTACAGTGAGAACGCACTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCGTGGAACAGCCT---------------------------CAACAAGAAGTTCTGACAATCGGGACTGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTAACTCATTGGAAAAGGCAGCGGTGGCCCACGAAATAAGCCTTATGAACCCTATATGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGAATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAGGAAT---------------GGGGATGCGTTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTACCTTCCGGTGATATCGGACTGCTGTGTGACACTGTTGTGGAGAATGTGAGACAGCTGACTGGGTATGATAGGGTAATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATTAGGCGTTCAAACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAAGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCATGCGCAATACATGGGCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGCGGGAGGT---------------ACTGGACGAAATTCCTTGAAGCTCTGGGGTTTGGTTGTTTGCCACCATACCTCCCCGCGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAAAACATTCTGAAGACTCAAACACTTCTGTGTGATATGCTTCTCCGAGATGCCCCTATTGGAATTGTAACTCAGTCTCCCAGTATAATGGATCTTGTCAGGTGTGATGGTGCTGCTCTTCATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGACATTGCAGATTGGTTGCTTGAACACCATGGGGATTCAACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCGGGTGCCGCCTCTCTTGGGGATGCTGTCTGTGGCATGGCTTCCGCTAGAATCACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAAGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGATAAGGACGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCGTGGGACAATGTGGAGATTGATGCAATTCACTCGCTACAGCTCATTCTACGAGGTTCATTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGCGCTTGCAGGGCATAGATGAACTTAGCTCTGTGGCTAGTGAGATGGTGCGTTTGATCGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCAAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTAGTTCAGGATCTTCTTTTTGAAGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATTCCTTTT

</sequence>

<sequence>

<taxon idref="Cathaya_argyrophylla_P1"/>

??????TTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTCGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGCGAACGCAGTGGAAATGCTGGATCTGGCGCCACAATCT------------------------------GTCCCG------AGCATGGAGCAACCT---------------------------CAACCAGAAGTTCTGACAATCGGGACCGACGTTCGAATCCTGTTCACTGCTGCCAGTGCTCACTCATTGGAAAAAGCAGCCGTAGCCCAAGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGAATGGTGATAGATTTTGAGCCCTTGAAGAGT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCGGTACAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATATCGGCTTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAATTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTCTCGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCAGCCACAGATATCCCACAGGCATCTCGATTTCTTTTTATGCAAAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCAGTGAAGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCACCCCACGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTCATGGCTGTGATTATTAATGGGAAT------GATGACGAAGGAGGATGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCTCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACGGAAAAACACATCCTTAGGACTCAAACTCTTCTCTGTGATATGCTTCTCCGAGATGCCCCAATTGGGATTGTAACTCAGTCTCCTAGTATCATGGATCTTGTCAAATGTGATGGTGCTTCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCCACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCAGGTGCCCCTTCTCTTGGGGATGCGGTCTGCGGCATGGCTTCCGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGCGGAGCAAAACATCACCCAGATGATAAGGACGATGGCCGGAGGATGCACCCTCGATCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTGAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCAGCTAAATGATTTGAGATTACAGGGCATAGACGAACTTAGCTCTGTGGCTAGCGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACCGGCCTTTCAGTTGGAGAAGCTATGGGCATGCCCCTTGTTCAGGATCTTGTTTTAGGGGACTCTGTGGAGAGGGTTGAAAAAATGCTATACAATGCCTTAAGAGGG?????????

</sequence>

<sequence>

<taxon idref="Cedrus_deodara_P1"/>

GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCCTTTGGGTGTGTGCTCGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGTGTCACAGTCT------------------------------GTCCCC------AGCATGGAACAACCT---------------------------CAGTCAGAAGTTCTGACAATTGGGACCGACGTTCGAACTCTGTTCACTGCGGCCAGTGCTCACTCATTGGAAAAGGCAGCCATGGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAAGACT---------------GGGGATGCGTTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCAATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATATTGGTCTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAGCTGACTGGGTATGATAGGGTTATGGTATACAAGTTCCATGAAGACGAACACGGGGAGGTTGTTGCGGAAATTAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTTCTCGCTTTCTCTTTATGCAGAACAGGGTACGAATGATCTGTGATTGCATGGCAACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTCTGTTTAGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCACGCGCAATATATGGCCAACATGGGTTCCGTTGCTTCACTTGTTATGGCGGTGATTATTAATGGGAAC------GATGATGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCCTTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATACTTAGGACTCAAACGCTTCTGTGTGACATGCTTCTCCGAGATGCCCCAATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAACCCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACTGCGATTCAACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCGGGTGCCGCCTCTCTTGGGGATGCAGTCTGTGGCATGGCTTCCGCTAGAATTACTTCGAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGATAAGGATGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCATTCGCTACAGCTTATTCTACGAGGTTCATTGCAAGATATTGATGACAGTAGTACTAAAACTATGGTTCATGCCCGGCTAAATGATTTGAGATTGCAGGGCATAGATGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTAGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTGGAGGAGTCTGTGGAGAGGGTTGACAAAATGCTCGACAATGCCATAAGAGGTATTCATTTT

</sequence>

<sequence>

<taxon idref="Keteleeria_evelyniana_P1"/>

GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCCTTTGGGTGTGTGCTGGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCACTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCATGGAACATCCT---------------------------CAACCAGAAGTACTGAAAATCGGGACGGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTCATTCATTGGAAAAGGCAGCGGTAGCCCATGAAATAAGCCTTATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTAGGGATGGTGATAGATTTTGAGCCCCTCAGGACT---------------GGGGACGCGTTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATGTCGGACTGCTGTGTGATACTGTTGTGGAGAATGTGAGAGAGCTGACTGGGTATGATAGGGTCATGGTATACAAATTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATCAGACGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGACATCCCTCAGGCTTCTCGCTTTCTATTTATGCAGAATAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAGGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGCGGCAGGA---------------AGTGGACGAAATTCTATGAAGCTCTGGGGTTTGGTCGTTTGCCACCATACCTCCCCGCGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTTAAGACTCAAACACTTCTGTGTGATATGCTTCTCCGAGATGCCCCAATCGGAATCGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGATTGGTTGCTTGAACACCATGGTGATTCAACAGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCCGGTGCCGCCTCTCTTGGGGATGCAGTCTGTGGCATGGCTTCCGCTAGAATTACTTCAAAAGATTATCTTTTTTGGTTTAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGACGATAAGGACGATGGCCGGAGGATGCACCCTCGCTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGTTTACCATGGGACAATGTGGAAATTGATGCGATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGATATCGATGACAGCGGTACTAAAACTATGGTTCATAATCGGCTAAATGACTTGAGATTGCAGGGCATAGATGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATCGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCAAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAACTGACAGGCCTTCCAGTTAGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATTCCTTTA

</sequence>

<sequence>

<taxon idref="Larix_decidua_P1"/>

GCATATTTATCCCGAATTCAAAGGGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTTGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACCAGAATTTCTGACAATCGGGACCGACGTTCGAACCCTGTTCACCGCCGCCAGTGCTCACTCATTGGAAAAGGCAGCCGTGGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGGATGGTGATAGATTTTGAGCCCTTGAAGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTACAGTCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATATCGGCCTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAGCTGACTGGGTATGAAAGGGTCATGGTATATAAGTTTCATGAAGACGAACACGGGGAAGTTGTCGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCGGCCACCGATATCCCTCAGGCTTCCCGCTTTCTGTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAAGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGCGCGCCCCATGGGTGCCACGCCCAATACATGGCTAACATGGGTTCTGTTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGGAGGAGGG---------------AGTGGGCGAAATTCAATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCACGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGATATGCTACTCCGAGATGCCCCGATGGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGACGGTGCTGCTCTTTACTATGGAGGTATGTGCTGGATGTTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTACTTGAACACCACGGGGATTCAACAGGCCTGAGCACGGATAGTTTGGCAGATGCAGGTTATCCAGGTGCCGCCTCTCTTGGAGATGCAGTCTGCGGCATGGCTTCCGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGATAAGGACGACGGCCGGAGGATGCACCCTCGTTCATCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTGCCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAAGGCATGGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCAAGTCACTTGTTCAGGATCTTGTGTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATACCTTAC

</sequence>

<sequence>

<taxon idref="Larix_occidentalis_P1"/>

??ATATTTATCTCGAATTCAAAGGGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTTGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACCAGAATTTCTGACAATCGGGACCGACGTTCGAACCCTGTTCACCGCCGCCAGTGCTCACTCATTGGAAAAGGCAGCCGTGGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGGATGGTGATAGATTTTGAGCCCTTGAAGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTACAGTCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATATCGGCCTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAGCTGACTGGGTATGAAAGGGTCATGGTATATAAGTTTCATGAAGACGAACACGGGGAAGTTGTCGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCGGCCACCGATATCCCTCAGGCTTCCCGCTTTCTGTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAAGGTTATCCAG????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------??????????????????---------------???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????

</sequence>

<sequence>

<taxon idref="Nothotsuga_longibracteata_P1"/>

GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCCTTTGGGTGTGTCCTGGCAGTGGAGGAGGCCACTTTTAGGATTATTGCGTACAGTGAGAACGCAGTGGAATTGCTGGATCTGGCGCCACAGCCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACCAGAAGGTCTGACAATCGGGACTGACGTTCGAACCCTGTTCACTGCCGCCAGTTCTCACTCACTGGAAAAGGCAGCCGTGGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATATCGGGTTGCTGTGTGATACGGTTGTCGAGAATGTGAGAGAGCTGACTGGGTATGATAGGGTCATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATTCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTAAAGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATCAATGGGAAT------GATGACGAAGCGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTTTGCCACCATACCTCCCCGCGGGCTGTTCCGTTTCCTCTCCGTTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTTAAGACCCAAACACTTCTGTGTGATATACTTCTCCGAGATGCCCCAATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCATGGGGATTCAACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCGGGTGCCGCATCTCTTGGGGATGCAGTGTGTGGCATGGCTTCCGCTAGAATAACTTCAAACGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGACAAGGACGATGGTCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTAGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGATATTGACGACAGTGGTACCAAAACTATGGTTCATGCACGGCTAAATGATTTGAGATTGCAGGGCATAGATGAACTTAGCTCTGTGGCTAGTGAGATGGTGCGTTTAATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCTAATGGACTTATAAATGGATGGAATGCAAAAGTAGCAGAATTGACAGGCCTTCAAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCACGATCTCATTTTTGAGGAGTCTGTCGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATTCCTTTT

</sequence>

<sequence>

<taxon idref="Picea_abies_P1"/>

GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTCGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCACAATCT------------------------------GTACCG------AGCATGGAACAACCT---------------------------CAACTAGAAGTTCTGACAATCGGTACCGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTCACTCATTGGAAAAGGCAGCCGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGAATGGTGATAGATTTTGAGCCCTTGAAGACT---------------GGGGATGCGTTCGTGTCAGCG------------------------GCTGGTGCAGTACAATCTCAGAAGCTTGCTGTGCGGGCGATTTCTCGTCTGCAGTCACTTCCTTGTGGTGATATCGAGCTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAATTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTACATTACCCGGCCACCGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGCAGGTTATCCAGTCCGAGGAATTAATGCAGCCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCTCTTGTTATGGCCGTGATTATTAACGGGAAT------GATGATGAAGGTGCGGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTATGATGCAAGCGTTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACGGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGATATGCTTCTCCGAGATGCCCCAATTGGAATTGTAACCCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTACGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCCGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCACCCAGACGATAAGGACGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTAGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTTTACGAGGTTCGTTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGACGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTATGCAATGCCTTAAAAGGTATACCTTTT

</sequence>

<sequence>

<taxon idref="Picea_glauca_P1"/>

GCTTATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTCGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCACAATCT------------------------------GTACCG------AGCATGGAACAACCT---------------------------CAACTAGAAGTTCTGACAATCGGTACCGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTCACTCATTGGAAAAGGCAGCCGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGAATGGTGATAGATTTTGAGCCCTTGAAGACT---------------GGGGATGCGTTCGTGTCAGCG------------------------GCTGGTGCAGTACAATCTCAGAAGCTTGCTGTGCGGGCGATTTCTCGTCTGCAGTCACTTCCTTGTGGTGATATCGAGCTGCTGTGTGATTCTGTTGTGGAGAATGTGAGGGAATTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTACATTACCCGGCCACTGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGCAGGTTATCCAGTCCGAGGAATTGATGCAGCCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCTCTTGTTATGGCCGTGATTATTAACGGGAAT------GATGATGAAGGTGCGGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTATGATGCAAGCGTTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACGGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGATATGCTTCTCCGAGATGCCCCAATTGGAATTGTAACCCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTACGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCCGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCACCCAGACGATAAGGACGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTAGTCAAAAGAAGAAGTTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTTTACGAGGTTCGTTTCAAGATATCGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATAGACGAGCTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTAAAAAAATGCTATGCAATGCCATAAGAGGTATACCTTTT

</sequence>

<sequence>

<taxon idref="Picea_sitchensis_P1"/>

GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGGTGTGTGCTCGCAGTGGAGGAGACCACTTTTAGGATCATCGCTTACAGTGAGAACGCGGTGGAAATGCTGGATCTGGCGCCACAATCT------------------------------GTACCG------AGCATGGAACAACCT---------------------------CAACTAGAAGTTCTGACAATCGGTACCGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTCACTCATTGGAAAAGGCAGCCGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGAATGGTGATAGATTTTGAGCCCTTGAAGACT---------------GGGGATGCGTTCGTGTCAGCG------------------------GCTGGTGCAGTACAATCTCAGAAGCTTGCTGTGCGGGCGATTTCTCGTCCGCAGTCACTTCCTTGTGGTGATATCGAGCTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAATTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTACATTACCCGGCCACCGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGCAGGTTATCCAGTCCGAGGAATTGATGCAGCCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCTCTTGTTATGGCCGTGATTATTAACGGGAAT------GATGATGAAGGTGCGGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTATGATGCAAGCGTTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACGGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGATATGCTTCTCCGAGATGCCCCAATTGGAATTGTAACCCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTACGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACGGGCCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCCGCTATAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCACCCAGACGATAAGGACGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTAGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTTTACGAGGTTCGTTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTATGCAATGCCTTAAGAGGTATACCTTTT

</sequence>

<sequence>

<taxon idref="Pinus_contorta_P1"/>

????????????????????????????????AATACAGCCGTTTGGCTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCCCAATCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACAAGACGTTCTGACAATCGGGACCGATGTTCGAACCCTGTTCACTGCTGCTAGTGCTCACTCATTGGAGAAGGCAGCAGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCATTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTAGGCATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTCCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGGCTGCAGTCACTTCCTTGCGGTGATGTTGGCTTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTTTACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTGCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGAGGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGAGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTAGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAGTTAACAGAGAAACACATTCTTAAGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCAATGGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGTTGGGAGTGACCCCAACTGAAGCTCAAATCAAAGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACAGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCATCCGGACGACAAGGACGATGCTCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTTGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGTCTCCCGGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTACACAATGCCTTAAGAGGTATACCTTTT

</sequence>

<sequence>

<taxon idref="Pinus_krempfii_P1"/>

??ATATTTATCTCGAATTCAAAGAGGGGGAATAATACAGCCGTTTGGGTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCTCCCCAATCG------------------------------GTCCCG------AGCATGGAACAATCT---------------------------CAACAAGAAGTTCTGACAATCGGGACCGATGTTCGAACCCTGTTCACTGCTGCTAGTTCTCACTCATTGGAAAAGGCAGCGGTAGCTCAGGAAATAAGCCTCATGAACCCTATCTGCGTTCATTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTGGGGATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGCCTGCAGTCACTTCCTTGCGGTGATATTGGATTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTTCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCGCCCCATGGATGCCACGCCCAGTACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGATGAAGGGGGAGGG---------------AGTGCACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTTGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACAGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCAATGGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGAAAGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCCACGGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCTGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCACCCGGATGACAAGGACGATGGCCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTCGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCCCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCAGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTCCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTAAAGAGTCTGTGGAGAGGGTTGAAAAAATGCTATACAATGCCTTAAGAGGTATACCTTTT

</sequence>

<sequence>

<taxon idref="Pinus_lambertiana_P1"/>

??ATATTTATCTCGAATTCAAAGAGGGGGAATAATACAGCCGTTTGGGTGTGTACTAGCAGTGGAGGAGACCACTTTTAGCATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCTCCCCAATCG------------------------------GTCCCG------AGCATGGAACAATCT---------------------------CAACAAGAAGTTCTGACAATCGGGACCGATGTTCGAACCCTGTTCACTGCTGCTAGTTCTCACTCATTGGAAAAGGCAGCGTTAGCTCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCATTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTGGGGATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCGGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGCCTGCAGTCACTTCCTTGCGGTGATATTGGATTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTTCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCGCCCCATGGATGCCACGCCCAGTACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGATGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGTCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTTGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACAGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGACATGCTTCTCCGACATGCCCCAATGGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGAAAGTGCTGGATGCTGGGAGTAACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCCACGGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCTGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCACCCGGATGACAAGGACGATGGCCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTCGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCCCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCAGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGATGTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTCCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAAGAGTCTGTGGAGAGTGTTGAAAAAATGCTATACAATGCCTTAAGAGGTATACCTTTT

</sequence>

<sequence>

<taxon idref="Pinus_monophylla_P1"/>

??????????????????????????????ATAATACAGCCGTTTGGGTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCACCCCAATCG------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACAAGAAGTTCTGACAATCGGGACCGATGTTCGAACCCTTTTCACTGCTGTTAGTTCTCACTCACTGGAAAAGGCAGCGGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCATTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTGGGGATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGCCTGCAGTCACTTCCTTGCGGTGACATTGGGTTGTTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTGCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCAGCCCATGGGTGCCACGCCCAGTACATGGCCAACATT---TCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGATGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTCCGCTATGCGTGCGAATTTCTGATGCAAGCATTTGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACAGAAAAACACATTCTTAGGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCAATTGGTATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGAATGTGCTGGATGCTTGGAGTGACCCCAACTGAAGCTCAAGTCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCCACGGGCCTGAGCACGGATAGCTTGGCAGATGCTGGATATCCAGGTGCCGCTTCTCTTGGGGATGCTGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCACCCGGATGACAAGGACGATGGCCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTCGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCCCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCAGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCCAGTGAAAGGGGCCAATTGATTGAA?CAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTCCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAAGAGTCTGTGGAGAGGGTTGAAAAAATGCTATACAATGCCTTAAGAGGTATACCTTTT

</sequence>

<sequence>

<taxon idref="Pinus_nelsonii_P1"/>

??ATATTTATCTCGAATTCAAAGAGGGGGAATAATACAGCCGTTTGGGTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCACCCCAATCG------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACAAGAAGTTCTGACAATCGGGACCGATGTTCGGACCCTTTTCACTGCTGCTAGTTCTCACTCATTGGAAAAGGCAGCGGTAGCCCAGGAAATAAGCCTTATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTGGGGATGGTGATAGATTTGGAGCCATTGAGTACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGCCTGCAGTCACTTCCTTGCGGTGACATTGGGTTGTTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTTTACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTGCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACGGATATTCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCACGCCCAGTACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGATGAAGGGGGCGGG---------------AATGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTTCGCTATGCGTGCGAATTTCTGATGCAAGCATTTGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACAGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCGATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGAATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAGTCAAGGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCCACGGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCCGCTTCTCTTGGGGATGCTGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAAATGAAGTGGGGAGGAGCAAAACATCACCCGGATGACAAGGACGATGGCCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTCGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCCCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCAGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGATTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTCCCAGTTGGAGAAGCCATGGGCATGCCCCTTGTTCACGATCTTGTTTTTGAAGAGTCTGTGGTGAGGGTTGAAAAAATGCTATACAATGCCTTAAGAGGTATACCTTTT

</sequence>

<sequence>

<taxon idref="Pinus_pinea_P1"/>

GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCATTTGGCTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCCCAATCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACAAGACGTTCTGACAATCGGGACCGATGTTCGAACCCTGTTCACTGCTGCTAGTGCTCACTCATTGGAGAAGGCAGCAGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGG?TCATTGTAAAAACTCCAGAAAA?CCTTTTATGCAATTGTGCATAGGATTGATGTAGGCATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTCCAATCGCAGAAGCTCGCTGTGAGGGCGATTTCTCGGCTGC?GTCACTTCCTTGCGGTGATGTTGGGTTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTTTACAAGTTTCATGAAGATGAACACGGGG?AGTTGTTGCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGG?TATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCA?TGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGATGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGAGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTAGGTCTTCAGCTGAACATGGAATTGCAATTGGCAG?TCAATTAACAGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCAATGGGAATTGTAACTCAG?CTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGTTGGGAGTGACCCCAACTGAAGCTCAAATCAAAGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACAGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATC?CACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCATCCGGATGACAAGGACGATGCTCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTTGAAGTGGTCAAAAGAAGAAGCTTAC?ATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGACTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTCCCGGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATG?TAAACAATGCCTTAAGAGGTATACCTTTT

</sequence>

<sequence>

<taxon idref="Pinus_ponderosa_P1"/>

??ATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCGTTTGGCTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCCCAATCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACAAGACGTTCTGACAATCGGGACCGATGTTCGAACCCTGTTCACTGCTGCTAGTGCTCACTCATTGGAGAAGGCAGCAGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCATTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTAGGCATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTCCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGGCTGCAGTCACTTCCTTGCGGTGATGTTGGCTTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTTTACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTGCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTACATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGAGGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGAGGGCGGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTAGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAGTTAACAGAGAAACACATTCTTAAGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCAATGGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGTTGGGAGTGACCCCAACTGAAGCTCAAATCAAAGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACAGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCATCCGGACGACAAGGACGATGCTCGACGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTTGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTCCCGGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTACACAATGCCTTAAGAGGTATACCTTTT

</sequence>

<sequence>

<taxon idref="Pinus_thunbergii_P1"/>

??ATATTTATCTCGAATTCAAAGGGGGGGAAGAATACAGCCGTTTGGCTGTGTACTAGCAGTGGAGGAGACCACTTTTAGGATCATTGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCCCAATCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACAAGACGTTCTGACAATCGGGACCGATGTTCGAACCCTGTTCACTGCTGCTAGTGCTCACTCATTGGAGAAGGCAGCAGTAGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCATTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTGCATAGGATTGATGTAGGCATGGTGATAGATTTGGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTCCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGGCTGCAGTCACTTCCTTGCGGTGATGTTGGGTTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAACTGACTGGTTATGACAGGGTCATGGTTTACAAGTTTCATGAAGATGAACACGGGGAAGTTGTTGCTGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACAGATATACCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCATGGCTACTCCCGTGAAGGTTATCCAGTCTGAGGAATTGATGCAACCTCTATGTTTGGTGGGTTCAACGCTTCGGGCACCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGATGAAGGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGAGGGCGGTCCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTAGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTAACGGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGACATGCTTCTCCGAGATGCCCCAATGGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGTTGGGAGTGACCCCAACTGAAGCTCAAATCAAAGATATTGCAGACTGGTTGCTTGAACACCACGGGGATTCTACAGGCCTGAGCACGGATAGCTTGGCAGATGCTGGTTATCCAGGTGCTGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCAGCTAGAATTACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGAGCAAAACATCATCCGGATGACAAGGACGATGCTCGACGGATGCATCCTCGTTCCTCTTTCAAGGCATTCCTTGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGCTCGTTTCAGGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATAGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTATAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACGGGCCTTCCGGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGCAGTCTGTGGAGAGGGTTGAAAAAATGCTACAGAATGCCTTAAGAGGTATACCTTTT

</sequence>

<sequence>

<taxon idref="Pseudolarix_amabilis_P1"/>

GCATATTTATCTCGAATTCAAAGAGGGGGAAGAATACAGCCCTTTGGGTGTGTGCTGGCAGTGGAGGAGATCACTTTTAGGATCATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCACAGTCA------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACCAGAAACTCTGACAATCGGGACTGACGTTCGAACCCTGTTCACTGCCGCCAGTGCTCACTCATTGGAAAAGGCAGCCTTGGCCCAGGAAATAAGCCTCCTGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAGGACT---------------GGGGATGCGTTCATGTCTGCG------------------------GCTGGCGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTGCAGTCACTTCCTTGCGGTGATATCGGACTGCTGTGTGATACTGTTGTGGAGAATGTGAGAGAACTGACCGGGTATGATAGGGTCATGGTATACAAGTTTCATGAAGACGAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACCCCCGTGAAGGTTATTCAGTCCGAGGAGTTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCATGCGCAATACATGTCCAACATGGGTTCCGTTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGCGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTTTGCCACCATACCTCTCCGCGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTTAAGACTCAAACACTTCTGTGTGATATGCTTCTCCGAGATGCCCCGATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAGCTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCATGGAGATTCAACGGGCCTGAGCACAGATAGTTTGGCAGATGCTGGTTATCCAGGTGCCGCCACTCTTGGGGATGCAGTCTGTGGCATGGCTTCCGCTAGAATAACTTCAAAAGATTTTCTTTTCTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGATAAGGACGACGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCATGGGATAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCGAGATATTGATGACAGTGGTACTAAAACGATGGTTCATGCTCGGCTAAATGATTTGAGATTGCAGGGCATAGATGAACTTAGCTCCGTGGCCAGTGAGATGGTGCGTTTGATTGAAACAGCCACAGCACCTATTTTGGCTGTAGATCCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACGATGCCTTAAGAGGTATTCCTTTT

</sequence>

<sequence>

<taxon idref="Pseudotsuga_menziesii_P1"/>

GCTTATTTATCTCGAATTCAAAGGGGAGGAAGAATACAGCCATTTGGGTGTGTGCTCGCAGTGGAGGAGACCACTTTTAGGATTATCGCTTACAGTGAGAACGCAGTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACCAGAAGTTCTGACAATCGGGACCGACGTTCGAACCCTGTTCACCGCCGCCAGTGCTAACTCATTGGAAAAGGCAGCTGTGGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTCCATAGGATTGATGTGGGGATGGTGATAGATTTTGAGCCCTTGAAGACC---------------GGGGATGCGTTCATGTCAGCG------------------------GCTGGTGCAGTACAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCTACAGTCACTTCCTTGCGGTGATATCGGTCTGCTGTGTGATACTGTTGTGGAGAATGTGAGGGAGCTGACTGGGTATGACAGGGTCATGGTATACAAGTTTCATGAAGATGAGCACGGGGAAGTTGTCGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCGGCCACCGATATCCCTCAGGCTTCTCGCTTTCTGTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCATGGCAACTCCCGTGAAGCTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCACGCCCAATACATGGCCAACATGGGTTCCGTTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGACGAAGGAGGAGGA---------------AGTGGGCGAAATTCAATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCTGTTCCGTTTCCTCTCCGCTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAGTTGGCAGCTCAATTGACGGAGAAACACATTCTTAGGACTCAAACGCTTCTCTGTGATATGCTACTCCGAGATGCCCCAATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGACGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTACTTGAACACCACGGAGATTCAACAGGCCTGAGCACGGATAGTTTGGCAGATGCAGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTCTGCGGCATGGCTTCCGCTATAATTACTTCAAAGGAATTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAATGGGGAGGTGCAAAACATCACCCAGATGACAAGGATGATGGCCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTTCCATGGGACAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGATATTGATGACAGTGGTACTAAAACTATGGTTCATTCTCGGCTAAATGATTTGAGATTGCAGGGCATGGACGAACTTAGCTCCGTGGCTAGTGAGATGGTGCGTTTGATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCTAATGGACTCGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGAGCATGTCACTTGTTCAGGATCTTGTGTTTGAGGAGTCTGTGCAGAGGGTTGAAAAAATGCTCAACAATGCCTTAAGAGGTATACCTTTT

</sequence>

<sequence>

<taxon idref="Tsuga_canadensis_P1"/>

GCATATTTATCTCGAATTCAAAGAGGGGGGAGAATACAGCCCTTTGGGTGTGTCCTGGCAGTGGAGGAGACCACTTTTACGATCATCGCGTACAGTGAAAACGCAGTGGAAATGCTGGATCTGGCGCCACAGTCT------------------------------GTCCCG------AGCATGGAACAACCT---------------------------CAACCAGAAGCTCTGACAATCGGGACTGACGTTCGAACCCTGTTCACTGCGGCCAGTGCTCACTCATTGGAAAAGGCAGCAGTGGCCCAGGAAATAAGCCTCATGAACCCTATCTGGGTTCACTGTAAAAACTCCAGAAAACCCTTTTATGCAATTGTTCATAGGATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTAAGGACT---------------GGGGATGCGGTCATGTCTGCG------------------------GCTGGTGCAGTGCAATCTCAGAAGCTCGCTGTGAGGGCGATTTCTCGTCCGCAGTCACTTCCTTGCGGTGATATCGGGCTGCTGTGTGATACGGTTGTCGAGAATGTGAGAGAGCTGACTGGGTATGATAGGGTCATGGTATACAAGTTTCATGAGGACGAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTTCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATTTGCGATTGCATGGCAACCCCCGTAAAGGTTATCCAGTCCGAGGAATTGATGCAACCTCTATGTTTAGTGGGTTCAACGCTTCGGGCGCCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCGTTGCTTCGCTTGTCATGGCTGTGATTATCAATGGGAAT------GATGACGAAGCGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTTTGCCACCATACTTCCCCGCGGGCTGTTCCGTTTCCTCTTCGTTATGCTTGCGAATTTCTGATGCAAGCATTCGGTCTTCAGCTGAACATGGAATTGCAATTGGCAGCTCAATTGACGGAGAAACACATTCTTAAGACTCAAACACTTCTGTGTGATATGCTTCTCCGAGATGCTCCAATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGACGGTGCTGCTCTTTATTATGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCAGACTGGTTGCTTGAACACCATGGGGATTCAACGGGTCTGAGCACGGATAGTTTGGCAGATGCTGGTTATCCAGGTGCCGCCTCTCTTGGGGATGCAGTGTGTGGCATGGCTTCCGCTAGAATAACTTCAAAAGATTTTCTTTTTTGGTTCAGATCCCACACTGCAAAGGAGATGAAGTGGGGAGGTGCAAAACATCACCCAGATGACAAGGACGATGGTCGGAGGATGCACCCTCGTTCCTCTTTCAAGGCATTCCTAGAAGTGGTCAAAAGAAGAAGCTTACCATGGGACAATGTAGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGATATTGACGACAGTGGTACCAAAACTATGGTTCATGCTCGGCTAAATGATTTGAGATTGCAGGGCATAGATGAACTTAGCTCTGTGGCTAGTGAGATGGTGCGTTTAATTGAAACAGCTACAGCACCTATTTTGGCTGTAGATTCTAATGGACTTGTAAATGGATGGAATGGAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCATGTCCCTTGTTCAGGATCTTGTTTTTGAGGAGTCTGTGGAGAGGGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATTCCTTTT

</sequence>

<sequence>

<taxon idref="Abies_concolor_P2"/>

GCATATTTATCTCGAATTCAAAGAGGGGGAATAATACAGCCCCACGGGTGTGTGCTCATAGTGGAGGAAACTACTTTTAGAATTATCGCTTACAGCGAGAACGCAGTAGAAATGCTGGATCTGGCGCAACAGTTT------------------------------GTCCCT------AGTATGGAAAAACCT---------------------------CCACCCCAAATTCTGACCATAGAGACCGACGTTCGAAACCTGTTGACTTCCGCCAGTGCTCAGTCCTTGGAAAAGGCTGCCGCGGCCCAGAAATTAAGCCTCATGAACCCCATCCGTGTTCACTGTAAAAGCTCCGGAAAGCCCTTTTATGCAATTGTCCACAGGATTGATGTGGGGATGGTGATAGATTTTGAGCCCTTGAACACT---------------GGGGATTTTGAGCCCTTGAAC------------------------ACTGGTGTAGTGCAATCTGAGAAGCTTGCTATGATGGCGATTTCTCGTCTGCAGTCACTTCCCCGCGGAGATATCGGCTTGCTGTGTAATACTGTTGTGGAGAATGTGCGGGAGCTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGACAAACATGGGGAAGTCTTTGCGGAAATTAAGCGGTCAGACTTGGAACCCTATGTTGGGTTGCATTACCCTGCCACCGATATTCCTCAGGCTGCTCGCTTTCTCTTTATGCAGAACAGGGTGCGAATGATCTGCGATTACACGGCAGCTCCCGTGAAGGTTATCCAGTCCGAGGAATTGATGCAACCTGTCTGTTTAGTGGGTTCCACGCTCCGGGCGCCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAAAGAGAAT------GATGGCGATCGGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTGTGGGGTTTGGTTGTGTGCCACCATACTTCCCCGCGGGCAGTTCCGTTTCCTCTTCGCCATGCTTGCGAGTTTCTGATGCAAGCTTTCGGTCTTCAGTTGAGCATGGAATTGCAGCTGGCAGCTCAATTGACGGCGAAACATATTATTAGGATTCATACGCTTCTGTGTGATATGTTTCTCCGAGATGGCCCAGTTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAATTGTGATGGTGCTGCTGTCTATTATGGAGGTATGTGCAGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGAATATTGCAGAATGGTTGCTTGAATACCATGGGGATTCAATCGGCCTGAAAACGGATAGTTTGATAGATGCTGGTTATCCTAGTGCCCCCTACCTTGGGGATGCAGTCTGTGGTATGGCTGCTGCTAGAATTGGTTCAAAAGACTTTATGTTTTGGTTTAGATCCCACACTGCAAAGGAGTTGAAGTGGGGAGGTGCAAAACATCATCCAGATGATAAAGATGATGGCCGGAGGATGCAGCCTTCTATCTCTTTCAAGGCATTTCTAGACGTGGTCAAAAGAAGAAGCCTACCATGGGAAAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTACTCTACGAGGTTCATTTCAAAACATTGATGACAGTGGCGCTAAAGCTATGGTTTATGCTTGGCGAAATGATTTGATATTCCAGGGCATAGATAAACTTAGGTCTGTGGCTACTGAGACGGTGCATGTGATTGAAACAGCCACAGCACCTATTTTTGCCGTAAATTCTAATGGACTTGTAAATGGATGGAATGCAAAGGTGGCAGAATTGACAGGCCTTCCTGTTGGAGAAGCCATGGGCAAGTCTATTGTTCAGAATCTTGTTTCTGAAGAATCTGTGGAGACAGCCGAAAAAATGCTCTACAATGCCTTAAGAGGTATGTTTTTT

</sequence>

<sequence>

<taxon idref="Abies_lasiocarpa_P2"/>

???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------??????------???????????????---------------------------???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????---------------?????????????????????------------------------?????????????????TGAGAAGCTTGCTATGATGGCGATTTCTCGTCTGCAGTCACTTCCCCGCGGAGATATCGGCTTGCTGTGTAATACTGTTGTGGAGAATGTGCGGGAGCTGACTGGTTATGACAGGGTCATGGTATACAAGTTTCATGAAGACAATCATGGGGAAGTCTTTGCGGAAATTAAGCGTTCAGACTTGGAACCCTATGTTGGATTGCATTACCCTGCCACCGATATTCCTCAGGCTGCTCGCTTTCTCTTTATGCAGAACAGGGTGCGAATGATCTGCGATTTCACGGCAGCTCCCGTGAAGGTTATCCAGTCCGAGGAATTGATGCAACCTGTCTGTTTAGTGGGTTCCACGCTCCGGGCGCCCCATGGGTGCCATGCGCAATACATGGGCAACATGGGTTCCATTTCTTCGCTTGTTATGGCTGTGATTATTAAAGAGAAT------GATGGCGATCGGGGAGAG---------------AGTGGACGAAATTCCATGAAGCTGTGGGGTTTGGTTGTGTGCCACCATACTTCCCCGCGGGCAGTTCCGTTTCCTCTTCGCCATGCTTGCGAATTTCTGATGCAAGCTTTCGGTCTTCAGTTGAGCATGGAATTGCAGCTGGCTGCTCAATTGACGGCGAAACATATTATTAGGATTCATACGCTTCTGTGTGATATGTTTCTCCGAGATGGCCCAGTTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAATTGTGATGGTGCTGCTGTCTATTATGGAGGTATGTGCAGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGAATATTGCAGAATGGTTGCTTGAATACCATGGGGATTCAATCGGCCTGAAAACGGATAGTTTGATAGATGCTGGTTATCCTAGTGCCCCCTACCTTGGGGATGCAGTCTGTGGTATGGCTGCTGCTAGAATTGGTTCAAAAGACTTTATGTTTTGGTTTAGATCCCACACTGCAAAGGAGTTGAAGTGGGGAGGTGCAAAACATCATCCAGATGATAAAGATGATGGCCGGAGGATGCACCCTTCTATCTCTTTAAAGGCATTTCTAGACATGGTCAAAAGAAGAAGCCTACCATGGGAAAATGTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAAACATTGATGACAGTGGCGCTAAAGCTATGGTTTATGCTTGGCGAAATGATTTGATATTCCAGGGCATAGATAAACTTAGGTCTGTGGCTACTGAGACGGTGCATGTGATTGAAACAGCCACAGCACCTATTTTTGCCGTAAATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCTGTTGGAGAAGCCATGGGCAAGTCTCTTGTTCAGAATCTTGTTTCTGAAGAATCTGTGGAGACAGTTGAAAAAATGCTCTACAATGCCTTAAGAGGTATGTTTTTT

</sequence>

<sequence>

<taxon idref="Cathaya_argyrophylla_P2"/>

GCATATTTATCTCGAATTCAGAGAGGGGAAAGAATACAACCCCATGGGTGTATGCTCGCAGTGGAGGAAAGCACTTTTAGGATCATCGCTTACAGCGAGAACGCAGTAGAAATGTTGGATCTGGCGCCACAGTCT------------------------------GTCCCC------AGCATGGAAGAACCT---------------------------CAATCCCAAGTTCTGACCATTGGGACCGATGTCCGAACCCTGTTCACTTCCGCCAGTGCTCACTCCTTGGAAAAGGCTGCAACAGTCCAAAACTTAAGTCTCATCAACCCAATTTGTGTTCATTGTAAAAACTCAGGAAAGCCCTACGATGCAATTGTCCATAGGATTGATGTGGCGATGGTGATAGATTTTGAGCCCTCAAGGTTC---------------GGGGATGCGTCCATGTCTGTT------------------------GCTGGTCCACTGCATTCTGAGAAGCTTGCTATGAGGGTGATATCTCGTATGCAGTCACTTCGCCGCTGTGATATCGGCTTACTGTGTGATACTGTTGTGGAGAGTGTGCGAGAGCTGACCGGGTATGACAGGGCCATGGTTTACAAGTTTCACGAAGACGAACACGGGGAAATTGTTTCAGAAATTAGGCGTTCAGACATGGAGCCCTATTTTGGATTGCATTACGCTGCCACCAATATCCCTCAGGCTGCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCAGGGCAACTCCCGTGAAGGTTATCCAGTCAGAGGAGTTGGTGCAACCTCTCTGTTTAGTGGGTTCCACGCTCAGGGCCTCCCATGCGTGCCATGCGCAATACATGGCCAACATGGGCTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAACGGGAAT------GATGGCGAAGGTGGAGGG---------------AATGGACGAAATTCCATGAAACTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCCGTTCCGTTTCCTCTTCGCTATACTTGCGAATTTCTGATGCAAGCATTCAGTCTTCAGCTGAGCATGGAATTACAGTTTACAGCGCAAGTGATGGAGAAACGCATTTTTAGGATTCAAACGCTTCTGCGCGATATGCTTCTCCGAGATGGCCCATTTGGAATTGTAACCCAGTCTCCCAGTATCATGGATCTTGTTAAGTGTGATGGTGCTGCTCTCTATTACGGAGGTATGTGCTGGATGCTGGGAGTGACCCCAACTGAACCTCAAATAAAGAATATTGCAGATTGGTTGCTTGAAAACCATGGGGATTCAACAGGACCGAACACAGATAGTTTGACAGATGCTGGTTATCCTGGTGCCGCCTATCTTGGAGATGCAGTCTGTGGCATGGCTGCTGCTAGAATTACTTCAAAAGATTTTCTATTTTGGTTCAGATCCCAAACTGCAAAGGAGTTGAAGTGGGGAAGTGCAGAACATCATCCAGGTGAAAAAGATGATGGACGG---ATGCACCCTGTTTACTCTTACGGGGCATTTCTAGAAGTGGTCCAAAAAAGAAGCCTACCATGGGAAAATGTGGAAATTGATGCAATTCAGTCGCTACAGCTTATTCTACGAGATTTATTTCAAGGCATTGATGACAGAGGCACTAAATCTATGGTTCATGCTCAACTAAAGGATTCAAGATTGCAGGGCTTAGATAAATTTAGGTCTGTGGCTACTGAGATGGTGCGTGTGATCGAAACGGCACCAGCACCTATTTTTTGCGTAGATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCAAGTCTCTTGTTCAGGATCTTGTTTTTGAAGAATCTGTGGAGACGGTTAAAAAAATGCTCTACAGTGCCTTAAGAGGTATGCTTTTT

</sequence>

<sequence>

<taxon idref="Larix_laricina_P2"/>

???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------??????------???????????????---------------------------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GCAATTGTCCATAGGATTGATGTAGGGATGATGATAGATTTTGAGCCCTTGATGACT---------------GGGGATGCGTTCATGTCTGCG------------------------CCTGCTGCAGTGCATTCTGAGAAGCTTGCTATGAGAGCGATTTCTCGTCTGCAGTCACTTCCTGGCGGCGATATCGGCCGCCTGTGTGATGCTGTCGTAGAGAATGTGCGAGAGCTGACTGGGTATGATAGGACCATGGTATACAAGTTTCATGAAGACGAACACGGTGAAGTTGTTACGGAAATCAGGCGTTCAGACTTGGAGCCCTATCTTGGTTTGCATTACCCTGCCACCGATATCCCGCAGGCTGCTCGCTTTCTTTTTATGCAGAACAAGGTGCGAATGATCTGCAATTGCAGGGCAACTCCCGTGAAGGTTATTCAGTCCGAGAAATTGACGCAACCTCTCTGTTTAGTGGGTTCCACCCTGCGGGCGCCCCATGAGTGCCATGCGCAATACATGGCGAACATGGGTTCTATTGCTTCGCTTGTTATGGCTGTGATTATTAATGAGAAT------GACGGCGAAGGGGGAGGG---------------AGTGGACGACATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCATCATACCACCCCGCGGGCGGTTCCGTTTCCTGTCCGCTATGCTTGCGAAGTTCTGATGCAAGCATTCGGTGTTCATCTGAGCATGGAATTGCAGTTGGCAGCTCAATTGACGGAGAAACGCATTTTAAGGGTTCAAACGCTTCTGTGTGATATGCTTCTCCGAGATGCCCCAACTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATCGAGATAAATGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCTGGCTGGTTGCTTGAATACCACGGGGATTCAACGGGTCTGACCACGGATAGTTTGACAGATGCTGGTTATCCTGGTGCCGCCTATCTTGGGGATGCAGTCTGTGGCATGGCTGCTGCTAGAATTACTTCAAAAGATTTTCTATTTTGGTTCAGATCCCACACTGCGAAGGAGTTGACGTGGGGAGGTGCAGAACAGTATCCAGGTGATAAAGATGGTGGCCTG---ATGCACCCGTGTTCCTCTTTCAAGGCATTTCTAGAGGGAGTCAAAAGAAGAAGCCTACCATGGGAAAATGTGGAAATTGATGCAATTCACTCGCTACAACTTAATCTACGAGGTTCATTTCAAGACATCGATGGCAGTGGTACTAAAGGTGTGGTTTGTTCTCGGCCAAATGATTCTAGATTGCAGGGCTTAGATAAACTTAGGTATGTGGCTACTGAAATG???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????

</sequence>

<sequence>

<taxon idref="Picea_abies_P2"/>

???TATTTATGTCGAATTCAAAGAGGGGGAAGAATACAACCCCATGGGTGTGTGCTCGCAGTGGAGGAAAGCACTTTTAGGATCATCGCTTACAGCGAGAACGCAGTAGAAATGTTGGAACCGACGCCACAGTCT------------------------------CTCCCC------AGCATGGAAAAATCT---------------------------CAACCCCAACTTTTGACCATCGGGACCGATGTTCGAACTCTGTTCACTTCCGCCAGTGTTCACTCCTTGGAAAATGCTTTCGCGGCCCAGAAATTAAGCCTCATGAACCCAATCTGTGTTCATTGTAAAACCTCTGGAAAGCCCTTCCATGCAATTGTCCATTGGATTGATGTGGGGATGGTGATAGATTTTGAGCCCTTGAGCACT---------------GGGGATGCGTTCATGTCGGCT------------------------GGTGGTGCAGTGCATTCTGAGAAGCTTGCTATGAGGGCGATTTCTCGTCTGCAGTCACTTCCCCGCGGTGATATCGGCTTACTGTGTGATACTGTTGTGGAGAATGTGCGAGCGCTGACTGGGTATGACAGGGCCATGGTATACAAGTTTCACGAAGACGAACACGGGGAAATTGTTGCTGAAATTAGGCGTTCAGACTTGGAGCCCTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTGCTCGTTTTCTTTTTATGCAGAACAGGGTGCGGATGATCTGCGATTGCAGGGCAACTCCCGTGAAGGTTATCCAGTCCGAGGAATTAACACAACCTCTCTGTTTAGTGGGTTCCACGCTCCGGGCGCCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTTCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGGCGAAGCGGGAGGG---------------AATGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTCCCTCTTCGTTATGCTTGCGAATTTTTGATGCAAGCATTCGGTCTTCAGCTGAGCATGGAATTGCAGTTGGCAGAACAATTGACGGAGAAACGCATTTTTAGGATTCAAGTGCTTCTGTCTGATATGCTTCTCCGAGATGGCTCAATTGGAATAGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTCTATTATGGAGGTATATGCTGGATGCTGGGAGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCGGATTGGTTGTGTGAATACCATGGGGATTCAACGGGCCTGACCACAGATAGTTTGACAGATGCTGGTTATCCTGGTGTCGCCTATCTTGGGGATGCAGTCTGTGGCATGGCTGCTGCTAGAATTACTTCTAAAGATTTTCTATTTTGGTTCAGATCCCAAACTGCAAAGGAGTTGAAGTGGGGAGGTGCAGAACATCATTCAGGTGATAAAGATGATGGCCGG---ATGCACCCTCGTTCCTCTTTCAAGGCATTTCTAGAACGGGTCAAAAGAAGAAGCCTACCATGGGAAAATTTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGACATTGATGACAGTGTCACTAAACCTGTGGTTCATGCTCGGCTAAAGGATTTGAGAATGCAGGGCTTAGGTAAACTTAGGTCTGTGGCTACTGAGATGGGGCGTGTGATTGAAACGGCTACAGCACCTATTTTTGCTGTAGATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGCTGAAGAAGCCATGGGCAAGTCTCTTGTTCAGGATCTTGTTTTTGAAGAATCTGTGGAGACGATCAAAAAAATGCTCTACAATGCGTTGAGAG???????????

</sequence>

<sequence>

<taxon idref="Picea_glauca_P2"/>

GCATATTTATCTCGAATTCAAAGAGGGGGGAGAATACAACCCCATGGGTGTGTGCTCGCAGTGGAGGAAAGCACTTTTAGGATCATCGCTTACAGCGAGAACGCAGTAGAAATGTTGGAACCGACGCCACAGTCT------------------------------GTCTCC------AGCATGGAAAAATCT---------------------------CAACCCCAACTTTTGACCATCGGGACCGATGTTCGAACTCTGTTCACTTCTGCCAGTGTTCACTCCTTGGAAAATGCTTTCGCGGCCCAGAAATTAAGCCTCATGAACCCAATCTGTGTTCATTGTAAAACCTCTGGAAAGCCCTTCCATGCAATTGTCCATTGGATTGATGTGGGGATGGTGATAGATTTTGAGCCCTTGAGCACT---------------GGGGATGCGTTCATGTCGGTT------------------------GCTGGTGCAGTGCATTCTGAGAAGCTTGCTATGAGGGCGATTTCTCGTCTGCAGTCACTTCCCCGCGGTGATATCGGCTTACTGTGTGATACTGTTGTGGAGGATGTGCGAGCGCTGACTGGGTATGACAGGGCCATGGTATACAAGTTTCACGAAGACGAACACGGGGAAATTGTTGCTGAAATTAGGCGTTCAGACTTGGAGCCCTATTTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTGCTCGTTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGCGATTGCAGGGCAACTCCCGTGAAGGTTATCCAGTTCGAGGAATTAACACAACCTCTCTGTTTAGTGGGTTCCACGCTCCGGGCGCCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAATGGGAAT------GATGGCGAAGCCGGAGGG---------------AATGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACCTCCCCGCGGGCGGTTCCGTTTCCTCTTCGTTATGCTTGCGAATTTTTGATGCAAGCATTCGGTCTTCAGCTGAGCATGGAATTGCAGTTGGCAGAACAATTGGCGGAGAAACGCATTTTTAGGATTCAAGCGCTTCTGTCTGATATGCTTCTCCGAGATGGCTCAATTGGAATAGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTCTATTATGGAGGTATATGCTGGATGCTGGGGGTGACCCCAACTGAAGCTCAAATCAAGGATATTGCGGATTGGTTGTGTGAATACCATGGGGATTCAACGGGCCTGACCACAGATAGTTTGACAGATGCTGGTTATCCTGGTGCCGCCTATCTTGGGGATGCAGTCTGTGGCATGGCTGCTGCTAGAATTACTTCTAAAGATTTTCTATTTTGGTTCAGATCCCAAACTGCAAAGGAGTTGAAGTGGGGAGGTGCAGAACATCATTCAGGTGATAAAGATGATGGCCGG---ATGCACCCTCGTTCCTCTTTCAAGGCATTTCTAGAACGGGTCAAAAGAAGAAGCCTACCATGGGAAAATTTGGAAATTGATGCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGACATTGATTACAGTGTCACTAAACCTGTGGTTCATGCTCGGCTAAAGGATTTGAGAATGCAGGGCTTAGGTAAACTTAGGTCTGTGGCTACTGAGATGGGGCGTGTGATTGAAACGGCTACAGCACCTATTTTTGCTATAGATTCTAATGGACTTGTAAATGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGCTGAAGAAGCCATGGGCAAGTCTCTTGTTCAGGATCTTGTTTTTGAAGAATCTGTGGAGACGATCAAAAAAATGCTCTACAATGCGTTGAGAGGTATGCCTTTT

</sequence>

<sequence>

<taxon idref="Pinus_strobus_P2"/>

???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????------------------------------??????------???????????????---------------------------??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????GCAATTGTCCACAGAATTGATGTAGGGATGGTGATAGATTTTGAGCCCTTGAGAATA---------------GGGGATGCGTTCATGTCTGCT------------------------GCTGGTGCAGTGTATTCTGAGAAGCTGGCCATGAGGGTGATTTCTTGTCTGCAGTCACTTCCCCGCGGTGATATCGGTCTACTGTGTGATACCGTTGTGCAGAATGTGAGAGAGCTGACTGGGTATGACAGGGCCATGATATACAAGTTTCACGAAGACGAACATGGGGAAATTATTGCAGAAATTAAGCGACCAGACTTGGAGCCTTATCTTGGGTTGCATTACCCTGCCACCGATATCCCTCAGGCTGTTCGCTTTCTTTTTATGCAGAACAAGGTGCGAATGATTTGCGGTTGCAGGGCAAGTCCTGTGAATGTTATCCAGTCACAGGAATTGACGCAACCTCTCTGTTTAGTGGGTTCCACGCTCCGGGCGTCCCATGAGTGCCATTCGCAATTCATGGTCAACATGGGTTCCATTGCTTCGCTTGTTATGTCTGTGATTATTAACGGAAAT------GATGCCGCAGTGGGAGGG---------------AGTGGACGAAATTCCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCACACCTCGCCGCGGGCGGTCCCGTTTCCTCATCGCTATGCTTGTGAATATCTGATGCAAGCATTTGGTCTTCAGCTGAGCATGGAATTGCAGTTGGCGGCTCAATTGAAGGAGAAACGCATTTTTAGGATTCAAACGCTTCTCTGTGAAAGGCTTCTCCGAGATGGCCCAATTGGAATTGTAACTCAGTCTCCCAGTATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTCTATTACAGAGGTATGTGCTGGATGCTGGGAATGACCCCAACTGAAGCTCTAATCGTGGATATTGCAGATTGGTTGCTTGAATACCACGGGGATTCAACAGGCATTAACACAGATAGTTTGACAGATGCTGGTTATCCTGGTGCCACCTATCTTGGGGATGCAGTCTGTGGCATGGCTGCAGCTAGAATTAATTCAAAAGATTTTGTATTTTGGTTCAGATCCCAAACTGCAAAAGAGTTGAAGTGGGGAGATACAGAAAATCATTCAAGTGCTGAAGATGATGGTCGG---ATGCATCCTTCTTCCTCTTTCAAGGCATTTCTAGAAGTGGTCCAAAGAAGAAGCCTACAATGGGAAGATGTGGAAATTGATGCAATTCACTCGCTGCAGCTTATTCTACGAGGTTCATTTCAAGACATTGATGACAGTGGCACTGAAGCTATGACTCATTCTCAGTTGAAGGATTCAAGATTGCATGGCTTAGATAAACTTAGGTTTGTGGCTACTGAGATGATGCGTGTGATTGAAACGGCTGCAGCACCTATTTTTGCCGTAGATTCTGATGGACTTGTAACTGGATGGAATGCAAAAGTGGCAGAATTGACAGGCCTTCCAGTTGGAGAAGCCATGGGCAAGTCTCTTGTCCAGGATCTTGTTTTTGAAGAATCTGTGGAGACAGTTAAAAAAATGCTCTACAGAGCCTTAAGAGGG?????????

</sequence>

<sequence>

<taxon idref="Tsuga_chinensis_P2"/>

GCATATTTATCTCGAATTCAAAGAGGGGGAATTATACAGTCTCACGGGTGTGTGCTCGTAGTGGAGGAGAGTACTTATAGAATTATCGCTTACAGCGAGAATGCAGTAGAAATGCTGGATCTGGTGCTACAGTCT------------------------------GTCCCC------AGCATGGAAAAACCT---------------------------CAACCCCAAATTCTGACCATAGGGACCGACGTTCGAACGCTGTTCACTTCCGCTAGTGCTCGGTTCTTGGAAAAGGCTACCACGGCCCAGAAATTAAGCTTCTTGAACCCCATCTGTGTTCATTGTAAAAACTCTGGAAAGCCCTTTAATGCAATTCTCCATAGGATTGATGTGGGGATGGTGATAGATTTTGAGCCTTTGGAGACT---------------GGGGATGCGTTCATGTCTTCA------------------------GCTGGTGCAGTGCACTCTGAGAAGCTTGCTATGATGGCGATTTCTCGTCTGCAGTCACTTCCTAGCGGTGATATCGGCTTGCTGTGTGATACTGTTGTGGAGAATGTGCGAGAGCTGACTGGGTATGATAGGGTTATGGTATACAAGTTTCATGAAGACAAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACATGGAACCCTATCTTGGGTTGCATTACCCTGCGACCGATATCCCTCAGGCTGCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGTGATTGCACGGCAAATCCTGTGAAGGTTATCCAGTCTGAGGAATTGAGGCAACCTGTCTGTTTAGTGGGTTCTACGCTCCGGGCGTCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAAAGGGAAT------GATGGCGAGGGGGGAGGG---------------AGTGGACGAAATTTCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACTTCCCCGCGGGCAGTTCCTTTTCCTCTTCGCCATGCTTGCGAATTTATGATGCAAGCATTTGGTCTTCAGTTGAGCATGGAATTGCAATTGGCAGCTCAATTGATGGAGAAACGCATTCTTAGAATTCAAACGCTTCTGTGTGATATGTTTCTCCGAGAAGGCCCTGTTGGAATTGTAACTCAGTCTCCCAGCATCATGGATCTTGTTGAGTGTGATGGTGCTGCTCTTTATTATGGATGTAAGTGTTGGATGCTAGGAGTGAGCCCGACTGAAGCTGAAATCAAGGATATTGCAGAATGGTTGCTTGAATACCATGGGGATTCATTGGACCTGAGCACGGATAGTTTGATAGATGCTGGTTATCCTGGTGCCGCCGATCTTGGGGATGCAGTCTGTGGCATGGCTGCTGCTAGAATTGCTGCAGAAGACTTTCTGTTTTGGTTTAGATCCCACACTGCAAAGGAGTTGAAGTGGGGAGGTGCAAAACATCATCCAGATGATAAAGATGATGGCCGGAGGATGCACCCTCGTATCTCTTTCAAGGCATTTCTAGAAGTGGTCAAAAGAAGAAGCCTACCATGGGGAAATCAGGAAATTGATTCAATTCACTCGCTACAGCTTATTCTACGAGGTTTATTTCAAGACATTGATGACAGTGGTACTAAAGCTATGGTTTATGCTCGGCGAAATGATTTGATATTTCAGGGCTTAGATAAACTTAGGTCTGTGACTACTGAGATGGTGCGTGCGATTGAAACAGCTACAGCACCTATTTTTTCCGTAGATACTAATGGACTTGTAAATGGATGGAATGCACAATTGGCAGAATTGACAGGCCTTCCAGTTCGAGAAGCCATGGGCAAGTCTCTTGTTCAGGATCTTGTTTTTGAAGAATCTGTGGAGACGGTTGAAAAACTGCTCTACAATGCCTTAAGAGGTATGCTTTTC

</sequence>

<sequence>

<taxon idref="Tsuga_heterophylla_P2"/>

GCATATTTATCTCGAATTCAAAGAGGGGGGATAATACAGTCTCACGGGTGTGTCCTCGTGGTGGAGGAGACTACTTATAGAATTATCGCTTACAGCGAGAATGCAGTAGAAATGCTGGATCTGGTGCCACAGTCT------------------------------GTCCCC------AGCATGGAAAAATCT---------------------------CAGCCCCAAATTCTGACCATAGGGACCGACGTTCGAACGCTGTTCACTTCCGCTAGTGCTCGGTTCTTGGAAAAGGCTACCGCGGCCCAGAAATTAAGCTTCTTGAACCCCATCTGTGTTCATTGTAAAAACTCTGGAAAGCCCTTTAATGCAATTCTCCATAGGATTGATGTGGGGATGGTGATCGATTTTGAGCCTTTGGAGACT---------------GGGGATGCGTTCATGTCTTCA------------------------GCTGGTGCAGTGCACTCTGAGAAGCTTGCTATGATGGCGATTTCTCGTCTGCAGTCACTTCCTAGCGGTGATATCGGCTTGCTGTGTGATACTGTTGTGGAGAATGTGCGAGAGCTGACTGGGTATGATAGGGTTATGGTATACAAGTTTCATGAAGACAAACACGGGGAAGTTGTTGCGGAAATCAGGCGTTCAGACATGGAACCCTATCTTGGGTTGCATTACCCTGCGACCGATATCCCTCAGGCTGCTCGCTTTCTTTTTATGCAGAACAGGGTGCGAATGATCTGTGATTGCACGGCAAATCCTGTGAAGGTTATCCAGTCTGAGGAATTGAGGCAACCTGTCTGTTTAGTGGGTTCTACGCTCCGGGCGTCCCATGGGTGCCATGCGCAATACATGGCCAACATGGGTTCCATTGCTTCGCTTGTTATGGCTGTGATTATTAAAGGGAAT------GATGGCGAGGGGGGAGGG---------------AGTGGACGAAATTTCATGAAGCTCTGGGGTTTGGTTGTGTGCCACCATACTTCCCCGCGGGCAGTTCCTTTTCCTCTTCGCCATGCTTGCGAATTTCTGATGCAAGCATTTGGTCTTCAGTTGAGCATGGAATTGCAATTGGCAGCTCAATTGATGGAGAAACGCATTCTTAGAATTCAAACGCTTCTGTGTGATATGTTTCTCCAAGAAGGCCCTGTTGGAATTGTAACTCAGTCTCCCAGCATCATGGATCTTGTCAAGTGTGATGGTGCTGCTCTTTATTATGGAGGTAAGTGTTGGATGCTGGGAGTGAGCCCGACTGAAGCTGAAATCAAGGATATTGCAGAATGGTTGCTTGAATACCATGGAGATTCATTGGGCCTGAGCACGGATAGTTTGATAGATGCTGGTTATCCTGGTGCCGCCGATCTTGGGGATGCAGTCTGTGGCATGGCTGCTGCTAGAATTGCTTCAGAAGACTTTCTGTTTTGGTTTAGATCCCACACTGCAAAGGAGTTGAAGTGGGGAGGCGCAAAACATCATCCAGATGATAAAGATGATGGCCGGAGGATGCACCCTCGTATCTCTTTCAAGGCATTTCTAGAAGTGGTCAAAAGAAGAAGCCTACCATGGGGAAATCAGGAAATTGATTCAATTCACTCGCTACAGCTTATTCTACGAGGTTCATTTCAAGACATTGATGACAGTGGTACTAAAGCTATGGTTTATGCTCGGCTAAATGATTCGATATTTCAGGGCTTAGATAAACTTAGGTCTGTGACTACTGAGATGGTGCGTGCGATTGAAACAGCTACAGCACCTATTTTTTCCGTAGATACTAATGGACTTGTAAATGGATGGAATGCACAAGTGGCAGAATTGACAGGCCTTCCAGTTCGAGAAGCCATGGGCAAGTCTCTTGTTCAGGATCTTGTTTTTGAAGAATCTGTGGAGACGGTTGAAAAACTGCTCTACAATGCCTTAAGAGGTATGCTTTTC

</sequence>

</alignment>


<!-- The unique patterns for codon position 1                                -->


<!-- The unique patterns from 1 to end every 3                               -->

<!-- npatterns=325                                                           -->

<patterns id="CP1.patterns" from="1" every="3" strip="false">

<alignment idref="alignment"/>

</patterns>


<!-- The unique patterns for codon position 2                                -->


<!-- The unique patterns from 2 to end every 3                               -->

<!-- npatterns=265                                                           -->

<patterns id="CP2.patterns" from="2" every="3" strip="false">

<alignment idref="alignment"/>

</patterns>


<!-- The unique patterns for codon position 3                                -->


<!-- The unique patterns from 3 to end every 3                               -->

<!-- npatterns=574                                                           -->

<patterns id="CP3.patterns" from="3" every="3" strip="false">

<alignment idref="alignment"/>

</patterns>


<!-- A prior on the distribution node heights defined given                  -->

<!-- a Yule speciation process (a pure birth process).                       -->

<yuleModel id="yule" units="years">

<birthRate>

<parameter id="yule.birthRate" value="0.039" lower="0.0"/>

</birthRate>

</yuleModel>


<!-- This is a simple constant population size coalescent model              -->

<!-- that is used to generate an initial tree for the chain.                 -->

<constantSize id="initialDemo" units="years">

<populationSize>

<parameter id="initialDemo.popSize" value="100.0"/>

</populationSize>

</constantSize>


<!-- Generate a random starting tree under the coalescent process            -->

<coalescentSimulator id="startingTree">

<taxa idref="taxa"/>

<constantSize idref="initialDemo"/>

</coalescentSimulator>


<!-- Generate a tree model                                                   -->

<treeModel id="treeModel">

<coalescentTree idref="startingTree"/>

<rootHeight>

<parameter id="treeModel.rootHeight"/>

</rootHeight>

<nodeHeights internalNodes="true">

<parameter id="treeModel.internalNodeHeights"/>

</nodeHeights>

<nodeHeights internalNodes="true" rootNode="true">

<parameter id="treeModel.allInternalNodeHeights"/>

</nodeHeights>

</treeModel>


<!-- Taxon Sets                                                              -->

<tmrcaStatistic id="tmrca(Conifers)" includeStem="false">

<mrca>

<taxa idref="Conifers"/>

</mrca>

<treeModel idref="treeModel"/>

</tmrcaStatistic>

<tmrcaStatistic id="tmrca(P1)" includeStem="false">

<mrca>

<taxa idref="P1"/>

</mrca>

<treeModel idref="treeModel"/>

</tmrcaStatistic>

<tmrcaStatistic id="tmrca(Pinus)" includeStem="false">

<mrca>

<taxa idref="Pinus"/>

</mrca>

<treeModel idref="treeModel"/>

</tmrcaStatistic>


<!-- Generate a speciation likelihood for Yule or Birth Death                -->

<speciationLikelihood id="speciation">

<model>

<yuleModel idref="yule"/>

</model>

<speciesTree>

<treeModel idref="treeModel"/>

</speciesTree>

</speciationLikelihood>


<!-- The uncorrelated relaxed clock (Drummond, Ho, Phillips & Rambaut (2006) PLoS Biology 4, e88 )-->

<discretizedBranchRates id="branchRates">

<treeModel idref="treeModel"/>

<distribution>

<logNormalDistributionModel meanInRealSpace="true">

<mean>

<parameter id="ucld.mean" value="1.0" lower="0.0"/>

</mean>

<stdev>

<parameter id="ucld.stdev" value="0.3333333333333333" lower="0.0"/>

</stdev>

</logNormalDistributionModel>

</distribution>

<rateCategories>

<parameter id="branchRates.categories"/>

</rateCategories>

</discretizedBranchRates>

<rateStatistic id="meanRate" name="meanRate" mode="mean" internal="true" external="true">

<treeModel idref="treeModel"/>

<discretizedBranchRates idref="branchRates"/>

</rateStatistic>

<rateStatistic id="coefficientOfVariation" name="coefficientOfVariation" mode="coefficientOfVariation" internal="true" external="true">

<treeModel idref="treeModel"/>

<discretizedBranchRates idref="branchRates"/>

</rateStatistic>

<rateCovarianceStatistic id="covariance" name="covariance">

<treeModel idref="treeModel"/>

<discretizedBranchRates idref="branchRates"/>

</rateCovarianceStatistic>


<!-- The general time reversible (GTR) substitution model                    -->

<gtrModel id="CP1.gtr">

<frequencies>

<frequencyModel dataType="nucleotide">

<frequencies>

<parameter id="CP1.frequencies" value="0.25 0.25 0.25 0.25"/>

</frequencies>

</frequencyModel>

</frequencies>

<rateAC>

<parameter id="CP1.ac" value="1.0" lower="0.0"/>

</rateAC>

<rateAG>

<parameter id="CP1.ag" value="1.0" lower="0.0"/>

</rateAG>

<rateAT>

<parameter id="CP1.at" value="1.0" lower="0.0"/>

</rateAT>

<rateCG>

<parameter id="CP1.cg" value="1.0" lower="0.0"/>

</rateCG>

<rateGT>

<parameter id="CP1.gt" value="1.0" lower="0.0"/>

</rateGT>

</gtrModel>


<!-- The general time reversible (GTR) substitution model                    -->

<gtrModel id="CP2.gtr">

<frequencies>

<frequencyModel dataType="nucleotide">

<frequencies>

<parameter id="CP2.frequencies" value="0.25 0.25 0.25 0.25"/>

</frequencies>

</frequencyModel>

</frequencies>

<rateAC>

<parameter id="CP2.ac" value="1.0" lower="0.0"/>

</rateAC>

<rateAG>

<parameter id="CP2.ag" value="1.0" lower="0.0"/>

</rateAG>

<rateAT>

<parameter id="CP2.at" value="1.0" lower="0.0"/>

</rateAT>

<rateCG>

<parameter id="CP2.cg" value="1.0" lower="0.0"/>

</rateCG>

<rateGT>

<parameter id="CP2.gt" value="1.0" lower="0.0"/>

</rateGT>

</gtrModel>


<!-- The general time reversible (GTR) substitution model                    -->

<gtrModel id="CP3.gtr">

<frequencies>

<frequencyModel dataType="nucleotide">

<frequencies>

<parameter id="CP3.frequencies" value="0.25 0.25 0.25 0.25"/>

</frequencies>

</frequencyModel>

</frequencies>

<rateAC>

<parameter id="CP3.ac" value="1.0" lower="0.0"/>

</rateAC>

<rateAG>

<parameter id="CP3.ag" value="1.0" lower="0.0"/>

</rateAG>

<rateAT>

<parameter id="CP3.at" value="1.0" lower="0.0"/>

</rateAT>

<rateCG>

<parameter id="CP3.cg" value="1.0" lower="0.0"/>

</rateCG>

<rateGT>

<parameter id="CP3.gt" value="1.0" lower="0.0"/>

</rateGT>

</gtrModel>


<!-- site model                                                              -->

<siteModel id="CP1.siteModel">

<substitutionModel>

<gtrModel idref="CP1.gtr"/>

</substitutionModel>

<relativeRate>

<parameter id="CP1.mu" value="1.0" lower="0.0"/>

</relativeRate>

<gammaShape gammaCategories="4">

<parameter id="CP1.alpha" value="0.5" lower="0.0"/>

</gammaShape>

</siteModel>


<!-- site model                                                              -->

<siteModel id="CP2.siteModel">

<substitutionModel>

<gtrModel idref="CP2.gtr"/>

</substitutionModel>

<relativeRate>

<parameter id="CP2.mu" value="1.0" lower="0.0"/>

</relativeRate>

<gammaShape gammaCategories="4">

<parameter id="CP2.alpha" value="0.5" lower="0.0"/>

</gammaShape>

</siteModel>


<!-- site model                                                              -->

<siteModel id="CP3.siteModel">

<substitutionModel>

<gtrModel idref="CP3.gtr"/>

</substitutionModel>

<relativeRate>

<parameter id="CP3.mu" value="1.0" lower="0.0"/>

</relativeRate>

<gammaShape gammaCategories="4">

<parameter id="CP3.alpha" value="0.5" lower="0.0"/>

</gammaShape>

</siteModel>


<compoundParameter id="allMus">

<parameter idref="CP1.mu"/>

<parameter idref="CP2.mu"/>

<parameter idref="CP3.mu"/>

</compoundParameter>


<!-- Likelihood for tree given sequence data                                 -->

<treeLikelihood id="CP1.treeLikelihood" useAmbiguities="false">

<patterns idref="CP1.patterns"/>

<treeModel idref="treeModel"/>

<siteModel idref="CP1.siteModel"/>

<discretizedBranchRates idref="branchRates"/>

</treeLikelihood>


<!-- Likelihood for tree given sequence data                                 -->

<treeLikelihood id="CP2.treeLikelihood" useAmbiguities="false">

<patterns idref="CP2.patterns"/>

<treeModel idref="treeModel"/>

<siteModel idref="CP2.siteModel"/>

<discretizedBranchRates idref="branchRates"/>

</treeLikelihood>


<!-- Likelihood for tree given sequence data                                 -->

<treeLikelihood id="CP3.treeLikelihood" useAmbiguities="false">

<patterns idref="CP3.patterns"/>

<treeModel idref="treeModel"/>

<siteModel idref="CP3.siteModel"/>

<discretizedBranchRates idref="branchRates"/>

</treeLikelihood>


<!-- Define operators                                                        -->

<operators id="operators" optimizationSchedule="default">

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP1.ac"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP1.ag"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP1.at"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP1.cg"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP1.gt"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP2.ac"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP2.ag"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP2.at"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP2.cg"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP2.gt"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP3.ac"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP3.ag"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP3.at"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP3.cg"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP3.gt"/>

</scaleOperator>

<deltaExchange delta="0.01" weight="0.1">

<parameter idref="CP1.frequencies"/>

</deltaExchange>

<deltaExchange delta="0.01" weight="0.1">

<parameter idref="CP2.frequencies"/>

</deltaExchange>

<deltaExchange delta="0.01" weight="0.1">

<parameter idref="CP3.frequencies"/>

</deltaExchange>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP1.alpha"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP2.alpha"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="0.1">

<parameter idref="CP3.alpha"/>

</scaleOperator>

<deltaExchange delta="0.75" parameterWeights="660 660 660" weight="3">

<parameter idref="allMus"/>

</deltaExchange>

<scaleOperator scaleFactor="0.75" weight="3">

<parameter idref="ucld.mean"/>

</scaleOperator>

<scaleOperator scaleFactor="0.75" weight="3">

<parameter idref="ucld.stdev"/>

</scaleOperator>

<subtreeSlide size="59.0" gaussian="true" weight="15">

<treeModel idref="treeModel"/>

</subtreeSlide>

<narrowExchange weight="15">

<treeModel idref="treeModel"/>

</narrowExchange>

<wideExchange weight="3">

<treeModel idref="treeModel"/>

</wideExchange>

<wilsonBalding weight="3">

<treeModel idref="treeModel"/>

</wilsonBalding>

<scaleOperator scaleFactor="0.75" weight="3">

<parameter idref="treeModel.rootHeight"/>

</scaleOperator>

<uniformOperator weight="30">

<parameter idref="treeModel.internalNodeHeights"/>

</uniformOperator>

<scaleOperator scaleFactor="0.75" weight="3">

<parameter idref="yule.birthRate"/>

</scaleOperator>

<upDownOperator scaleFactor="0.75" weight="3">

<up>

<parameter idref="ucld.mean"/>

</up>

<down>

<parameter idref="treeModel.allInternalNodeHeights"/>

</down>

</upDownOperator>

<swapOperator size="1" weight="10" autoOptimize="false">

<parameter idref="branchRates.categories"/>

</swapOperator>

<uniformIntegerOperator weight="10">

<parameter idref="branchRates.categories"/>

</uniformIntegerOperator>

</operators>


<!-- Define MCMC                                                             -->

<mcmc id="mcmc" chainLength="10000000" autoOptimize="true" operatorAnalysis="phyP-20140910-10M.ops">

<posterior id="posterior">

<prior id="prior">

<normalPrior mean="305.0" stdev="2.0">

<statistic idref="tmrca(Conifers)"/>

</normalPrior>

<normalPrior mean="136.0" stdev="2.0">

<statistic idref="tmrca(P1)"/>

</normalPrior>

<normalPrior mean="124.0" stdev="2.0">

<statistic idref="tmrca(Pinus)"/>

</normalPrior>

<gammaPrior shape="0.05" scale="10.0" offset="0.0">

<parameter idref="CP1.ac"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="20.0" offset="0.0">

<parameter idref="CP1.ag"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="10.0" offset="0.0">

<parameter idref="CP1.at"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="10.0" offset="0.0">

<parameter idref="CP1.cg"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="10.0" offset="0.0">

<parameter idref="CP1.gt"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="10.0" offset="0.0">

<parameter idref="CP2.ac"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="20.0" offset="0.0">

<parameter idref="CP2.ag"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="10.0" offset="0.0">

<parameter idref="CP2.at"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="10.0" offset="0.0">

<parameter idref="CP2.cg"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="10.0" offset="0.0">

<parameter idref="CP2.gt"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="10.0" offset="0.0">

<parameter idref="CP3.ac"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="20.0" offset="0.0">

<parameter idref="CP3.ag"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="10.0" offset="0.0">

<parameter idref="CP3.at"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="10.0" offset="0.0">

<parameter idref="CP3.cg"/>

</gammaPrior>

<gammaPrior shape="0.05" scale="10.0" offset="0.0">

<parameter idref="CP3.gt"/>

</gammaPrior>

<uniformPrior lower="0.0" upper="1.0E100">

<parameter idref="CP1.mu"/>

</uniformPrior>

<uniformPrior lower="0.0" upper="1.0E100">

<parameter idref="CP2.mu"/>

</uniformPrior>

<uniformPrior lower="0.0" upper="1.0E100">

<parameter idref="CP3.mu"/>

</uniformPrior>

<uniformPrior lower="0.0" upper="1.0">

<parameter idref="CP1.frequencies"/>

</uniformPrior>

<uniformPrior lower="0.0" upper="1.0">

<parameter idref="CP2.frequencies"/>

</uniformPrior>

<uniformPrior lower="0.0" upper="1.0">

<parameter idref="CP3.frequencies"/>

</uniformPrior>

<exponentialPrior mean="0.5" offset="0.0">

<parameter idref="CP1.alpha"/>

</exponentialPrior>

<exponentialPrior mean="0.5" offset="0.0">

<parameter idref="CP2.alpha"/>

</exponentialPrior>

<exponentialPrior mean="0.5" offset="0.0">

<parameter idref="CP3.alpha"/>

</exponentialPrior>

<exponentialPrior mean="0.3333333333333333" offset="0.0">

<parameter idref="ucld.stdev"/>

</exponentialPrior>

<uniformPrior lower="0.0" upper="1.0E100">

<parameter idref="ucld.mean"/>

</uniformPrior>

<uniformPrior lower="0.0" upper="1.0E100">

<parameter idref="yule.birthRate"/>

</uniformPrior>

<speciationLikelihood idref="speciation"/>

</prior>

<likelihood id="likelihood">

<treeLikelihood idref="CP1.treeLikelihood"/>

<treeLikelihood idref="CP2.treeLikelihood"/>

<treeLikelihood idref="CP3.treeLikelihood"/>

</likelihood>

</posterior>

<operators idref="operators"/>


<!-- write log to screen                                                     -->

<log id="screenLog" logEvery="1000">

<column label="Posterior" dp="4" width="12">

<posterior idref="posterior"/>

</column>

<column label="Prior" dp="4" width="12">

<prior idref="prior"/>

</column>

<column label="Likelihood" dp="4" width="12">

<likelihood idref="likelihood"/>

</column>

<column label="rootHeight" sf="6" width="12">

<parameter idref="treeModel.rootHeight"/>

</column>

<column label="ucld.mean" sf="6" width="12">

<parameter idref="ucld.mean"/>

</column>

</log>


<!-- write log to file                                                       -->

<log id="fileLog" logEvery="1000" fileName="phyP-20140910-10M.log" overwrite="false">

<posterior idref="posterior"/>

<prior idref="prior"/>

<likelihood idref="likelihood"/>

<parameter idref="treeModel.rootHeight"/>

<tmrcaStatistic idref="tmrca(Conifers)"/>

<tmrcaStatistic idref="tmrca(P1)"/>

<tmrcaStatistic idref="tmrca(Pinus)"/>

<parameter idref="yule.birthRate"/>

<parameter idref="CP1.ac"/>

<parameter idref="CP1.ag"/>

<parameter idref="CP1.at"/>

<parameter idref="CP1.cg"/>

<parameter idref="CP1.gt"/>

<parameter idref="CP2.ac"/>

<parameter idref="CP2.ag"/>

<parameter idref="CP2.at"/>

<parameter idref="CP2.cg"/>

<parameter idref="CP2.gt"/>

<parameter idref="CP3.ac"/>

<parameter idref="CP3.ag"/>

<parameter idref="CP3.at"/>

<parameter idref="CP3.cg"/>

<parameter idref="CP3.gt"/>

<parameter idref="CP1.frequencies"/>

<parameter idref="CP2.frequencies"/>

<parameter idref="CP3.frequencies"/>

<parameter idref="CP1.alpha"/>

<parameter idref="CP2.alpha"/>

<parameter idref="CP3.alpha"/>

<compoundParameter idref="allMus"/>

<parameter idref="ucld.mean"/>

<parameter idref="ucld.stdev"/>

<rateStatistic idref="meanRate"/>

<rateStatistic idref="coefficientOfVariation"/>

<rateCovarianceStatistic idref="covariance"/>

<treeLikelihood idref="CP1.treeLikelihood"/>

<treeLikelihood idref="CP2.treeLikelihood"/>

<treeLikelihood idref="CP3.treeLikelihood"/>

<speciationLikelihood idref="speciation"/>

</log>


<!-- write tree log to file                                                  -->

<logTree id="treeFileLog" logEvery="1000" nexusFormat="true" fileName="phyP-20140910-10M.trees" sortTranslationTable="true">

<treeModel idref="treeModel"/>

<trait name="rate" tag="rate">

<discretizedBranchRates idref="branchRates"/>

</trait>

<posterior idref="posterior"/>

</logTree>

</mcmc>

<report>

<property name="timer">

<mcmc idref="mcmc"/>

</property>

</report>

</beast>