conifer-rbcL

#NEXUS

BEGIN TAXA;
    TITLE Taxa;
    DIMENSIONS NTAX=78;
    TAXLABELS
        Ginkgo Cycas Stangeria Encephalartos Bowenia Ceratozamia Dioon Chigua Ephedra Gnetum Welwitschia Athrotaxis Austrocedrus Callitris Callitropsis Chamaecyparis Calocedrus Cupressus Cryptomeria Cunninghamia Diselma Fokienia Glyptostrobus Juniperus Libocedrus Metasequoia Microbiota Neocallitris Papuacedrus Pilgerodendron Platycladus Sequoia Sequoiadendron Taiwania Taxodium Tetraclinis Thujopsis Thuja Widdringtonia Xanthocyparis Agathis Araucaria Wollemia Torreya Taxus Amentotaxus Pseudotaxus Austrotaxus Cephalotaxus Sciadopitys Pinus Picea Cathaya Larix Abies Tsuga Nothotsuga Cedrus Pseudolarix Keteleeria Phyllocladus Lagarostrobus Prumnopitys Dacrydium Dacrycarp Podocarpus Nageia Microstrobos Microcachys Saxegothaea Acmopyle Falcatifolum Manoao Lepidothamnus Halocarpus Afrocarpus Retrophyllum Sundacarpus
    ;
END;

BEGIN CHARACTERS;
    TITLE  Character_Matrix;
    DIMENSIONS  NCHAR=1380;
    FORMAT DATATYPE = DNA GAP = - MISSING = ?;
    MATRIX
    Ginkgo           GTCGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGAATATCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTGCCACCTGAGGAAGCGGGAGCTGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGAAGATGCTATGACATCGAGCCCGTTCCTGGGGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTGGATCTTTTCGAGGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGGAATGTATTTGGATTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAGGGTCCACCTCATGGTATCCAAGTTGAAAGGGATAAATTGAATAAATATGGCCGTCCCCTATTGGGATGTACTATCAAGCCAAAATTGGGTTTATCTGCCAAAAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTTACTAAAGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTTGTTTTGTGCAGAAGCAATTTATAAAGCTCAGACCGAGACGGGTGAAATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATGAAAAGGGCAGTATTTGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACGGGAGGTTTTACTGCAAATACTAGCTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTGCGTATGTCTGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTCTGGGTTTTGTTGATCTACTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGCCCGTAGCTTCAGGGGGTATTCACGTCTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCCCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCCGAACTAGCCGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATTTGAT
    Cycas            gttggatttaaagctggtgttaaagattacagattaacttattacactcctgaatatcaaaccaaagataccgatatcttagcagcgttccgagtaactcctcaacctggagtgccgcctgaggaagcgggagctgcagtagccgctgaatcttccactggtacatggaccactgtttggaccgatggacttaccagtctcgatcgttacaaggggcgatgctatgacatcgagcccgttcctggggagaaaaatcaatttattgcctatgtagcttaccccttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctacgagctctacgcctagaagatttgcgagttcctcctgcttattccaaaactttccaaggtccacctcatggtatccaagttgaaagagataaattaaacaaatatggccgtcctctattgggatgtaccattaaacccaaattgggtttatctgccaaaaactatggtagagcagtttatgaatgtcttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccatttatgcgctggagagatcgtttctgcttctgtgcagaagcaatttataaagctcaggctgagacgggtgaaattaagggacattacttgaatgctactgcaggtacatgcgaagaaatgatcaaaagggcagtatttgccagagaattgggggttcctatcgtcatgcatgactacctgacaggaggatttactgcaaataccagcttggctcattattgccgagacaatggcctacttcttcacattcaccgcgcaatgcatgcagttattgacagacaaagaaatcatggtatgcacttccgtgtgctagctaaagcattgcgaatgtccggtggagatcatattcacgccggtactgtagtaggtaaacttgaaggagaacgagacgtaactttgggttttgttgatctactgcgtgacgattttattgaaagagaccgaagtcgtggtatttatttcacccaagattgggtatctatgccaggtgttctgcccgtagcttcggggggtattcacgtttggcatatgcctgctctaaccgagatctttggggatgattccgtactacagttcggtgggggaactttgggacacccttggggaaatgcacctggtgcagtagcgaatcgagttgccttagaagcttgtgtacaagctcgtaatgaaggacgtgatcttgctcgtgaaggtaatgaagtgatccgcgaagctagtaaatggagtcccgaattagctgctgcttgtgaagtatggaaggagatcaaatttgaatttgag
    Stangeria        gtcggatttaaagctggtgttaaagattacagattaacttattacactcctgaatataaaaccaaagataccgatatcttggcagcgttccgagtaactccccaacctggggtgccacctgaggaagcgggggctgcagtagctgctgaatcttccactggtacatggaccactgtttggaccgatgggcttaccagtctcgatcgttacaaggggcgatgctatgacatcgagcccgttcctggggaagaaactcaatttattgcctatgtagcttaccccttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctaagggctctgcgtctggaagatttgcgaattcctcctgcttattccaaaactttccaaggtccacctcatggtatccaagttgaaagagataaattaaacaaatatggccgtcccctattgggatgtaccattaaaccaaaattgggtttatctgccaaaaactatggtagagcagtttacgaatgtcttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccttttatgcgctggagagatcgtttctgcttctgtgcagaagcaatttataaagctcaagctgaaacgggtgaaattaaggggcattacttgaatgctactgcaggtacatgtgaagaaatgataaaaagggcagtatttgccagagaattgggagttcctatcgtcatgcatgactacctgacgggaggttttactgcaaataccagtttgtctcattattgccgagacaatggcctacttcttcacattcaccgcgcaatgcatgcagttattgacagacaaagaaatcatggtatgcacttccgtgtactagctaaagcattgcgcatgtccgggggagatcatattcacgccggtactgtagtaggtaaacttgaaggggaacgagaagtcactttgggttttgttgatctactgcgtgatgattttattgaaagagaccgaagtcgtggtatttatttcactcaagattgggtatctatgccaggtgttctacccgtagcttcggggggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattctgtactacagttcggcgggggaactttgggacacccttggggaaatgcacctggtgcagtagcgaatcgagtcgccttagaagcttgtgtacaagctcgtaatgagggacgtgatcttgctcgtgaaggtaatgaagtgatccgtgaagctagtaaatggagtccYgaaYtRgctg-----------------------------------------
    Encephalartos    ---------------------------------ttaacttattacactcctgaatataaaaccaaagataccgatatcttggcagcgttccgagtaactccccaacctggggtgcccgctgaggaagcgggggctgcagtagctgctgaatcttccactggtacatggaccactgtttggaccgatggacttaccagtctcgatcgttacaaggggcgatgctatgacatcgagcccgttcctggggaagaaactcaatttattgcctatgtagcttaccccttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctacgagctctacgtctagaagatttgcgaattcctcctgcttattccaaaactttccaaggtccacctcatggtatccaagttgaaagagataaattaaacaaatatggccgtcccctattgggatgtaccattaaaccaaaattgggtttatctgccaaaaactatggtagagcagtttacgaatgtcttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccatttatgcgctggagagatcg?ttctgcttttgtgcagaagcaatttataaagctcagactgagacgggtgaaattaagggacattacttgaatgctactgcaggtacatgtgaagaaatgataaaaagggcagtatttgccagagaattgggagttcctatcgtcatgcatgactacctgacgggaggttttactgcaaataccagcttggctcattattgccgagacaatggcctacttcttcacattcaccgcgcaatgcatgcagttattgacagacaaagaaatcatggtatgcacttccgtgtactagctaaagcattgcgcatgtccggtggagatcatattcacgccggtactgtagtaggtaaacttgaaggagaacgagaagtcactctgggttttgttgatctactgcgtgatgattttattgaaagagaccgaagtcgtggtatttatttcactcaagattgggtatctatgccaggtgttctgcccgtagcttcggggggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattccgtactacagttcggcgggggaactttgggacacccttggggaaatgcacctggtgcagtagcgaatcgagtcgccttagaagcttgtgtacaagctcgtaatgagggacgtgatcttgctcgtgaaggtaatgaagtgatccgtgaagctagtaaatggagtcccg--------------------------------------------------
    Bowenia          gtcggatttaaagctggtgtt?aagattacagattaacttattacactcctgaatataaaactaaagataccgatatcttggcagcgttccgagtaactccccaacctggggtgcccgctgaggaagcgggggcagcagtagctgctgaatcttctactggtacatggaccactgtttggaccgatggacttaccagtctcgatcgttacaaggggcgatgctatgacattgagcccgttcctggggaagaaactcaatttattgcctatgtagcttaccccttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctacgagctctacgcctagaagatttgcgaattcctcctgcttattccaaaactttccaaggcccacctcatggtatccaagttgaaagagataaattaaacaaatatggccgtcccctattgggatgtactattaaaccaaaattgggtttatctgccaaaaactatggtagagcagtttacgaatgtcttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccatttatgcgctggagagatcgtttctgcttctgtgcagaagcaatttataaagctcaggctgagacgggtgaaattaagggacattacttgaatgctactgcaggtacatgtgaagaaatgataaaaagggcagtatttgccagagaattgggagttcctatcgtcatgcatgactacctgacgggaggttttactgcaaataccaccttggctcattattgccgagacaatggcctacttcttcacattcaccgcgcaatgcatgcagttattgacagacaaagaaatcatggtatgcacttccgtgtactagctaaagcattgcgcatgtccggtggagatcatattcacgccggtactgtagtaggtaaacttgaaggagaacgagaagtcactttgggttttgttgatctactgcgtgatgattttattgaaaaagaccgaagtcgtggtatttatttcactcaagattgggtatctatgccaggtgttctgcccgtagcttcggggggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattccgtactacagttcggcgggggaactttgggacacccttggggaaatgcacctggtgcagtagcgaatcgagtcgccttagaagcttgtgtacaagctcgcaatgagggacgtgatcttgctcgtgaaggtaatgaagtgatccgtgaagctagtaaatggagtcccgagcta?ctgctgcc------------------------------------
    Ceratozamia      gtcggatttaaagctggtgttaaagattacagattaacttattacactcctgaatataaaaccaaagataccgatattttggcagcgttccgagtaactccccaacctggggtgccacctgaggaagcgggggctgcagtagctgctgaatcttccactggtacatggaccactgtttggaccgatggacttaccagtctcgatcgttacaaggggcgatgctatgacatcgagcccgttcctggggaagagactcaatttattgcctatgtagcttaccccttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctacgagctctacgtctagaagatttgcgagttcctcctgcttattccaaaactttccaaggtccacctcatggtatccaagttgaaagagataaattaaacaaatatggacgtcccctattgggatgtaccattaaaccaaaattgggtttatctgccaaaaactatggtagagcagtttacgaatgtcttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccatttatgcgctggagagatcgtttctgcttctgtgcagaagcaatttataaagctcaggctgagacgggtgaaattaagggacattacttgaatgctactgcaggtacatgtgaagaaatgataaaaagggcagtatttgccagagaattgggagctcctatcgtcatgcatgactacctgacgggaggttttactgcaaataccagcttggctcattattgtcgagacaatggcttacttcttcacattcaccgcgc?atgcatgcagttattgacagacaaagaaatcatggtatgcacttccgtgtactagctaaagcattgcgcatgtccggtggagatcatattcacgccggtactgtagtaggtaaacttgaaggagaacgagaagtcactttgggttt?gt?gatctactgcgtgatgattttattgaaagagaccgaagtcgtggtatttatttcactcaagattgggtatctatgccaggtgttctgcccgtagcttcggggggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattccgtactacagttcggcgggggaactt?gggacacccttggggaaatgcacctggtgcagtagcgaatcgagtcgccttagaagcttgtgtacaagctcgtaatgagggacgtgatcttgctcgtgaaggtaatgaagtgatccgtgaagctagtaaatggagtcccgagctagctgctgct------------------------------------
    Dioon            gtcggatttaaagctggtgttaaagattacagattaacttattacactcctgaatatgaaaccaaagataccgatatcttggcagcgttccgagtaactccccaacctggggtgccacctgaggaagcgggggctgcagtagctgctgaatcttccactggtacatggaccactgtttggaccgatggacttaccagtctcgatcgttacaaggggcgatgctatgacatcgagcccgttcctggggaagaaactcaatttattgcctatgtagcttaccccttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctacgagctctacgtctagaagatttgcgaattcctcctgcttattccaaaacttcccaaggtccacctcatggtatccaagttgaaagagataaattaaacaaatatggtcgtcccctattgggatgtaccattaaaccaaaattggggttatctgccaaaaactatggtagagcagtttacgagtgtcttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccatttatgcgctggagagatcgtttctgcttctgtgcagaagcaatttacaaagctcaggctgagacgggtgagattaagggacattacttgaatgctactgcaggtacatgtgaagaaatgataaaaagggcagtatttgccagagaattgggagttcctatcgtcatgcatgactacctgacgggaggttttactgcaaataccagcttggctcattattgccgagacaatggcctgcttcttcacattcaccgcgcaatgcatgcagttattgacagacaaagaattcatggtatgcacttccgtgtgctagctaaagcattgcgcatgtccggtggagatcatattcacgccggtactgtagtaggtaaacttgaaggagaacgagaagtcactttgggttttgttgatctactgcgtgatgattttattgaaagagaccgaagtcgtggtatttatttcactcaagattgggtatctatgccaggtgttctgcccgtagcttcggggggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattccgtactacagttcggcgggggaactttgggacacccctggggaaatgcacctggtgcagtagcgaatcgagtcgccttagaagcttgtgtacaagctcgtaatgagggacgtgatcttgctcgtgaaggtaatgaagtgatccgtgaagctagtaaatggagtcccgagctagctgctgcttgtgaagtatggaaggagatcaaatttgaatttga-
    Chigua           gtcggatttaaagctggtgttaaagattacagaataacttattacactcctgactatgaaaccaaagataccgatatcttggcagcgttccgagtaactcctcaacctggggtgcccgctgaggaagcgggggctgcagtagctgctgaatcttccactggtacatggaccactgtttggaccgatggacttaccagtcttgatcgttacaaggggcgatgctatgacatcgagcccgttcctggggaagagactcaatttattgcctatgtagcgtaccctttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctacgagctatacgcctagaagatttgcgaattcctcctgcttattccaaaactttccaaggtccacctcatggtatccaagttgaaagagataagttaaacaaatatggccgtcccctattgggatgtaccattaaaccaaaattgggtttatctgccaaaaactatggtagagcagtttacgaatgccttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccatttatgcgctggagagatcgtttctgcttctgtgcagaagcactttataaagctcaggctgagacgggtgaaattaagggacattacttgaatgctaccgcaggtacatgtgaagaaatgataaaaagggctgtatttgccagagaattgggagttcctatcgtcatgcatgactacctgacgggaggttttactgcgaataccagcttggctcattattgccgagataatggcctacttcttcacattcaccgcgcaatgcatgcagttattgacagacaaagaaatcatggtatgcacttccgtgtactagctaaagcattgcgcatgtccggtggagatcatgttcacgccggtactgtagtaggtaaacttgaaggtgaacgagaagtcactttgggttttgttgatctattgcgtgatgattttattgaaagagaccgaagtcgcggtatttatttcactcaagattgggtatctatgccaggtgttctgcccgtagcttcggggggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattccgtactacagttcggcgggggaactttgggacacccttggggaaatgcacctggtgcagcagcgaatcgagtcgccttagaagcttgtgtacaagctcgtaatgaaggacgtgatcttgctcgtgaaggtaatgaagtgatccgtgaagctagtaaatggagccccgagctagctgctgcttgtgaagtatggaaggagatcaaatttgaatttgat
    Ephedra          ---ggatttaaagctggtgttaaagattatagattaacttattatactccagagtatcagactaagaacactgatatcttggcagcattccgagtaactcctcaacccggagtaccgcccgaggaagcaggcgcagcggtagctgctgaatcttctacaggtacatggaccacagtttggactgatggtcttactagtcttgatcgttacaaaggacgatgctatgatatcgaacctgttccgggagaagacaatcaatttattgcttatgtagcatatcctttggacctttttgaagaaggttctgttactaacatgtttacttctattgtggggaatgtttttggttttaaagctctacgagctctacgcctagaagatttgcgaattcctcctgcttatatcaaaacatttcaaggtccacctcatgggatccaagtagaaagagataaattaaacaaatacggacgtcctttgttgggatgtaccatcaaacctaaattaggtctatctgctaaaaattacggtagagcagtttatgaatgtcttcgtggcggactagattttactaaagatgatgaaaatgtaaattctcaaccctttatgcgttggagagatcgctttgttttttgcgcggaagctatttataaagctcaagctgaaacaggtgaaattaagggacattacttaaatgctactgcgggtacatgtgaagaaatgataaaaagagcagtattcgcaagagaattaggggttccgattgttatgcatgattatttaacaggaggtttcactgcaaataccactttagctcattattgccgagataatggcttacttcttcatattcatcgtgcaatgcatgcagttattgatagacaaaaaaatcatggtatgcacttccgtgtactggctaaagcattacgaatgtccggtggagatcatattcatgccggtactgtcgtaggtaaacttgaaggagaacgagaaattactttaggttttgtggatttacttcgtgatgactttattgaaaaagatcgaagtcgtggtatttatttcacgcaagattgggtatctatgccaggtgttctgcctgttgcttcaggaggtattcatgtttggcatatgcctgctttgaccgatatctttggagatgacgctgtattacaatttggtggaggaaccttaggacatccttggggaaatgcacccggtgccgtagctaatcgggttgctttagaagcttgtgtccaagctcgtaatgaaggacgtgatcttgctcgtgaggggaatgaagtaattcgtgaagcttgtaagtggagtcctgaactagctgctgcttgt---------------------------------
    Gnetum           gtaggattccaagctggtgttaaagattatagattaacttattatactccggaatatcagactaaggatactgatatcttggcagcattccgagtaacaccacagcccggagtaccgcctgaggaagcaggagcagctgtagctgctgaatcctccaccggtacatggaccactgtgtggactgatggacttaccagtcttgatcggtacaaaggacgatgctacgaccttgagcctgttcctggagaagaaaatcaatttattgcttatgtggcgtatcctttggaccttttcgaagagggttccgtgactaacatgtttacttccattgtaggaaacgtttttggattcaaagctctacgggctttacgcctggaagacttacggattcctcctgcttatacaaaaacatttcaagggccccctcacggtatccaagttgaaagagataaattaaacaaatatggacgtcctttattggggtgtactatcaagcctaagttaggtctatcggccaaaaactacggtagagccgtttatgaatgtcttcgtggtgggcttgattttactaaagatgatgaaaacgtcaattctcaaccattcatgcgctggagagaccgctttgttttttgcgcggaagctattaataaagctcaagctgaaacaggcgaaattaaagggcattatttaaatgctactgcaggtacatgcgaggaaatgatcaaaagggcagtatttgcaagagaattaggagttcctattgtcatgcatgactatctgacaggaggttttaccgcgaataccagcttggctcattattgccgagataacggcttacttcttcacattcaccgcgcaatgcatgcagttattgatagacaaaaaaatcatggtatgcatttccgtgtactggctaaagcgttgcgcttgtccggcggggatcacgttcatgctggtactgtagttggtaaacttgaaggagaacgagaaatcactttaggttttgtggatttacttcgcgatgattttgttgaaaaagaccgaagtcgtggtatttatttcacccaagattgggtatctacgccgggcgtcctgcctgtagcttcgggaggtattcatgtttggcatatgccagctctaactgacatttttggagatgatgcagtactccaatttggtggaggaaccttgggacatccttgggggaatgcacccggtgctgtagctaatcgagttgctctagaggcttgtatacaggctcgtaatgaagggcgtgatcttgttcgtgaaggtaatgaagtgatccgcgaagctagtaaatggagtcctgaactagctgctgcttgtgaag-----------------------------
    Welwitschia      gtaggattccaagctggtgttaaagattatagattaacttattatactccggaatatcagactaaggacactgatatcttggcagcattccgagtaacccctcaacctggggtaccgcctgaggaagcgggagcagcagtagccgctgaatcttctactggtacatggaccacggtgtggactgatggacttacgagtctcgatcgttacaaaggacgatgctacgaccttgaacctgttcctggagaggacaatcaatatattgcttatgtagcatatcccctggacctgtttgaagaaggttctgtgactaacatgtttacttccattgttgggaacgtttttggattcaaagctctacgtgctttacgcctggaagatttgcgaattcctacttcttatataaaaacttttcaaggaccaccccacggtatccaggtggaaagagataaattaaacaaatacggacgtcccttattgggttgtactatcaaacctaaattaggtctatcagctaaaaactatggtagagctgtttatgaatgtcttcgtgggggacttgattttactaaggatgatgaaaacgtcaattctcaaccattcatgcgctggagagatcgtttcgttttctgtgcagaagcaatttataaagctcaagctgaaacaggtgaaattaaaggacattatttgaatgctactgcgggtacatgtgaggaaatgatcaaaagggcagtattcgcgagagaattaggagttcctattgtcatgcatgattatttaacaggaggttttactgcaaatactaccttggctcattactgccgggataatggcttacttcttcacattcaccgtgcaatgcatgcagttattgatagacaaaaaaatcatggtatgcatttccgtgtactggctaaagcattacgaatgtccggtggggatcatattcatgctggtactgtagtaggtaaacttgaaggagaacgagaaatcactttaggttttgtggatttactgcgcgatgactttattgaaaaagaccggagtcgtggtatttatttcactcaagattgggtatctatgccaggtgtcatgcccgtagcttcgggaggtattcacgtttggcatatgccagctctgaccgatatttttggagatgatgctgtactacaatttggtggaggaactttaggacacccttggggaaatgcaccaggtgctgtagctaatcgagtcgctttagaagcttgtgtgcaggctcgtaacgaggggcgcgatcttgctcgtgaagggaatgaagtaatccgcgaagcagctaaatggagtcctgaactagctgctgcgtgtgaagtctggaaggagatcaagtttgaatttgag
    Athrotaxis       GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGACTATCAGGTAAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTACCCCCCGAAGAAGCGGGA???GCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATTCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTTAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACAGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATTTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATAAAATTTGAATTTGAT
    Austrocedrus     GTTGGATTCAAAGCGGGTGTTAAAAATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCTACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTACGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTTACTTCGATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTTTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGACCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAAACGGGTGAGATTAAGGGGCATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTGCTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTACCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAGTA---------------------------
    Callitris        -----------------------AGATTACAGATTAACTTATTATACTCCCGAATATCCGACCAAAGATACTGATATCTTAGCAGCCTTCCGCGTCACTCCCCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCGGCCGAGTCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTCGATCGTTACAAGGGGCGATGTTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCTTATGTAGCCTATCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTTTTTACTTCTATTGTCGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTTCTTATTCAAAAACTTTTCAAGGACCCCCACACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTAGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTGGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCGGAAGCACTTTATAAAGCTCAAGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCGGGGACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCACTATTGCCGCGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTTGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATTTATTGCGTGATGATTTTATTCAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGAGGGATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCGGGTGCAGTGGCCAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGGCGCGACCTTGCGCGTGAAGGTAAT------------------------------------------------------------------------------------
    Callitropsis     --------CAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCGGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGCCTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAGCCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTG--------------------------------------------------------------------------------------------
    Chamaecyparis    --------CAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGGGCGGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGGACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGTCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAGGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTG--------------------------------------------------------------------------------------------
    Calocedrus       --------CAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAATATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGGAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTG--------------------------------------------------------------------------------------------
    Cupressus        ------TTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCGGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGCCTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAGCCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGTCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTGGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTA--------------------------------------------------------------------------------------
    Cryptomeria      GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTAGCAGCATTCCGAGTCACTCCTCAACCTGGAGTACCCCCCGAAGAAGCGGGAGCAGCAGTAGCCGCCGAATCTTCCACTGGTACGTGGACGACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTGGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGGATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATAAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGGGAAGTGACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTCGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATCAAGTGATCCGCGAAGCTACTAAATGGAGCCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGAT
    Cunninghamia     GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTACCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACATGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACAAGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACTGGAGGTTTTACGTCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATACACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCACGTGAAGGTAACGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGAT
    Diselma          -----------------TGTTAAAGATTATAGTTTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGGGTGCCCCCCGAAGAAGCGGGAGC?GCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGGTACAAGGGGCGATGCTATGATATCGAACCCGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAGCTTTTCAAGGACCACCACACG??AT?CA?GTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGAACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGGAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCGCGTGAAGGTAATGAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGAT
    Fokienia         -------------------------------GATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCGGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGCCTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAGCCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAATTCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACT----------------------------------------------
    Glyptostrobus    GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTAGCAGCATTCCGAGTCACTCCTCAACCTGGAGTACCCCCCGAAGAAGCGGGA???GCAGTAGCCGCCGAATCTTCCACTGGTACGTGGACGACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTGCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTGACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATAAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTAACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGCCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGAT
    Juniperus        --------CAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCGGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGCCTTACTAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAGCCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAATTCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTG--------------------------------------------------------------------------------------------
    Libocedrus       GTTGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCAGGAGCAGCAGTAGCTGCCGAATCGTCCACTGGTACGTGGACGACTGTTTGGACCGATGGACTTACTAGTCTTGATCGTTACAAGGGACGATGCTATGATATTGAACCGATTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTTACTTCTAT?GTAGGTAA?GTATTTGGATTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGACCACCGCACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCTAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAAGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTTTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGAC?TTGCGCGTGAAGGTAATGAAGTGATCC?CGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTCAATTTGAT
    Metasequoia      GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATGCAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCGCAGCCTGGAGTACCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCGACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCCTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGCTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGACCACCACATGGTATTCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTTTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCCCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTA---------------------------------------------
    Microbiota       GTCGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTAGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTATGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTTATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGAT
    Neocallitris     GTTGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCCGAATATCCGACCAAAGATACTGATATCTTAGCAGCCTTCCGCGTCACTCCCCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGCAGCGGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTCGATCGTTACAAGGGGCGATGTTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGTTTATGTAGCCTATCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTTTTTACTTCTATTGTCGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTTCTTATTCAAAAACTTTTCAAGGACCCCCACACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTAGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGC?TTTGTGCAGAAGCAATTTATAAAGCTCAAGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCGGG?ACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCACTATTTCCGCGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTCCGTG??CTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTTGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATTTATTGCGTGATGATTTTATTCAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATGCCTGTAGCTTCAGGAGGGATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCGGGTGCAGTGGCCAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGGCGCGACCTTCCGGTTGAAGGTAATGAAGTGA?CC--------------------------------------------------------------------------
    Papuacedrus      GTTGGGTTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACTAAAGATACTGATATCCTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAACGCAATTTATTGCGTATGTAGCTTATCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTTACCTCTATTGTAGGAAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGACCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTAGGTCTATCTGCCAAAAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGGCATTACCTGAATGCTACTGCAGGTACATGGGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACGGTTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAATA---------------------------
    Pilgerodendron   GTTGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCAGGAGCAGCAGTAGCTGCCGAATCGTCCACTGGTACGTGGACGACTGTTTGGACCGATGGACTTACTAGTCTTGATCGTTACAAGGGACGATGCTATGATATTGAACCGATTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGACCACCACACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTAGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAAGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTTTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATAAAGGACGTGACCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAGTA---------------------------
    Platycladus      GTC?GATTCAAAGCGGGTGTTAAAGGTTACAGATTAAATTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGACGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAGGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGGGATAAATTAAATAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCRGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGAGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGCGAAGTATGGAAGGAAATCAAATTTGAATTTGAT
    Sequoia          GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATGTGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTACCCCCCGAAGAAGCGGGA???GCAGTAGCTGCCGAATCTTCGACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCCTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGACCACCACATGGTATTCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCCCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGAT
    Sequoiadendron  ----GATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATGTGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCACCT?GGAGTACCCCCC??????CGGGAAGCAGCAGTAGCTGCCGAATCTTCGACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTATCCCTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGACCACCACATGGTATTCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCGGTATTCGCCAGAGAATTGGGAGTTCCTATCATCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAG?GGCTAATCGAGTCGCTTTA?AA?CTTGTGT?CAAGCTC?TAATGAA?GAC?TGATCTTGCGC?TGAAGGTAATGAAGTGATCCGAGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAATATGGAAAGAAATCAAATTTGAATTTGAT
    Taiwania         GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGGGTCACTCCCCAACCCGGAGTACCCCCCGAAGAAGCGGGACAGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACTAGTCTTGATCGTTATAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGTCCACCACATGGTATTCAAGTGGAAAGAGACAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCGGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGCGCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTCTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGAT
    Taxodium         gtcggattcaaagctggtgttaaagattacagattaacttattatactccggaatatcagaccaaagatactgatatcttagcagcattccgagtcactcctcaacctggagtaccccccgaagaagcgggagcagcagtagccgccgaatcttccactggtacgtggacgactgtttggaccgatggacttaccagtcttgatcgttacaaggggcgatgctatgatattgaaccccttcctggagaggaaagtcaatttattgcctatgtagcttaccctttagatctttttgaagaaggttctgttactaacctgttcacttctattgtaggtaatgtatttggattcaaagccttacgggctctacgtctggaagatttacgaattcctcctgcttattcaaaaactttccaaggcccaccacatggtattcaagtagaaagagataaattaaacaaatatggtcgtcctttgttgggatgtactataaaaccaaaattgggtctatctgccaagaattatggtagagcggtttatgaatgtctccgtggtggacttgattttaccaaggatgatgaaaacgtgaattcccaaccatttatgcgctggagagatcgtttctgcttttgtgcagaagcaatttataaagctcaggctgagacgggtgagattaagggacattacctgaatgctactgcaggtacatgtgaagaaatgatgaaaagagcaatattcgccagagaattgggagttcctatagtcatgcatgactatctgactggaggttttacggcaaatacttcgttggctcattattgccgagataacggcctacttcttcacattcaccgcgcaatgcatgcagttattgatagacaaagaattcatggtatgcacttccgtgtactggctaaagcactacgtatgtctggtggagatcatattcacgctggtactgtagtaggtaaacttgaaggagaacgagaagtcactttgggttttgttgatctattgcgtgatgattttattgaaaaagaccgaagtcgtggtatttatttcactcaagattgggtctctatgccgggtgtcctgcctgtagcttcaggaggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattccgtattacagtttggtggagggactttggggcacccttggggaaatgcacctggtgcagtggctaatcgggtcgctttagaagcttgtgtacaagctcgtaatgaaggacgtgatcttgcgcgtgaaggtaatgaagtgatccgcgaagctactaaatggagccctgaactagctgccgcttgtgaagtatggaaagaaatcaaatttgaatttgat
    Tetraclinis      GTCGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCTTCGAAGAAGCAGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTGCTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTGACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATCGTAGAGCGGTTTATGAAGGTCTCCGTGGTGGACTGGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCAYTATTGCCGCGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTCAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTCCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGAT
    Thujopsis        GTCGGATTCAAAGCGGGTGTTAAAG?TTACAGATTAACTT??TATACTCCGGAGTATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGCTGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGAGGTATCCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGGCGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGAT
    Thuja            --------CAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAGTATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGGGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATAAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTAGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGGCGTGATCTTGCGCGTG--------------------------------------------------------------------------------------------
    Widdringtonia    GTTGGATTCAAAGCGGGTGTTAAAGATTATAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGGGTGCCCCCCGAAGAAGCGGGAGCAGCTGTAGCTGCCGAATCCTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGGTACAAGGGGCGATGCTATGATATCGAACCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGACCACCACACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGAACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCT------------------------------------
    Xanthocyparis    --------caaagcgggtgttaaagattacagattaacttattatactccggaatatcagaccaaagatactgatatcttggcagcattccgagtcactcctcaacctggagtgccccccgaagaagcgggagcagcggtagctgccgaatcttccactggtacgtggaccactgtttggaccgatggccttaccagtcttgatcgctacaaggggcgatgctatgatattgaacccgttcctggagaagaaactcaatttattgcctatgtagcttaccctttagacctttttgaagaaggctctgtgactaacctgtttacttctattgtaggtaatgtatttggattcaaagctttacgggctctacgtctggaagatttacgaattcctcctgcttattcaaaaacttttcaaggcccaccacatggtattcaagtagaaagagataaattaaacaaatatggtcgtcctttattgggatgtactatcaaaccaaaattgggtctatctgccaagaattatggtagagcggtttatgaatgtctccgtggtggacttgattttaccaaggatgatgaaaacgtgaattcccagccatttatgcgctggagagatcgtttctgcttttgtgcagaagcactttataaagctcaggctgagacgggtgagattaagggacattatctgaatgcgactgcaggtacatgtgaagaaatgatgaaaagagcagtattcgccagagaattgggagttcctatagtcatgcatgactatctgactggaggttttacggcaaatacttcgttggctcattattgccgagataacggcctacttcttcacattcaccgcgcaatgcacgcagttattgacagacaaagaaatcatggtatgcacttccgtgtactggctaaagcactacgtatgtctggtggagatcatattcatgctggtactgtagtaggtaaacttgaaggagaacgagaagtcactttgggttttgttgatctattgcgtgatgattttattgaaaaagaccgaagtcgtggtatttatttcactcaagattgggtctctatgccgggtgttctgcctgaagcttcaggaggtattcacgtttggcatatgcctgctctgaccgagatctttggagatgattccgtattacagtttggtggagggactttggggcacccttggggaaatgcacctggtgcagtggctaatcgggtcgctttagaagcttgtgtacaagctcgtaatgaaggacgtgatcttgcgcgtg--------------------------------------------------------------------------------------------
    Agathis          GTTGGATTTAAAGCTGGTGTTAAAGATTATAGATTAACTTATTATACTCCGGAATATCAGACCAAAGACACTGATATCTTGGCAGCATTCCGAGTTACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCAGCAGTAGCGGCTGAATCTTCCACCGGTACATGGACAACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACCTGTTCACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCCAAAACTTTCCAGGGTCCACCCCATGGTATTCAAGTTGAAAGAGATAAATTAAACAAATATGGCCGTCCCTTGTTGGGGTGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTTTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCAGAGACGGGTGAAATTAAGGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAATGTTCGCCTATGAATTGGGAGTTCCCATAGTCATGCATGACTATCTGACGGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGACCATGGCCTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAAAATTCATGGTATGCACTTTCGTGTGCTGGCTAAAGCATTGCGTATGTCTGGCGGAGATCATGTTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGTGAACGAGAAGTCACTTTAGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTGTTTATTTTACTCAAGATTGGGTATCTATGCCAGGTGTTTTGCCTGTAGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGGGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATCCGTGAAGCAGCTAA-------------------------------------------------------------
    Araucaria        GTTGGATTTAAAGCTGGTGTTAAAGATTATAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCAGCAGTAGCGGCTGAATCTTCTACCGGTACATGGACAACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACCTGTTCACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATTCAAGTTGAAAGAGATAAATTAAACAAATATGGCCGTCCCTTGTTGGGGTGTACTATAAAACCAAAATTGGGTCTATCTGCCAAAAATTATGGTAGAGCAGTTTATGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCGGAGACGGGTGAAATTAAGGGGCATTACTTGAATGCTACCGCAGGTACATGTGAAGAAATGATGAAAAGAGCAAGTTTCGCCTATGAATTGGGAGTTCCCATCGTCATGCATGACTATCTGACGGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGACCATGGCCTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAAAATTCATGGTATGCACTTTCGTGTGCTGGCTAAAGCATTGCGTATGTCTGGTGGAGATCATGTTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGTGAACGAGAAGTCACTTTAGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTTACTCAAGATTGGGTATCTATGCCAGGTGTTTTGCCTGTAGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGAGGTAGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCAACTAAATGGAGTCCTGAACTAGCTGCTGC-------------------------------------
    Wollemia         GTTGGATTTAAAGCTGGTGTTAAAGATTATAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCAGCAGTAGCGGCTGAATCTTCCACCGGTACATGGACAACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATTCAAGTTGAAAGAGATAAATTAAACAAATATGGCCGTCCCTTGTTGGGGTGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCGGAGACGGGTGAAATTAAGGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAAATTTCGCCTATGAATTGGGAGTTCCCATAGTCATGCATGACTATCTGACGGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGACCATGGCCTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAAAATTCATGGTATGCACTTTCGTGTGCTGGCTAAAGCATTGCGTATGTCTGGCGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGTGAACGAGAAGTCACTTTAGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTTACTCAAGATTGGGTATCTATGCCAGGTGTTTTGCCTGTAGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGGGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTGAAGGTAATGAGATTATCCGTGAAGCAGCTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCACATTTGTATTTGAT
    Torreya          GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGACTATGATACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGACGATGCTATGATATCGAGCCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTGACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCATTGTTGGGATGTACTATCAAACCAAAATTGGGCTTATCCGCCAAGAATTATGGTAGAGCGGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTGTTTTTGTGCAGAAGCAATTTATAAGTCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACGGCAAATACTACGTTAGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGACAGACAAAAAAATCATGGTATGCACTTCCGTGTGCTAGCTAAAGCACTGCGTATGTCTGGTGGAGATCATATTCACGCTGGTACGGTAGTAGGTAAACTTGAAGGAGAACGAGAGATCACTTTAGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTCTTGCCTGTAGCTTCAGGAGGCATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCTTTA?AAGCTTGTGTACAAGCGCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATTAGCGAAGCAGCTAAATGGAGTCCTGAACTAGCTGCTGCT------------------------------------
    Taxus            GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCACAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCGGGAGTGCCCCCCGAGGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGACGATGCTATGATATCGAACCCGTTGCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGATCTTTTTGAAGAAGGTTCTGTGACTAACCTGTTCACTTCCATTGTAGGTAATGTCTTTGGATTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGCTGGGATGTACTATAAAACCAAAATTGGGCCTATCTGCCAAAAATTATGGTAGAGCCGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATTTGACTGGAGGTTTCACGGCAAATACTTCGTTGGCTCATTATTGTCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATACATTTCCGTGTACTAGCTAAAGCACTGCGTATGTCTGGTGGAGACCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTTGATTTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGCACTTTGGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCATTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTCGCTCGTGAAGGTAATGAAGTGATCCGCGAACGTACTAAAT-----------------------------------------------------------
    Amentotaxus      GTTGGCTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCAGAATATAAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGACGATGCTATGATATTGAGCCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGACAAATTAAACAAATATGGTCGTTCTTTGTTGGGATGTACTATCAAACCAAAATTGGGCCTATCTGCCAAAAATTATGGTAGAGCGGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTGTTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTTATGCATGACTATTTGACTGGAGGTTTTACAGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTGCTGGCTAAAGCACTGCGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTCTAGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACCCAAGATTGGGTCTCTATGCCAGGTGTCTTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTCGCTTTAGAAGCCTGTGTGCAAGCTCGTAATGAAGG-------------------------------------------------------------------------------------------------------------
    Pseudotaxus      GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCAGGAGTGCCTCCCGAGGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGACGATGTTATGATATCGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAACGTATTTGGATTTAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCAAAAACCTTCCAAGGACCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGCTGGGATGTACTATCAAACCAAAGTTGGGCCTATCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAATCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTTATGCATGACTATTTGACTGGAGGTTTTACGGCGAATACTTCGTTGGCTCATTATTGCCGAGACAACGGACTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGACAGACAAAAAAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCGCTGCGTATGTCTGGTGGAGACCATGTTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGCGAAGTAACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCTTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAGTTTGGTGGAGGGACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTCGCATTAGAAGCTTGTGTACAAGCTCGTAACGAAGGACGTGATCTCGCTCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCTGC-------------------------------------
    Austrotaxus      GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCCGCCCAAAGACACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCGGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTATGATATCGAACCCGTTCCTGGAGAGGAAAATCAATATATTGCCTATGTAGCTTACCCATTAGATCTTTTCGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCTCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGTCCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGCCTATCTGCCAAAAATTATGGTAGAGCGGTTTACGAATGTCTTCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATAAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAAAAATCATGGTATGCACTTCCGTGTGCTAGCTAAAGCACTGCGTATGTCTGGTGGAGATCATGTTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTGTCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAAATTTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGCACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTCGCATTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGC-------------------------------------
    Cephalotaxus     GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATAAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTGCCCCCTGAGGAAGCAGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACGAGTCTTGATCGTTACAAGGGACGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGATAAACTAAATAAATATGGTCGTCCTTTGTTGGGATGTACAATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTACGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAATGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTGCTTCTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACCGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTCCACATTCATCGTGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTGCGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGTGATGATTCTGTATTACAGTTTGGTGGAGGGACTTTGGGACACCCTTGGGGAAATGCACCAGGTGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGAGAAGCCACTAAATGGAGTCCTGAACTA---------------------------------------------
    Sciadopitys      GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACCCCTGAATATCAGACCAAAGACACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCTCCTGAGGAGGCAGGA???GCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTCACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTATCCCTTAGATCTTTTTGAGGAAGGTTCTGTTACTAACATGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGTCCGCCCCATGGTATCCAAGTTGAAAGAGATAAATTAAACAAATATGGTCGCCCTTTATTGGGGTGTACTATCAAACCAAAATGTGGCCTATCTGCCAAAAATTATGGCAGAGCAGTTTACGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACCATTCATGCGCTGGAGAGACCGTTTTTGCTTTTGTGCTGAAGCAATTTATAAAGCTCAAGCTGAAACGGGTGAAATTAAGGGACATTATTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTCCCCATAGTCATGCATGACTATCTGACGGGAGGTTTTACGGCAAATACTTCGTTGTCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTCCGTGTGCTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATTTACTGCGTGATGATTTTATTGAAAAAGATCGAAGCCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTTTTGCCTGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGACGATTCTGTATTACAGTTCGGTGGGGGAACTTTGGGGCATCCGTGGGGAAATGCGCCTGGTGCAGTAGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTTGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCAAATTTGAATTTGAT
    Pinus            GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAGGATACAGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGGGTGCCACCTGAAGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTAGTCTCGATCGTTACAAGGGGCGATGCTATGATATCGAGCCCGTTCCTGGAGAGGAGACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACTTTTCAGGGTCCACCTCATGGTATCCAGGTTGAAAGAGATAAATTGAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCAGCCAAAAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTCGATTTTACTAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCAATTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTATTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGTAATATTTGCAAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGAGGTTTTACCGCAAATACTTCTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAATTCATGGTATGCATTTCCGGGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTAACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCT?CTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTTCTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAATATGGAAGGAGATCAAATTTGAATTTGAT
    Picea            GTCGGATTTAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATTTTGGCAGCATTCCGAGTAACTCCTCAACCAGGGGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACATTTCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCCAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAATATTTGCAAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGAGGTTTTACCGCAAATACTTCTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTGATTGACAGACAAAAAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAATATGGAAGGAGATCAAATTTGAATTTGAG
    Cathaya          gtcggattcaaggctggtgttaaagattacagattaacttattatactcctgaatatcagaccaaagatacggatatcttggcagcattccgagtaactcctcaacccggggtgccgcccgaagaagcgggagcagcagtagctgctgaatcttccaccggtacatggaccactgtttggaccgatggacttactagtcttgatcgttacaaggggcgatgctatgacatcgagcccgttcctggagaggagagtcaatttattgcctatgtggcttaccctttagaccttttcgaagaaggctctgttactaatttgttcacttccattgtaggtaatgtatttggattcaaggccctacgggctctacgtttggaagatttgcggattccccctgcttattccaaaacttttcaaggtccacctcatggtatccaagttgaaagagataaattgaacaaatatggacgtcctttattgggatgtactatcaaaccaaaattgggtctatcagccaagaactatggtagagcagtttacgaatgtctccgcggtggactcgattttaccaaggatgatgagaacgtaaattcccaaccattcatgcgctggagagatcgttttgtcttttgtgcggaagcaattaataaggctcaggctgagacgggtgaaattaagggacattacttgaatgctactgcaggtacatgtgaagaaatgataaaaagggcagtatttgcaagagaattgggagttcctatcattatgcatgactatctgacgggaggttttactgcaaatacttctttggctcattattgccgagacaacggcctacttcttcacattcaccgcgcgatgcatgcagttattgacagacaaaaaattcatggtatgcatttccgtgtactggctaaagcattgcgtatgtccggcggagatcatattcacgccggtactgtagtaggtaaacttgaaggggaacgagacgtcactttagggtttgtggatctactgcgtgatgattttattgaaaaagatcgaagtcgtggtatttacttcactcaagattgggtatctatgccaggtgtcctgcccgtagcttcaggaggtattcacgtttggcatatgcctgctctgaccgaaatctttggggatgattccgtactacagtttggtgggggaactttggggcacccttggggaaatgcacctggtgcagtagctaatcgggttgctctagaagcttgtgtacaagctcgtaatgaaggacgtgatcttgctcgtgaaggtaatgaaattatccgggaagcttctaaatgg---------------------------------------------------------
    Larix            GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGGGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTAGTCTTGATCGTTACAAGGGACGATGCTATGACATCGAGGCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATCCCCCCTGCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTATCCAAGTCGAAAGGGATAAATTGAACAAATATGGCCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCACTTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAGTATTTGCAAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGAGGTTTTACTGCAAATACTTCTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGCATGCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGACTGGGTATCTATGCCAGGTGTTCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGGCACCCTTGGGGAAATGCGCCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTACTAAATG----------------------------------------------------------
    Abies            GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCGGCATTCCGAGTAACTCCTCAACCTGGGGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCACTTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAGTATTTGCAAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACGGGGGGTTTTACCGCAAATACTACTTTGGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATCGACAGACAAAGAAATCATGGTATGCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATTTGAT
    Tsuga            GTAGGGTTCAAAGCTGGTGTTAAGGATTATAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCGTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAACCCGTTCCTGGAGAAGAGAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTATTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACTTTTCAAGGTCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATACGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTATGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAACTCCCAACCATTCATGCGTTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCACTTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAGTATTTGCAAGAGAATTAGGAGTTCCTATCGTTATGCATGACTATCTGACGGGAGGTTTTACCGCAAATACTACTTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTTCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTAGGGTTTGTTGATCTACTGCGTGATAATTATATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTCGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTTGTTCGTGAAGCTTGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATTTGAT
    Nothotsuga       ------------GCTGGTGTTAAGGATTATAGACTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCGTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAACCCGTTCCTGGAGAAGAGAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTATTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGAGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACTTTTCAAGGTCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTATGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAACTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCACTTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAATATTTGCAAGAGAATTAGGAGTTCCTATCGTCATGCATGACTATCTGACGGGAGGTTTTACCGCAAATACTAGTTTGGCTCATTATTGCCGAGACAATGGCTTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCTTTTTCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGACGTCACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGCCGGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGTGAAGCTTCTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAATATGGAAGGAAATCAAATTTGAATTTGAT
    Cedrus           GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGGGTGCCACCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAGGAGAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACATTTCAAGGTCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCTAAAAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCAATTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAGGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAGTCTTTGCAAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATTTGACGGGAGGTTTTACCGCAAATACTAGTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAATTCATGGTATGCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGATGTTACTTTAGGATTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTTTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCAAATTTGAATTTGAG
    Pseudolarix      GTCGGATTCAAAGCTGGTGTTAAAGATTACCGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGGGTGCCACCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATTGAGCCCGTTCCTGGAGAGGAGAGCCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCAATTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAGATGATGAAAAGGGCAATATTTGCAAGAGAATTAGGAGTTCCTATCGTCATGCATGACTATCTGACGGGAGGTTTTACTGCAAATACTAGTTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGACGTCACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATG----------------------------------------------------------
    Keteleeria       GTCGGATTCAAAGCTGGTGTTAAAGATTATAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCGGCATTCCGAGTAACCCCTCAACCTGGGGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTACTCAAGTTGAAAGAGATAAATTGAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCAGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGACATCGTTTTGTCTTTTGTGCGGAAGCACTTAATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAATATTTGCAAGAGAATTAGGAGTTCCTATCGTCATGCATGACTATCTGACGGGGGGTTTTACTGCAAATACTAGTTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTGTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTGCTAAATG----------------------------------------------------------
    Phyllocladus     GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGGCTCACCAGCCTTGATCGTTACAAGGGGCGATGTTATGACATCGAGCCTGTTCCTGGAGAGGAAAATCAATATATTGTCTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTATTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAAGTTGAAAGAGATAAATTAAATAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTGTCCGCTAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGATGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCAGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCGGGTACATGCGAAGAAATGCTAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGTTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTATGCACTTTCGTGTACTGGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATTCACGCTGGTACGGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTGGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGCCGTGGTATTTATTTCACTCAAGACTGGGTATCTATGCCAGGTGTCCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTTGTAAATGGAGTCCCGAACTAGCTGCTGC-------------------------------------
    Lagarostrobus    GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGACTATCAGGTCGCAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTCACCAGCCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAAGTCAATATATTGTCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACTTGTTCACTTCGATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCCAATACTTTCCAAGGCCCACCCCATGGTATCCAGGTTGAAAGAGATAAATTAAATAAATATGGCCGTCCCTTGTTGGGATGTACCATCAAACCAAAATTGGGCCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGATGATGAGAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGCTTCTGCTTTTGCGATGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAAGTTCATGTCAAGAAATGATTAAAACAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATTCACGCAGGTACTGTAGTAGGTAAACTTGAAGGAGAGGGAGAAGTAACTTTGGGTTTTGTTGATCTACTACGTGATAATTTTATTGAAAAAGACCGAAGCCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCTGTAGCTTCMGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTTTTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCCCCTGGTGCAGTAGCTAATCGGGTTGC----------------------------------------------------------------------------------------------------------------------------------------------
    Prumnopitys      GTTGGGTTCAAAGCTGGTGTTAAAGACTACAGATTAACTTATTATACTCCGGAATATCAGTCCCAAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCSGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGCCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAAATCAATATATTGTCTATGTAGCTTAMCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTTTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCARGTWGAAAGAGATAAATTAAATAAATATGGCCGTCCCTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTGTCCGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACMAAGGATGATGAGAATGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCAGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCCATCGTTATGCATGACTACTTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCATCGCGCAATGCATGCAGTTATCGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTGGCTAAAGCMTTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTAATACGTGATAATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCATACCTGTAGCTTCGGGGGGTATTCATGTTAAACATATGCATGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGCGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTGGTAAGCGGAGTCCCGAACTTG--------------------------------------------
    Dacrydium        GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGACACAGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTACCTCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGTCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCACATGGTATCCAGGTTGAAAGAGATAAATTAAATAAATATGGCCGCCCCCTATTGGGATGTACTATCAAACCAAAATTGGGTTTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAGGATGATGAGAACGTAAATTCTCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCAATTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCAGTATTCGCTAGAGAATTGGGGGTTCCTATCATTATGCATGACTATCTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTAGCGAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTTTCTATGCCAGGTGTCCTGCCTGTAGCTTCGGGAGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTTGTAAATGGAGT------------------------------------------------------
    Dacrycarp        GTTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCCAAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTTCCTTCCGAGGAAGCAGGAGCGGCAGTAGCTTCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGGCTTACCAGCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAACTCAATTTATTGTCTATGTGGCTTATCCCTTAGACCTTGGTGAAGAAGGTTCTGTTACTAACCTGTACACCTCTATTGTAGGTAATGTGGTTGGATACAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAGACTTTCCAGGGCCCACCCCATGGTATCCAGGTGGGAAGAGATAGATTAAATAAATATGGTCGCCCCCTATTGGGATGCACTATCAAACCAAAATTGGGCCTGTCTGCCAAGAATTATGGTAGAACAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAAGATGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTCACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCACTTTCGTGTACTAGCGAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTACTACAGTTTGGTGGAGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGGCGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGCAAATGGAGTCCCGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCATATT----------
    Podocarpus       ---GGGTTCAAGGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAAATCAATATATTGTCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGGGCTCTACGTCTAGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCACATGGTATCCAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCTTATTGGGATGTACCATCAAACCAAAATTGGGCCTGTCTGCAAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAGGATGATGAGAATGTAAATTCCCAACCATTTATGCGCTGGAGAGAACGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACGGCGAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGGGATCATATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTACCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCACGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCCGAACT----------------------------------------------
    Nageia           GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAAGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACTTGGACTACTGTTTGGACCGATGGGCTTACCAGCCTCGATCGTTACAAGGGGCGATGCTATGGCATCGAGCCTATTCCTGGAGAGGAGAGTCAATTTATTGCCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTCCCAAGGTCCACCACATGGTATCCAGGTTGAAAGAGATAACTTAAATAAATATGGCCGCCCCTTATTGGGATGTACCATCAAACCAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTATTCGTGGTGGGCTTGATTTCACGAAGGATGATGAGAATGTAAATTCCAAACCAATTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGTGAAGAAATGATGAAAAGGGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACGGCGAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTCTTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCATGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCTTACCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGCAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGGTAGCAAATGGTGTCCAGACCTAGC-------------------------------------------
    Microstrobos     GTTGGGTTCAAAGCTGGTGTTAAAGGTTACAGATTAACTTATTATACTCCGGTATATCAGTCCAAAGGTACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGTAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGCCTTGATCGTTATAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGCTCTGTTACTAATCTGTTCACTTCCATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCTTTATTGGGATGTACTAACAAACCAAAATTGGGACTGACTGCCAAAAATTATGGTAGAGCAGTTTACGAATGTCTACGTGGTGGACTTGATTTCACCAAGGATGATGAGAACGTAAATACGCAACCATTTATGCGCTGGAGAGAACGTTTTTGCTTCTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTACCTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTCACCGAAATATTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCCGAACG----------------------------------------------
    Microcachys      GTTGGGTGCCAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGTAGCAGGAGCGGCAGTATCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACCCAATATATTGCCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAAGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCTTATTGGGATGTACTATAAAACCAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGCCTACGTGGTGGACTTGATTTCACAAAGGATGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAACCACCTCATAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCGGGTACATGTGAAAAAATGATGAAAAGAGCGGTATTCGCTCGAAAATTGGGAGTTCCTATCATTATGCATGACTATCTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTGCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTACCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACCTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCTTGCCTGTAGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGTTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGAGA----------------------------------------------------------------------
    Saxegothaea      GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGCCCAAAGATACTGATATCTTGGCGGCATTCCGAGTCACTGCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGACGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAAGTCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAAGTCGAAAGAGATAAATTAAATAAATACGGCCGTCCTTTGCTGGGATGTACTATCAAACCAAAATTGGGTCTGTCTGCCAAAAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGATGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACTGCAAATACATCGTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAGAAATCACGGTATGCATTTTCGTGTACTGGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATCCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGACAAGTAACTTTAGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATCTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCTTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTTGTAAATGGAGTCTCGAACTGGCTGCTGCT------------------------------------
    Acmopyle         ----------AATCTGGCGTTAAAGATTACAKATTAACTTATTATACTCCTGAATATGCGGTCAAAGACACTGATATCTTGGCGGCATTCSGAGTCACWCCTCAACCCGGTGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACCGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTATCCCYTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACCTCAATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAARATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCGCCGCATGGTATCCAGTTTGAAAGAGATAAATTAAATWAATATGGCCGCCCCTTATTGGGATGTACTATCMAACCAAAATTGGGTCTGTCTGCCMAGAATTATGKTAGAGCAGTTTACGAATGTCTTCSTGGTGGACTTGATTYCAMGAAKGATGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGGGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACTGCGAAYACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTKATTGATAGACAAAGAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCAGATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAATAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCTGTAGCTYCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGRATGATTCTGTATTACAGTTTGGTGGARGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCGAATCSGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGSCGTKATCTTGCTMGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCC---------------------------------------------------
    Falcatifolum     ------TTCAAAGCTGGTGTGCCAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGACACCGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTACCTCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGTCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAACTCAATTTATTGTCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCACATGGTATCCAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCCTATTGGGATGTACTATCAAACCAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGGGGTGGACTTGATTTCACGAAGGATGATGAGAATAT?????????????????????????????????????????????????????????????AAAGCTCACGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCAGTATTCGCTAGAGAATTGGGGGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACGAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTTTCTATGCCAGGTGTCCTGCCTGTAGCTTCSGGGGGTATTCATGTTTGGCATATGCCCGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCGCCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTTGTATTTGGAGTGCCGAACTAG--------------------------------------------
    Manoao           GTTGGGTTCAAAGCTGGTGTTAAAGRTTACAGATTAACTTATTATACTCCTGACTATCAGGTCGCAGGTACTGATATCTTGGCAGCATTCSGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGGCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTYACCAGCCTTGATCGTTACAAGGGGMGATGCTATSACATCGAGCCTGTTCCTGGAGAGGAAAATCAATATATTGACTATGTAGCTTACCCCTTGGACCTTTTTGAAGAAGGTTCTGTTACTAATTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTMTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAGTTTGAAAGAGATAAATTAAATAAATATGTCCTCCCCTTGTTGGGATGTACTATTAAACCCAAATTGGGTCCGTCTGCCAAGAATTATGTTAGAGCAGTTTACGAATGCCTTCGTGGTGGACTTGATTTCMCAAAGGATGATGAGAATGTWAATTCCCAACCATTTATGCGTTGGAGAGATCGCTTCTGCTTTTGCGCCGAAGCACTTTTTAAAGCTCATGCTGAAACAGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGCGAAGAAATGCTAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATTGTGATGCATGACTACTTGACGGGGGGTTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGATTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTATGCACTTTCGTGTACTGGCTAAAGCATTGCGTATGTCCGGGGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAGCGAGAAGTAACTTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGCCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCTGTAGCTTCAGGGGTTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTAGGGCACCCTTGGGGAAATGCACCTGGTGGAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTATTGAAGTGATCCGTGAAGCTAACAA-------------------------------------------------------------
    Lepidothamnus    GTCGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCCGACCAAAGATACTGATATCTTAGCGGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCTGTAGCTGCCGAATCTTCTACTGGTACATGGACTACTGTTTGGACCGATGGACTCACCAGCCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAAGAAAATCAATATATTGTCTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTGACTAACCTGTTCACTTCTATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCTCATGGTATCCAGTTTGAAAGAGATAAATTAAATAAATACGGCCGCCCCTTGTTGGGTTGTACCATCAAACCAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGAGGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCAGAAGCACTTTTTAAAGCTCAGGCCGAAACGGGTGAAATTAAGGGGCATTACCTTAATGCTACCGCAAGTACATGTGAACAAATGATGAAAAGATCAGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACAAAGAAATCATGGTATGCACTTTCGTGTACTGGCTAAAGCATTGCGTATGTCTGGGGGGGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTTGATCTACTACGTGATGATTMTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATTTTTGGGGATGATTCTGTATTACAGTTCGGTGGAGGAACTGTGGGGCACCCTTGGGGAAATGCACCTGGGGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGAGACGAGATCTTGCACGTGAAGGTAATGAAGTGATCGGTGAAGCTGGCCAAGAGAGT------------------------------------------------------
    Halocarpus       GTAGGGTTCAAAGCTGGTGTTAAAGGTTACAGGTTAACTTATTATACTCCGGTATATCAGACCAAAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCTGGTGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGTCCGATGGCCTCACCAGCCTTGATCGTTACAAGGGGCGATGCTATGACATTGAGCCTGTTCCTGGAGTGGAAAATCAATTTATTGCCTATGTAGCTTACCCCCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTTATTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAGGTTGAAAGAGATAAATTAAATAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTCTCCGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCATGGTGGACTTGATTTCACGAAGGATGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGATGAAATTAAGGGGCATTACCTGAATGCTACCGCGGGAACATGCGAAGAAATGATAAAAAGGGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGATTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTATGCACTTTCCTGTACTGGCTAAAGCGTTGCGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTGGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTTGACCTACTACGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGGGGTATACATGTTTGGCATATGCCTGCTCTGACGGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCGGGTGCAGCCGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCCGAG------------------------------------------------
    Afrocarpus       GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCCGACCAAAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGGCTTACCAGCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAAATCAATATATTGTCTATGTAGCTTATCCCTTAGACCTTTTKGAAGAAGGTTCTGTTACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATACAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCTTATTGGGATGTACCATCAAACCAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAGGATGATGAGAATGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTACTTGACGGGGGGGTTTACGGCGAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCATGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGAATGGGTATCTATGCCAGGTGTCATACCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCCTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGCAAATGGAGTCCCGAACT----------------------------------------------
    Retrophyllum     GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATGTCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAAATCAATTTATTGTCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTCACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCTTATTGGGATGTACCATCAAACCAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAGGATGATGAGAATGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGATCCGGCTGAAACTGGTGAAATTAAAGGGCATTACCTGAATGCTACCGCAGGTACATGTGAACAAATGATAAAAAGAGCGGTATTCGCTATAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACGGCMAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCATGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCCTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCYTACCTGTAGCTTCGGGGGGTATTCATKTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTCGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTAGTAATGAGGGACGAGATCTTGCTCGTGAAGGTGATGAAGTGATCCGTGAAGCTAGTGAACGGAGTCCAG--------------------------------------------------
    Sundacarpus      -------TCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGACTATCAGACCCCCGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTATCCGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTCACCAGCCTTGATCGTTACAAGGGGCGATGCTACGACATCGAGCCTGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAGACTTTCCAAGGTCCACCTCATGGTATCCAAGTAGAAAGAGATAAATTAAATAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAGCCAAAATTGGGTCTGTCCGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGATGATGAGAATGTAAATTCCCAACCATTTATGCGCAGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAGTTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGCGAAGAAATGATAAAAAGAGCAGTATTCGCGAGAGAATTGGGAACTCCTATCGTTATGCATGACTACCTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGTCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTATGCACTTTCGTGTACTGGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTTGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTACCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGCGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGGGTTGCTTTACAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATCAAGTGATCCGCGAAGCTGCTACATGGAGTCCAGAATTA---------------------------------------------

;

END;


begin assumptions;
    charset 1stpos = 1-1380\3;
    charset 2ndpos = 2-1380\3;
    charset 3rdpos = 3-1380\3;
    end;