conifer-rbcL-ratchet

#NEXUS

BEGIN TAXA;
    TITLE Taxa;
    DIMENSIONS NTAX=78;
    TAXLABELS
        Ginkgo Cycas Stangeria Encephalartos Bowenia Ceratozamia Dioon Chigua Ephedra Gnetum Welwitschia Athrotaxis Austrocedrus Callitris Callitropsis Chamaecyparis Calocedrus Cupressus Cryptomeria Cunninghamia Diselma Fokienia Glyptostrobus Juniperus Libocedrus Metasequoia Microbiota Neocallitris Papuacedrus Pilgerodendron Platycladus Sequoia Sequoiadendron_ Taiwania Taxodium Tetraclinis Thujopsis Thuja Widdringtonia Xanthocyparis Agathis Araucaria Wollemia Torreya Taxus Amentotaxus Pseudotaxus Austrotaxus Cephalotaxus Sciadopitys Pinus Picea Cathaya Larix Abies Tsuga Nothotsuga Cedrus Pseudolarix Keteleeria Phyllocladus Lagarostrobus Prumnopitys Dacrydium Dacrycarp Podocarpus Nageia Microstrobos Microcachys Saxegothaea Acmopyle Falcatifolum Manoao Lepidothamnus Halocarpus Afrocarpus Retrophyllum Sundacarpus
    ;

END;

BEGIN CHARACTERS;
    TITLE  Character_Matrix;
    DIMENSIONS  NCHAR=1380;
    FORMAT DATATYPE = DNA GAP = - MISSING = ?;
    MATRIX
    Ginkgo           GTCGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGAATATCAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTGCCACCTGAGGAAGCGGGAGCTGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGAAGATGCTATGACATCGAGCCCGTTCCTGGGGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTGGATCTTTTCGAGGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGGAATGTATTTGGATTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAGGGTCCACCTCATGGTATCCAAGTTGAAAGGGATAAATTGAATAAATATGGCCGTCCCCTATTGGGATGTACTATCAAGCCAAAATTGGGTTTATCTGCCAAAAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTTACTAAAGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTTGTTTTGTGCAGAAGCAATTTATAAAGCTCAGACCGAGACGGGTGAAATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATGAAAAGGGCAGTATTTGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACGGGAGGTTTTACTGCAAATACTAGCTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCATTGCGTATGTCTGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTCTGGGTTTTGTTGATCTACTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGCCCGTAGCTTCAGGGGGTATTCACGTCTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCCCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCCGAACTAGCCGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATTTGAT
    Cycas            gttggatttaaagctggtgttaaagattacagattaacttattacactcctgaatatcaaaccaaagataccgatatcttagcagcgttccgagtaactcctcaacctggagtgccgcctgaggaagcgggagctgcagtagccgctgaatcttccactggtacatggaccactgtttggaccgatggacttaccagtctcgatcgttacaaggggcgatgctatgacatcgagcccgttcctggggagaaaaatcaatttattgcctatgtagcttaccccttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctacgagctctacgcctagaagatttgcgagttcctcctgcttattccaaaactttccaaggtccacctcatggtatccaagttgaaagagataaattaaacaaatatggccgtcctctattgggatgtaccattaaacccaaattgggtttatctgccaaaaactatggtagagcagtttatgaatgtcttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccatttatgcgctggagagatcgtttctgcttctgtgcagaagcaatttataaagctcaggctgagacgggtgaaattaagggacattacttgaatgctactgcaggtacatgcgaagaaatgatcaaaagggcagtatttgccagagaattgggggttcctatcgtcatgcatgactacctgacaggaggatttactgcaaataccagcttggctcattattgccgagacaatggcctacttcttcacattcaccgcgcaatgcatgcagttattgacagacaaagaaatcatggtatgcacttccgtgtgctagctaaagcattgcgaatgtccggtggagatcatattcacgccggtactgtagtaggtaaacttgaaggagaacgagacgtaactttgggttttgttgatctactgcgtgacgattttattgaaagagaccgaagtcgtggtatttatttcacccaagattgggtatctatgccaggtgttctgcccgtagcttcggggggtattcacgtttggcatatgcctgctctaaccgagatctttggggatgattccgtactacagttcggtgggggaactttgggacacccttggggaaatgcacctggtgcagtagcgaatcgagttgccttagaagcttgtgtacaagctcgtaatgaaggacgtgatcttgctcgtgaaggtaatgaagtgatccgcgaagctagtaaatggagtcccgaattagctgctgcttgtgaagtatggaaggagatcaaatttgaatttgag
    Stangeria        gtcggatttaaagctggtgttaaagattacagattaacttattacactcctgaatataaaaccaaagataccgatatcttggcagcgttccgagtaactccccaacctggggtgccacctgaggaagcgggggctgcagtagctgctgaatcttccactggtacatggaccactgtttggaccgatgggcttaccagtctcgatcgttacaaggggcgatgctatgacatcgagcccgttcctggggaagaaactcaatttattgcctatgtagcttaccccttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctaagggctctgcgtctggaagatttgcgaattcctcctgcttattccaaaactttccaaggtccacctcatggtatccaagttgaaagagataaattaaacaaatatggccgtcccctattgggatgtaccattaaaccaaaattgggtttatctgccaaaaactatggtagagcagtttacgaatgtcttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccttttatgcgctggagagatcgtttctgcttctgtgcagaagcaatttataaagctcaagctgaaacgggtgaaattaaggggcattacttgaatgctactgcaggtacatgtgaagaaatgataaaaagggcagtatttgccagagaattgggagttcctatcgtcatgcatgactacctgacgggaggttttactgcaaataccagtttgtctcattattgccgagacaatggcctacttcttcacattcaccgcgcaatgcatgcagttattgacagacaaagaaatcatggtatgcacttccgtgtactagctaaagcattgcgcatgtccgggggagatcatattcacgccggtactgtagtaggtaaacttgaaggggaacgagaagtcactttgggttttgttgatctactgcgtgatgattttattgaaagagaccgaagtcgtggtatttatttcactcaagattgggtatctatgccaggtgttctacccgtagcttcggggggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattctgtactacagttcggcgggggaactttgggacacccttggggaaatgcacctggtgcagtagcgaatcgagtcgccttagaagcttgtgtacaagctcgtaatgagggacgtgatcttgctcgtgaaggtaatgaagtgatccgtgaagctagtaaatggagtccYgaaYtRgctg-----------------------------------------
    Encephalartos    ---------------------------------ttaacttattacactcctgaatataaaaccaaagataccgatatcttggcagcgttccgagtaactccccaacctggggtgcccgctgaggaagcgggggctgcagtagctgctgaatcttccactggtacatggaccactgtttggaccgatggacttaccagtctcgatcgttacaaggggcgatgctatgacatcgagcccgttcctggggaagaaactcaatttattgcctatgtagcttaccccttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctacgagctctacgtctagaagatttgcgaattcctcctgcttattccaaaactttccaaggtccacctcatggtatccaagttgaaagagataaattaaacaaatatggccgtcccctattgggatgtaccattaaaccaaaattgggtttatctgccaaaaactatggtagagcagtttacgaatgtcttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccatttatgcgctggagagatcg?ttctgcttttgtgcagaagcaatttataaagctcagactgagacgggtgaaattaagggacattacttgaatgctactgcaggtacatgtgaagaaatgataaaaagggcagtatttgccagagaattgggagttcctatcgtcatgcatgactacctgacgggaggttttactgcaaataccagcttggctcattattgccgagacaatggcctacttcttcacattcaccgcgcaatgcatgcagttattgacagacaaagaaatcatggtatgcacttccgtgtactagctaaagcattgcgcatgtccggtggagatcatattcacgccggtactgtagtaggtaaacttgaaggagaacgagaagtcactctgggttttgttgatctactgcgtgatgattttattgaaagagaccgaagtcgtggtatttatttcactcaagattgggtatctatgccaggtgttctgcccgtagcttcggggggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattccgtactacagttcggcgggggaactttgggacacccttggggaaatgcacctggtgcagtagcgaatcgagtcgccttagaagcttgtgtacaagctcgtaatgagggacgtgatcttgctcgtgaaggtaatgaagtgatccgtgaagctagtaaatggagtcccg--------------------------------------------------
    Bowenia          gtcggatttaaagctggtgtt?aagattacagattaacttattacactcctgaatataaaactaaagataccgatatcttggcagcgttccgagtaactccccaacctggggtgcccgctgaggaagcgggggcagcagtagctgctgaatcttctactggtacatggaccactgtttggaccgatggacttaccagtctcgatcgttacaaggggcgatgctatgacattgagcccgttcctggggaagaaactcaatttattgcctatgtagcttaccccttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctacgagctctacgcctagaagatttgcgaattcctcctgcttattccaaaactttccaaggcccacctcatggtatccaagttgaaagagataaattaaacaaatatggccgtcccctattgggatgtactattaaaccaaaattgggtttatctgccaaaaactatggtagagcagtttacgaatgtcttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccatttatgcgctggagagatcgtttctgcttctgtgcagaagcaatttataaagctcaggctgagacgggtgaaattaagggacattacttgaatgctactgcaggtacatgtgaagaaatgataaaaagggcagtatttgccagagaattgggagttcctatcgtcatgcatgactacctgacgggaggttttactgcaaataccaccttggctcattattgccgagacaatggcctacttcttcacattcaccgcgcaatgcatgcagttattgacagacaaagaaatcatggtatgcacttccgtgtactagctaaagcattgcgcatgtccggtggagatcatattcacgccggtactgtagtaggtaaacttgaaggagaacgagaagtcactttgggttttgttgatctactgcgtgatgattttattgaaaaagaccgaagtcgtggtatttatttcactcaagattgggtatctatgccaggtgttctgcccgtagcttcggggggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattccgtactacagttcggcgggggaactttgggacacccttggggaaatgcacctggtgcagtagcgaatcgagtcgccttagaagcttgtgtacaagctcgcaatgagggacgtgatcttgctcgtgaaggtaatgaagtgatccgtgaagctagtaaatggagtcccgagcta?ctgctgcc------------------------------------
    Ceratozamia      gtcggatttaaagctggtgttaaagattacagattaacttattacactcctgaatataaaaccaaagataccgatattttggcagcgttccgagtaactccccaacctggggtgccacctgaggaagcgggggctgcagtagctgctgaatcttccactggtacatggaccactgtttggaccgatggacttaccagtctcgatcgttacaaggggcgatgctatgacatcgagcccgttcctggggaagagactcaatttattgcctatgtagcttaccccttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctacgagctctacgtctagaagatttgcgagttcctcctgcttattccaaaactttccaaggtccacctcatggtatccaagttgaaagagataaattaaacaaatatggacgtcccctattgggatgtaccattaaaccaaaattgggtttatctgccaaaaactatggtagagcagtttacgaatgtcttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccatttatgcgctggagagatcgtttctgcttctgtgcagaagcaatttataaagctcaggctgagacgggtgaaattaagggacattacttgaatgctactgcaggtacatgtgaagaaatgataaaaagggcagtatttgccagagaattgggagctcctatcgtcatgcatgactacctgacgggaggttttactgcaaataccagcttggctcattattgtcgagacaatggcttacttcttcacattcaccgcgc?atgcatgcagttattgacagacaaagaaatcatggtatgcacttccgtgtactagctaaagcattgcgcatgtccggtggagatcatattcacgccggtactgtagtaggtaaacttgaaggagaacgagaagtcactttgggttt?gt?gatctactgcgtgatgattttattgaaagagaccgaagtcgtggtatttatttcactcaagattgggtatctatgccaggtgttctgcccgtagcttcggggggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattccgtactacagttcggcgggggaactt?gggacacccttggggaaatgcacctggtgcagtagcgaatcgagtcgccttagaagcttgtgtacaagctcgtaatgagggacgtgatcttgctcgtgaaggtaatgaagtgatccgtgaagctagtaaatggagtcccgagctagctgctgct------------------------------------
    Dioon            gtcggatttaaagctggtgttaaagattacagattaacttattacactcctgaatatgaaaccaaagataccgatatcttggcagcgttccgagtaactccccaacctggggtgccacctgaggaagcgggggctgcagtagctgctgaatcttccactggtacatggaccactgtttggaccgatggacttaccagtctcgatcgttacaaggggcgatgctatgacatcgagcccgttcctggggaagaaactcaatttattgcctatgtagcttaccccttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctacgagctctacgtctagaagatttgcgaattcctcctgcttattccaaaacttcccaaggtccacctcatggtatccaagttgaaagagataaattaaacaaatatggtcgtcccctattgggatgtaccattaaaccaaaattggggttatctgccaaaaactatggtagagcagtttacgagtgtcttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccatttatgcgctggagagatcgtttctgcttctgtgcagaagcaatttacaaagctcaggctgagacgggtgagattaagggacattacttgaatgctactgcaggtacatgtgaagaaatgataaaaagggcagtatttgccagagaattgggagttcctatcgtcatgcatgactacctgacgggaggttttactgcaaataccagcttggctcattattgccgagacaatggcctgcttcttcacattcaccgcgcaatgcatgcagttattgacagacaaagaattcatggtatgcacttccgtgtgctagctaaagcattgcgcatgtccggtggagatcatattcacgccggtactgtagtaggtaaacttgaaggagaacgagaagtcactttgggttttgttgatctactgcgtgatgattttattgaaagagaccgaagtcgtggtatttatttcactcaagattgggtatctatgccaggtgttctgcccgtagcttcggggggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattccgtactacagttcggcgggggaactttgggacacccctggggaaatgcacctggtgcagtagcgaatcgagtcgccttagaagcttgtgtacaagctcgtaatgagggacgtgatcttgctcgtgaaggtaatgaagtgatccgtgaagctagtaaatggagtcccgagctagctgctgcttgtgaagtatggaaggagatcaaatttgaatttga-
    Chigua           gtcggatttaaagctggtgttaaagattacagaataacttattacactcctgactatgaaaccaaagataccgatatcttggcagcgttccgagtaactcctcaacctggggtgcccgctgaggaagcgggggctgcagtagctgctgaatcttccactggtacatggaccactgtttggaccgatggacttaccagtcttgatcgttacaaggggcgatgctatgacatcgagcccgttcctggggaagagactcaatttattgcctatgtagcgtaccctttagacctctttgaagaaggttctgttactaacatgttcacttccattgtaggtaatgtatttggattcaaagccctacgagctatacgcctagaagatttgcgaattcctcctgcttattccaaaactttccaaggtccacctcatggtatccaagttgaaagagataagttaaacaaatatggccgtcccctattgggatgtaccattaaaccaaaattgggtttatctgccaaaaactatggtagagcagtttacgaatgccttcgtggtggacttgattttaccaaagatgatgagaacgtaaattcccaaccatttatgcgctggagagatcgtttctgcttctgtgcagaagcactttataaagctcaggctgagacgggtgaaattaagggacattacttgaatgctaccgcaggtacatgtgaagaaatgataaaaagggctgtatttgccagagaattgggagttcctatcgtcatgcatgactacctgacgggaggttttactgcgaataccagcttggctcattattgccgagataatggcctacttcttcacattcaccgcgcaatgcatgcagttattgacagacaaagaaatcatggtatgcacttccgtgtactagctaaagcattgcgcatgtccggtggagatcatgttcacgccggtactgtagtaggtaaacttgaaggtgaacgagaagtcactttgggttttgttgatctattgcgtgatgattttattgaaagagaccgaagtcgcggtatttatttcactcaagattgggtatctatgccaggtgttctgcccgtagcttcggggggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattccgtactacagttcggcgggggaactttgggacacccttggggaaatgcacctggtgcagcagcgaatcgagtcgccttagaagcttgtgtacaagctcgtaatgaaggacgtgatcttgctcgtgaaggtaatgaagtgatccgtgaagctagtaaatggagccccgagctagctgctgcttgtgaagtatggaaggagatcaaatttgaatttgat
    Ephedra          ---ggatttaaagctggtgttaaagattatagattaacttattatactccagagtatcagactaagaacactgatatcttggcagcattccgagtaactcctcaacccggagtaccgcccgaggaagcaggcgcagcggtagctgctgaatcttctacaggtacatggaccacagtttggactgatggtcttactagtcttgatcgttacaaaggacgatgctatgatatcgaacctgttccgggagaagacaatcaatttattgcttatgtagcatatcctttggacctttttgaagaaggttctgttactaacatgtttacttctattgtggggaatgtttttggttttaaagctctacgagctctacgcctagaagatttgcgaattcctcctgcttatatcaaaacatttcaaggtccacctcatgggatccaagtagaaagagataaattaaacaaatacggacgtcctttgttgggatgtaccatcaaacctaaattaggtctatctgctaaaaattacggtagagcagtttatgaatgtcttcgtggcggactagattttactaaagatgatgaaaatgtaaattctcaaccctttatgcgttggagagatcgctttgttttttgcgcggaagctatttataaagctcaagctgaaacaggtgaaattaagggacattacttaaatgctactgcgggtacatgtgaagaaatgataaaaagagcagtattcgcaagagaattaggggttccgattgttatgcatgattatttaacaggaggtttcactgcaaataccactttagctcattattgccgagataatggcttacttcttcatattcatcgtgcaatgcatgcagttattgatagacaaaaaaatcatggtatgcacttccgtgtactggctaaagcattacgaatgtccggtggagatcatattcatgccggtactgtcgtaggtaaacttgaaggagaacgagaaattactttaggttttgtggatttacttcgtgatgactttattgaaaaagatcgaagtcgtggtatttatttcacgcaagattgggtatctatgccaggtgttctgcctgttgcttcaggaggtattcatgtttggcatatgcctgctttgaccgatatctttggagatgacgctgtattacaatttggtggaggaaccttaggacatccttggggaaatgcacccggtgccgtagctaatcgggttgctttagaagcttgtgtccaagctcgtaatgaaggacgtgatcttgctcgtgaggggaatgaagtaattcgtgaagcttgtaagtggagtcctgaactagctgctgcttgt---------------------------------
    Gnetum           gtaggattccaagctggtgttaaagattatagattaacttattatactccggaatatcagactaaggatactgatatcttggcagcattccgagtaacaccacagcccggagtaccgcctgaggaagcaggagcagctgtagctgctgaatcctccaccggtacatggaccactgtgtggactgatggacttaccagtcttgatcggtacaaaggacgatgctacgaccttgagcctgttcctggagaagaaaatcaatttattgcttatgtggcgtatcctttggaccttttcgaagagggttccgtgactaacatgtttacttccattgtaggaaacgtttttggattcaaagctctacgggctttacgcctggaagacttacggattcctcctgcttatacaaaaacatttcaagggccccctcacggtatccaagttgaaagagataaattaaacaaatatggacgtcctttattggggtgtactatcaagcctaagttaggtctatcggccaaaaactacggtagagccgtttatgaatgtcttcgtggtgggcttgattttactaaagatgatgaaaacgtcaattctcaaccattcatgcgctggagagaccgctttgttttttgcgcggaagctattaataaagctcaagctgaaacaggcgaaattaaagggcattatttaaatgctactgcaggtacatgcgaggaaatgatcaaaagggcagtatttgcaagagaattaggagttcctattgtcatgcatgactatctgacaggaggttttaccgcgaataccagcttggctcattattgccgagataacggcttacttcttcacattcaccgcgcaatgcatgcagttattgatagacaaaaaaatcatggtatgcatttccgtgtactggctaaagcgttgcgcttgtccggcggggatcacgttcatgctggtactgtagttggtaaacttgaaggagaacgagaaatcactttaggttttgtggatttacttcgcgatgattttgttgaaaaagaccgaagtcgtggtatttatttcacccaagattgggtatctacgccgggcgtcctgcctgtagcttcgggaggtattcatgtttggcatatgccagctctaactgacatttttggagatgatgcagtactccaatttggtggaggaaccttgggacatccttgggggaatgcacccggtgctgtagctaatcgagttgctctagaggcttgtatacaggctcgtaatgaagggcgtgatcttgttcgtgaaggtaatgaagtgatccgcgaagctagtaaatggagtcctgaactagctgctgcttgtgaag-----------------------------
    Welwitschia      gtaggattccaagctggtgttaaagattatagattaacttattatactccggaatatcagactaaggacactgatatcttggcagcattccgagtaacccctcaacctggggtaccgcctgaggaagcgggagcagcagtagccgctgaatcttctactggtacatggaccacggtgtggactgatggacttacgagtctcgatcgttacaaaggacgatgctacgaccttgaacctgttcctggagaggacaatcaatatattgcttatgtagcatatcccctggacctgtttgaagaaggttctgtgactaacatgtttacttccattgttgggaacgtttttggattcaaagctctacgtgctttacgcctggaagatttgcgaattcctacttcttatataaaaacttttcaaggaccaccccacggtatccaggtggaaagagataaattaaacaaatacggacgtcccttattgggttgtactatcaaacctaaattaggtctatcagctaaaaactatggtagagctgtttatgaatgtcttcgtgggggacttgattttactaaggatgatgaaaacgtcaattctcaaccattcatgcgctggagagatcgtttcgttttctgtgcagaagcaatttataaagctcaagctgaaacaggtgaaattaaaggacattatttgaatgctactgcgggtacatgtgaggaaatgatcaaaagggcagtattcgcgagagaattaggagttcctattgtcatgcatgattatttaacaggaggttttactgcaaatactaccttggctcattactgccgggataatggcttacttcttcacattcaccgtgcaatgcatgcagttattgatagacaaaaaaatcatggtatgcatttccgtgtactggctaaagcattacgaatgtccggtggggatcatattcatgctggtactgtagtaggtaaacttgaaggagaacgagaaatcactttaggttttgtggatttactgcgcgatgactttattgaaaaagaccggagtcgtggtatttatttcactcaagattgggtatctatgccaggtgtcatgcccgtagcttcgggaggtattcacgtttggcatatgccagctctgaccgatatttttggagatgatgctgtactacaatttggtggaggaactttaggacacccttggggaaatgcaccaggtgctgtagctaatcgagtcgctttagaagcttgtgtgcaggctcgtaacgaggggcgcgatcttgctcgtgaagggaatgaagtaatccgcgaagcagctaaatggagtcctgaactagctgctgcgtgtgaagtctggaaggagatcaagtttgaatttgag
    Athrotaxis       GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGACTATCAGGTAAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTACCCCCCGAAGAAGCGGGA???GCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATTCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTTAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACAGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATTTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATAAAATTTGAATTTGAT
    Austrocedrus     GTTGGATTCAAAGCGGGTGTTAAAAATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCTACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTACGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTTACTTCGATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTTTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGACCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTTCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAAACGGGTGAGATTAAGGGGCATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTGCTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTACCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAGTA---------------------------
    Callitris        -----------------------AGATTACAGATTAACTTATTATACTCCCGAATATCCGACCAAAGATACTGATATCTTAGCAGCCTTCCGCGTCACTCCCCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCGGCCGAGTCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTCGATCGTTACAAGGGGCGATGTTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCTTATGTAGCCTATCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTTTTTACTTCTATTGTCGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTTCTTATTCAAAAACTTTTCAAGGACCCCCACACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTAGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTGGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCGGAAGCACTTTATAAAGCTCAAGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCGGGGACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCACTATTGCCGCGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTTGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATTTATTGCGTGATGATTTTATTCAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGAGGGATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCGGGTGCAGTGGCCAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGGCGCGACCTTGCGCGTGAAGGTAAT------------------------------------------------------------------------------------
    Callitropsis     --------CAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCGGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGCCTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAGCCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTG--------------------------------------------------------------------------------------------
    Chamaecyparis    --------CAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGGGCGGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGGACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGTCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAGGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTG--------------------------------------------------------------------------------------------
    Calocedrus       --------CAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAATATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGGAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTG--------------------------------------------------------------------------------------------
    Cupressus        ------TTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCGGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGCCTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAGCCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGTCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTGGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTA--------------------------------------------------------------------------------------
    Cryptomeria      GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTAGCAGCATTCCGAGTCACTCCTCAACCTGGAGTACCCCCCGAAGAAGCGGGAGCAGCAGTAGCCGCCGAATCTTCCACTGGTACGTGGACGACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTGGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGGATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATAAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGGGAAGTGACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTCGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATCAAGTGATCCGCGAAGCTACTAAATGGAGCCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGAT
    Cunninghamia     GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTACCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACATGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACAAGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACTGGAGGTTTTACGTCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATACACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCACGTGAAGGTAACGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGAT
    Diselma          -----------------TGTTAAAGATTATAGTTTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGGGTGCCCCCCGAAGAAGCGGGAGC?GCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGGTACAAGGGGCGATGCTATGATATCGAACCCGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAGCTTTTCAAGGACCACCACACG??AT?CA?GTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGAACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGGAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCGCGTGAAGGTAATGAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGAT
    Fokienia         -------------------------------GATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCGGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGCCTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAGCCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAATTCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACT----------------------------------------------
    Glyptostrobus    GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTAGCAGCATTCCGAGTCACTCCTCAACCTGGAGTACCCCCCGAAGAAGCGGGA???GCAGTAGCCGCCGAATCTTCCACTGGTACGTGGACGACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTGCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTGACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATAAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTAACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGCCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGAT
    Juniperus        --------CAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCGGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGCCTTACTAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTATTGGGATGTACTATTAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAGCCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAATTCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTG--------------------------------------------------------------------------------------------
    Libocedrus       GTTGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCAGGAGCAGCAGTAGCTGCCGAATCGTCCACTGGTACGTGGACGACTGTTTGGACCGATGGACTTACTAGTCTTGATCGTTACAAGGGACGATGCTATGATATTGAACCGATTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTTACTTCTAT?GTAGGTAA?GTATTTGGATTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGACCACCGCACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCTAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAAGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTTTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGAC?TTGCGCGTGAAGGTAATGAAGTGATCC?CGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTCAATTTGAT
    Metasequoia      GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATGCAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCGCAGCCTGGAGTACCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCGACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCCTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGCTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGACCACCACATGGTATTCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTTTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCCCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTA---------------------------------------------
    Microbiota       GTCGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTAGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTATGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTTATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGAT
    Neocallitris     GTTGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCCGAATATCCGACCAAAGATACTGATATCTTAGCAGCCTTCCGCGTCACTCCCCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGCAGCGGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTCGATCGTTACAAGGGGCGATGTTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGTTTATGTAGCCTATCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTTTTTACTTCTATTGTCGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTTCTTATTCAAAAACTTTTCAAGGACCCCCACACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTAGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGC?TTTGTGCAGAAGCAATTTATAAAGCTCAAGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCGGG?ACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCACTATTTCCGCGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTCCGTG??CTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTTGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATTTATTGCGTGATGATTTTATTCAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTATGCCTGTAGCTTCAGGAGGGATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCGGGTGCAGTGGCCAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGGCGCGACCTTCCGGTTGAAGGTAATGAAGTGA?CC--------------------------------------------------------------------------
    Papuacedrus      GTTGGGTTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACTAAAGATACTGATATCCTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAACGCAATTTATTGCGTATGTAGCTTATCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTTACCTCTATTGTAGGAAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGACCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTAGGTCTATCTGCCAAAAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGGCATTACCTGAATGCTACTGCAGGTACATGGGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACGGTTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAATA---------------------------
    Pilgerodendron   GTTGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCAGGAGCAGCAGTAGCTGCCGAATCGTCCACTGGTACGTGGACGACTGTTTGGACCGATGGACTTACTAGTCTTGATCGTTACAAGGGACGATGCTATGATATTGAACCGATTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGACCACCACACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTAGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAAGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTTTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATAAAGGACGTGACCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCTTGTGAAGTA---------------------------
    Platycladus      GTC?GATTCAAAGCGGGTGTTAAAGGTTACAGATTAAATTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGACGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAAGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAGGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGGGATAAATTAAATAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCGACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCRGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGAGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGCGAAGTATGGAAGGAAATCAAATTTGAATTTGAT
    Sequoia          GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATGTGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTACCCCCCGAAGAAGCGGGA???GCAGTAGCTGCCGAATCTTCGACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCCTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGACCACCACATGGTATTCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGGGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCCCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGAT
    Sequoiadendron_  ----GATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATGTGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCACCT?GGAGTACCCCCC??????CGGGAAGCAGCAGTAGCTGCCGAATCTTCGACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGCCGATGCTACGATATTGAACCCGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTATCCCTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGACCACCACATGGTATTCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACGTGTGAAGAAATGATGAAAAGAGCGGTATTCGCCAGAGAATTGGGAGTTCCTATCATCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAG?GGCTAATCGAGTCGCTTTA?AA?CTTGTGT?CAAGCTC?TAATGAA?GAC?TGATCTTGCGC?TGAAGGTAATGAAGTGATCCGAGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAATATGGAAAGAAATCAAATTTGAATTTGAT
    Taiwania         GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGGGTCACTCCCCAACCCGGAGTACCCCCCGAAGAAGCGGGACAGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACTAGTCTTGATCGTTATAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGTCCACCACATGGTATTCAAGTGGAAAGAGACAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCGGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGCGCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTCTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAAGAAATCAAATTTGAATTTGAT
    Taxodium         gtcggattcaaagctggtgttaaagattacagattaacttattatactccggaatatcagaccaaagatactgatatcttagcagcattccgagtcactcctcaacctggagtaccccccgaagaagcgggagcagcagtagccgccgaatcttccactggtacgtggacgactgtttggaccgatggacttaccagtcttgatcgttacaaggggcgatgctatgatattgaaccccttcctggagaggaaagtcaatttattgcctatgtagcttaccctttagatctttttgaagaaggttctgttactaacctgttcacttctattgtaggtaatgtatttggattcaaagccttacgggctctacgtctggaagatttacgaattcctcctgcttattcaaaaactttccaaggcccaccacatggtattcaagtagaaagagataaattaaacaaatatggtcgtcctttgttgggatgtactataaaaccaaaattgggtctatctgccaagaattatggtagagcggtttatgaatgtctccgtggtggacttgattttaccaaggatgatgaaaacgtgaattcccaaccatttatgcgctggagagatcgtttctgcttttgtgcagaagcaatttataaagctcaggctgagacgggtgagattaagggacattacctgaatgctactgcaggtacatgtgaagaaatgatgaaaagagcaatattcgccagagaattgggagttcctatagtcatgcatgactatctgactggaggttttacggcaaatacttcgttggctcattattgccgagataacggcctacttcttcacattcaccgcgcaatgcatgcagttattgatagacaaagaattcatggtatgcacttccgtgtactggctaaagcactacgtatgtctggtggagatcatattcacgctggtactgtagtaggtaaacttgaaggagaacgagaagtcactttgggttttgttgatctattgcgtgatgattttattgaaaaagaccgaagtcgtggtatttatttcactcaagattgggtctctatgccgggtgtcctgcctgtagcttcaggaggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattccgtattacagtttggtggagggactttggggcacccttggggaaatgcacctggtgcagtggctaatcgggtcgctttagaagcttgtgtacaagctcgtaatgaaggacgtgatcttgcgcgtgaaggtaatgaagtgatccgcgaagctactaaatggagccctgaactagctgccgcttgtgaagtatggaaagaaatcaaatttgaatttgat
    Tetraclinis      GTCGGATTCAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCTTCGAAGAAGCAGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTGCTGGAGAAGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTGACTAACATGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATCGTAGAGCGGTTTATGAAGGTCTCCGTGGTGGACTGGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCAYTATTGCCGCGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTAGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTCAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTCCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGAT
    Thujopsis        GTCGGATTCAAAGCGGGTGTTAAAG?TTACAGATTAACTT??TATACTCCGGAGTATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGCTGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGAGGTATCCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGGCGTGATCTTGCGCGTGAAGGTAATGAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAACTAGCTGCCGCTTGTGAAGTATGGAAGGAAATCAAATTTGAATTTGAT
    Thuja            --------CAAAGCGGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAGTATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGGGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGCTACAAGGGGCGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTGACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGCCCACCACATGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATAAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATCTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCACGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTAGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGGCGTGATCTTGCGCGTG--------------------------------------------------------------------------------------------
    Widdringtonia    GTTGGATTCAAAGCGGGTGTTAAAGATTATAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGGGTGCCCCCCGAAGAAGCGGGAGCAGCTGTAGCTGCCGAATCCTCCACTGGTACGTGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGGTACAAGGGGCGATGCTATGATATCGAACCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTTACTTCTATTGTAGGTAATGTATTTGGGTTCAAAGCTTTACGGGCTCTACGCCTGGAAGATTTACGAATTCCTCCTGCTTATTCAAAAACTTTTCAAGGACCACCACACGGTATTCAAGTAGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTATGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAAACGGGTGAGATTAAGGGACATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATTAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCATGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTATATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTTCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAATTTGGTGGAGGAACTTTGGGGCATCCTTGGGGAAATGCACCTGGTGCAGTGGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGACCTTGCGCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGCT------------------------------------
    Xanthocyparis    --------caaagcgggtgttaaagattacagattaacttattatactccggaatatcagaccaaagatactgatatcttggcagcattccgagtcactcctcaacctggagtgccccccgaagaagcgggagcagcggtagctgccgaatcttccactggtacgtggaccactgtttggaccgatggccttaccagtcttgatcgctacaaggggcgatgctatgatattgaacccgttcctggagaagaaactcaatttattgcctatgtagcttaccctttagacctttttgaagaaggctctgtgactaacctgtttacttctattgtaggtaatgtatttggattcaaagctttacgggctctacgtctggaagatttacgaattcctcctgcttattcaaaaacttttcaaggcccaccacatggtattcaagtagaaagagataaattaaacaaatatggtcgtcctttattgggatgtactatcaaaccaaaattgggtctatctgccaagaattatggtagagcggtttatgaatgtctccgtggtggacttgattttaccaaggatgatgaaaacgtgaattcccagccatttatgcgctggagagatcgtttctgcttttgtgcagaagcactttataaagctcaggctgagacgggtgagattaagggacattatctgaatgcgactgcaggtacatgtgaagaaatgatgaaaagagcagtattcgccagagaattgggagttcctatagtcatgcatgactatctgactggaggttttacggcaaatacttcgttggctcattattgccgagataacggcctacttcttcacattcaccgcgcaatgcacgcagttattgacagacaaagaaatcatggtatgcacttccgtgtactggctaaagcactacgtatgtctggtggagatcatattcatgctggtactgtagtaggtaaacttgaaggagaacgagaagtcactttgggttttgttgatctattgcgtgatgattttattgaaaaagaccgaagtcgtggtatttatttcactcaagattgggtctctatgccgggtgttctgcctgaagcttcaggaggtattcacgtttggcatatgcctgctctgaccgagatctttggagatgattccgtattacagtttggtggagggactttggggcacccttggggaaatgcacctggtgcagtggctaatcgggtcgctttagaagcttgtgtacaagctcgtaatgaaggacgtgatcttgcgcgtg--------------------------------------------------------------------------------------------
    Agathis          GTTGGATTTAAAGCTGGTGTTAAAGATTATAGATTAACTTATTATACTCCGGAATATCAGACCAAAGACACTGATATCTTGGCAGCATTCCGAGTTACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCAGCAGTAGCGGCTGAATCTTCCACCGGTACATGGACAACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACCTGTTCACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCCAAAACTTTCCAGGGTCCACCCCATGGTATTCAAGTTGAAAGAGATAAATTAAACAAATATGGCCGTCCCTTGTTGGGGTGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTTTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCAGAGACGGGTGAAATTAAGGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAATGTTCGCCTATGAATTGGGAGTTCCCATAGTCATGCATGACTATCTGACGGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGACCATGGCCTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAAAATTCATGGTATGCACTTTCGTGTGCTGGCTAAAGCATTGCGTATGTCTGGCGGAGATCATGTTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGTGAACGAGAAGTCACTTTAGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTGTTTATTTTACTCAAGATTGGGTATCTATGCCAGGTGTTTTGCCTGTAGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGGGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGATATTATCCGTGAAGCAGCTAA-------------------------------------------------------------
    Araucaria        GTTGGATTTAAAGCTGGTGTTAAAGATTATAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCAGCAGTAGCGGCTGAATCTTCTACCGGTACATGGACAACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACCTGTTCACTTCCATTGTGGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATTCAAGTTGAAAGAGATAAATTAAACAAATATGGCCGTCCCTTGTTGGGGTGTACTATAAAACCAAAATTGGGTCTATCTGCCAAAAATTATGGTAGAGCAGTTTATGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCGGAGACGGGTGAAATTAAGGGGCATTACTTGAATGCTACCGCAGGTACATGTGAAGAAATGATGAAAAGAGCAAGTTTCGCCTATGAATTGGGAGTTCCCATCGTCATGCATGACTATCTGACGGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGACCATGGCCTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAAAATTCATGGTATGCACTTTCGTGTGCTGGCTAAAGCATTGCGTATGTCTGGTGGAGATCATGTTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGTGAACGAGAAGTCACTTTAGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTTACTCAAGATTGGGTATCTATGCCAGGTGTTTTGCCTGTAGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGAGGTAGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATCCGTGAAGCAACTAAATGGAGTCCTGAACTAGCTGCTGC-------------------------------------
    Wollemia         GTTGGATTTAAAGCTGGTGTTAAAGATTATAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCAGCAGTAGCGGCTGAATCTTCCACCGGTACATGGACAACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATTCAAGTTGAAAGAGATAAATTAAACAAATATGGCCGTCCCTTGTTGGGGTGTACTATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAGAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCGGAGACGGGTGAAATTAAGGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAAATTTCGCCTATGAATTGGGAGTTCCCATAGTCATGCATGACTATCTGACGGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGACCATGGCCTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAAAATTCATGGTATGCACTTTCGTGTGCTGGCTAAAGCATTGCGTATGTCTGGCGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGTGAACGAGAAGTCACTTTAGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTTACTCAAGATTGGGTATCTATGCCAGGTGTTTTGCCTGTAGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGGGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTGAAGGTAATGAGATTATCCGTGAAGCAGCTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCACATTTGTATTTGAT
    Torreya          GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGACTATGATACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGACGATGCTATGATATCGAGCCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTGACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCATTGTTGGGATGTACTATCAAACCAAAATTGGGCTTATCCGCCAAGAATTATGGTAGAGCGGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTGTTTTTGTGCAGAAGCAATTTATAAGTCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACGGCAAATACTACGTTAGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGACAGACAAAAAAATCATGGTATGCACTTCCGTGTGCTAGCTAAAGCACTGCGTATGTCTGGTGGAGATCATATTCACGCTGGTACGGTAGTAGGTAAACTTGAAGGAGAACGAGAGATCACTTTAGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCAGGTGTCTTGCCTGTAGCTTCAGGAGGCATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCTTTA?AAGCTTGTGTACAAGCGCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATTAGCGAAGCAGCTAAATGGAGTCCTGAACTAGCTGCTGCT------------------------------------
    Taxus            GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCACAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCGGGAGTGCCCCCCGAGGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGACGATGCTATGATATCGAACCCGTTGCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGATCTTTTTGAAGAAGGTTCTGTGACTAACCTGTTCACTTCCATTGTAGGTAATGTCTTTGGATTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGCTGGGATGTACTATAAAACCAAAATTGGGCCTATCTGCCAAAAATTATGGTAGAGCCGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATTTGACTGGAGGTTTCACGGCAAATACTTCGTTGGCTCATTATTGTCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATACATTTCCGTGTACTAGCTAAAGCACTGCGTATGTCTGGTGGAGACCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTTGATTTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGCACTTTGGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTCGCATTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTCGCTCGTGAAGGTAATGAAGTGATCCGCGAACGTACTAAAT-----------------------------------------------------------
    Amentotaxus      GTTGGCTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCAGAATATAAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGACGATGCTATGATATTGAGCCCGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGACAAATTAAACAAATATGGTCGTTCTTTGTTGGGATGTACTATCAAACCAAAATTGGGCCTATCTGCCAAAAATTATGGTAGAGCGGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTGTTTTTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTTATGCATGACTATTTGACTGGAGGTTTTACAGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTGCTGGCTAAAGCACTGCGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTCTAGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACCCAAGATTGGGTCTCTATGCCAGGTGTCTTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGGACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTCGCTTTAGAAGCCTGTGTGCAAGCTCGTAATGAAGG-------------------------------------------------------------------------------------------------------------
    Pseudotaxus      GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCAGGAGTGCCTCCCGAGGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGACGATGTTATGATATCGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCTTTAGATCTTTTCGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAACGTATTTGGATTTAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCAAAAACCTTCCAAGGACCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGCTGGGATGTACTATCAAACCAAAGTTGGGCCTATCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAATCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTTATGCATGACTATTTGACTGGAGGTTTTACGGCGAATACTTCGTTGGCTCATTATTGCCGAGACAACGGACTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGACAGACAAAAAAATCATGGTATGCATTTCCGTGTACTAGCTAAAGCGCTGCGTATGTCTGGTGGAGACCATGTTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGCGAAGTAACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCTTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAGTTTGGTGGAGGGACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTCGCATTAGAAGCTTGTGTACAAGCTCGTAACGAAGGACGTGATCTCGCTCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCTGC-------------------------------------
    Austrotaxus      GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCCGCCCAAAGACACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCGGGAGTGCCCCCCGAAGAAGCGGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAAGGACGATGTTATGATATCGAACCCGTTCCTGGAGAGGAAAATCAATATATTGCCTATGTAGCTTACCCATTAGATCTTTTCGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCTCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGTCCACCACATGGTATCCAAGTGGAAAGAGATAAATTAAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGCCTATCTGCCAAAAATTATGGTAGAGCGGTTTACGAATGTCTTCGTGGTGGACTTGATTTTACCAAGGATGATGAAAACGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTGCTTTTGTGCAGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACTTGAATGCTACTGCAGGTACGTGTGAAGAAATGATAAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGTCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAAAAATCATGGTATGCACTTCCGTGTGCTAGCTAAAGCACTGCGTATGTCTGGTGGAGATCATGTTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTGTCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGAGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAAATTTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGCACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTCGCATTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGCGAAGCTACTAAATGGAGTCCTGAATTAGCTGCCGC-------------------------------------
    Cephalotaxus     GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATAAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTGCCCCCTGAGGAAGCAGGAGCAGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACGAGTCTTGATCGTTACAAGGGACGATGCTATGATATTGAACCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGATCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGAGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGCCCACCACATGGTATCCAAGTGGAAAGAGATAAACTAAATAAATATGGTCGTCCTTTGTTGGGATGTACAATCAAACCAAAATTGGGTCTATCTGCCAAGAATTATGGTAGAGCGGTTTACGAATGTCTCCGCGGTGGACTTGATTTTACCAAGGATGATGAAAATGTGAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTCTGCTTCTGTGCAGAAGCACTTTATAAAGCTCAGGCTGAGACGGGTGAGATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTTCCTATAGTCATGCATGACTATTTGACTGGAGGTTTTACCGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTCCACATTCATCGTGCAATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCACTGCGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATCTATTGCGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTCTCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTTTGACCGAAATCTTTGGTGATGATTCTGTATTACAGTTTGGTGGAGGGACTTTGGGACACCCTTGGGGAAATGCACCAGGTGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGAGAAGCCACTAAATGGAGTCCTGAACTA---------------------------------------------
    Sciadopitys      GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACCCCTGAATATCAGACCAAAGACACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCTCCTGAGGAGGCAGGA???GCAGTAGCTGCCGAATCTTCCACTGGTACATGGACCACTGTTTGGACCGATGGACTCACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTATCCCTTAGATCTTTTTGAGGAAGGTTCTGTTACTAACATGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCAAAAACTTTCCAAGGTCCGCCCCATGGTATCCAAGTTGAAAGAGATAAATTAAACAAATATGGTCGCCCTTTATTGGGGTGTACTATCAAACCAAAATGTGGCCTATCTGCCAAAAATTATGGCAGAGCAGTTTACGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAATTCCCAACCATTCATGCGCTGGAGAGACCGTTTTTGCTTTTGTGCTGAAGCAATTTATAAAGCTCAAGCTGAAACGGGTGAAATTAAGGGACATTATTTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCAGTATTCGCCAGAGAATTGGGAGTCCCCATAGTCATGCATGACTATCTGACGGGAGGTTTTACGGCAAATACTTCGTTGTCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTCCGTGTGCTGGCTAAAGCACTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTTGATTTACTGCGTGATGATTTTATTGAAAAAGATCGAAGCCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTTTTGCCTGTGGCTTCAGGGGGTATTCACGTTTGGCATATGCCTGCTCTGACTGAGATCTTTGGGGACGATTCTGTATTACAGTTCGGTGGGGGAACTTTGGGGCATCCGTGGGGAAATGCGCCTGGTGCAGTAGCTAATCGAGTCGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGCGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTTGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCAAATTTGAATTTGAT
    Pinus            GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAGGATACAGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGGGTGCCACCTGAAGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTAGTCTCGATCGTTACAAGGGGCGATGCTATGATATCGAGCCCGTTCCTGGAGAGGAGACTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACTTTTCAGGGTCCACCTCATGGTATCCAGGTTGAAAGAGATAAATTGAACAAATATGGTCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCAGCCAAAAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTCGATTTTACTAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCAATTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTATTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGTAATATTTGCAAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGAGGTTTTACCGCAAATACTTCTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAATTCATGGTATGCATTTCCGGGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTAACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCT?CTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACATCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTTCTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAATATGGAAGGAGATCAAATTTGAATTTGAT
    Picea            GTCGGATTTAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATTTTGGCAGCATTCCGAGTAACTCCTCAACCAGGGGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACATTTCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCCAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCAATTTATAAAGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAATATTTGCAAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGAGGTTTTACCGCAAATACTTCTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTGATTGACAGACAAAAAAATCATGGTATGCACTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGAGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAATATGGAAGGAGATCAAATTTGAATTTGAG
    Cathaya          gtcggattcaaggctggtgttaaagattacagattaacttattatactcctgaatatcagaccaaagatacggatatcttggcagcattccgagtaactcctcaacccggggtgccgcccgaagaagcgggagcagcagtagctgctgaatcttccaccggtacatggaccactgtttggaccgatggacttactagtcttgatcgttacaaggggcgatgctatgacatcgagcccgttcctggagaggagagtcaatttattgcctatgtggcttaccctttagaccttttcgaagaaggctctgttactaatttgttcacttccattgtaggtaatgtatttggattcaaggccctacgggctctacgtttggaagatttgcggattccccctgcttattccaaaacttttcaaggtccacctcatggtatccaagttgaaagagataaattgaacaaatatggacgtcctttattgggatgtactatcaaaccaaaattgggtctatcagccaagaactatggtagagcagtttacgaatgtctccgcggtggactcgattttaccaaggatgatgagaacgtaaattcccaaccattcatgcgctggagagatcgttttgtcttttgtgcggaagcaattaataaggctcaggctgagacgggtgaaattaagggacattacttgaatgctactgcaggtacatgtgaagaaatgataaaaagggcagtatttgcaagagaattgggagttcctatcattatgcatgactatctgacgggaggttttactgcaaatacttctttggctcattattgccgagacaacggcctacttcttcacattcaccgcgcgatgcatgcagttattgacagacaaaaaattcatggtatgcatttccgtgtactggctaaagcattgcgtatgtccggcggagatcatattcacgccggtactgtagtaggtaaacttgaaggggaacgagacgtcactttagggtttgtggatctactgcgtgatgattttattgaaaaagatcgaagtcgtggtatttacttcactcaagattgggtatctatgccaggtgtcctgcccgtagcttcaggaggtattcacgtttggcatatgcctgctctgaccgaaatctttggggatgattccgtactacagtttggtgggggaactttggggcacccttggggaaatgcacctggtgcagtagctaatcgggttgctctagaagcttgtgtacaagctcgtaatgaaggacgtgatcttgctcgtgaaggtaatgaaattatccgggaagcttctaaatgg---------------------------------------------------------
    Larix            GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGGGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTAGTCTTGATCGTTACAAGGGACGATGCTATGACATCGAGGCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATCCCCCCTGCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTATCCAAGTCGAAAGGGATAAATTGAACAAATATGGCCGTCCTTTATTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCACTTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAGGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAGTATTTGCAAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGAGGTTTTACTGCAAATACTTCTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGCATGCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGACTGGGTATCTATGCCAGGTGTTCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGGCACCCTTGGGGAAATGCGCCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTACTAAATG----------------------------------------------------------
    Abies            GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCGGCATTCCGAGTAACTCCTCAACCTGGGGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCACTTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAGTATTTGCAAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATCTGACGGGGGGTTTTACCGCAAATACTACTTTGGCTCATTATTGCCGAGACAATGGTCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATCGACAGACAAAGAAATCATGGTATGCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTTCTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTACTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATTTGAT
    Tsuga            GTAGGGTTCAAAGCTGGTGTTAAGGATTATAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCGTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAACCCGTTCCTGGAGAAGAGAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTATTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACTTTTCAAGGTCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATACGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTATGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAACTCCCAACCATTCATGCGTTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCACTTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAGTATTTGCAAGAGAATTAGGAGTTCCTATCGTTATGCATGACTATCTGACGGGAGGTTTTACCGCAAATACTACTTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTTCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTAGGGTTTGTTGATCTACTGCGTGATAATTATATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTCGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTTGTTCGTGAAGCTTGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCAAATTTGAATTTGAT
    Nothotsuga       ------------GCTGGTGTTAAGGATTATAGACTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCGTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAACCCGTTCCTGGAGAAGAGAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTATTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGAGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACTTTTCAAGGTCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTATGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAACTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCACTTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAATATTTGCAAGAGAATTAGGAGTTCCTATCGTCATGCATGACTATCTGACGGGAGGTTTTACCGCAAATACTAGTTTGGCTCATTATTGCCGAGACAATGGCTTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCTTTTTCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGACGTCACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGCCGGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAATTATTCGTGAAGCTTCTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAATATGGAAGGAAATCAAATTTGAATTTGAT
    Cedrus           GTCGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGGGTGCCACCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACTAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAGGAGAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACATTTCAAGGTCCGCCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCTAAAAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCAATTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAGGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAGTCTTTGCAAGAGAATTGGGAGTTCCTATCGTCATGCATGACTATTTGACGGGAGGTTTTACCGCAAATACTAGTTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAATTCATGGTATGCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGATGTTACTTTAGGATTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTTTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCAAATTTGAATTTGAG
    Pseudolarix      GTCGGATTCAAAGCTGGTGTTAAAGATTACCGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGGGTGCCACCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATTGAGCCCGTTCCTGGAGAGGAGAGCCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTATCCAAGTTGAAAGAGATAAATTGAACAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCGGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTTGATTTTACCAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGAGATCGTTTTGTCTTTTGTGCGGAAGCAATTTATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAGATGATGAAAAGGGCAATATTTGCAAGAGAATTAGGAGTTCCTATCGTCATGCATGACTATCTGACGGGAGGTTTTACTGCAAATACTAGTTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGACGTCACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATCGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTTCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTCTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATG----------------------------------------------------------
    Keteleeria       GTCGGATTCAAAGCTGGTGTTAAAGATTATAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATCTTGGCGGCATTCCGAGTAACCCCTCAACCTGGGGTGCCGCCCGAGGAAGCGGGAGCAGCAGTAGCTGCTGAATCTTCCACCGGTACATGGACCACTGTTTGGACCGATGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCCGTTCCTGGAGAAGAAAGTCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTCGAAGAAGGTTCTGTTACTAACTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACTTTTCAAGGTCCACCTCATGGTACTCAAGTTGAAAGAGATAAATTGAACAAATATGGTCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTATCAGCTAAGAACTATGGTAGAGCAGTTTACGAATGTCTCCGTGGTGGACTCGATTTTACCAAGGATGATGAGAACGTAAATTCCCAACCATTCATGCGCTGGAGACATCGTTTTGTCTTTTGTGCGGAAGCACTTAATAAGGCTCAGGCTGAGACGGGTGAAATTAAAGGACATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCAATATTTGCAAGAGAATTAGGAGTTCCTATCGTCATGCATGACTATCTGACGGGGGGTTTTACTGCAAATACTAGTTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCGATGCATGCAGTTATTGACAGACAAAGAAATCATGGTATGCATTTCCGTGTACTGGCTAAAGCATTGCGTATGTCCGGTGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGGGAACGAGACGTCACTTTAGGGTTTGTTGATCTACTGCGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTACTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCCGTAGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCCGTACTACAGTTTGGTGGGGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTGTAGAAGCTTGTGTACAAGCTCGTAATGAAGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTGCTAAATG----------------------------------------------------------
    Phyllocladus     GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGGCTCACCAGCCTTGATCGTTACAAGGGGCGATGTTATGACATCGAGCCTGTTCCTGGAGAGGAAAATCAATATATTGTCTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTATTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAAGTTGAAAGAGATAAATTAAATAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTGTCCGCTAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGATGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCAGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCGGGTACATGCGAAGAAATGCTAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGTTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTATGCACTTTCGTGTACTGGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATTCACGCTGGTACGGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTCACTTTGGGTTTTGTGGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGCCGTGGTATTTATTTCACTCAAGACTGGGTATCTATGCCAGGTGTCCTGCCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTTGTAAATGGAGTCCCGAACTAGCTGCTGC-------------------------------------
    Lagarostrobus    GTTGGATTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGACTATCAGGTCGCAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTCACCAGCCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAAGTCAATATATTGTCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACTTGTTCACTTCGATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTACGAATTCCTCCTGCTTATTCCAATACTTTCCAAGGCCCACCCCATGGTATCCAGGTTGAAAGAGATAAATTAAATAAATATGGCCGTCCCTTGTTGGGATGTACCATCAAACCAAAATTGGGCCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGATGATGAGAACGTGAATTCCCAACCATTTATGCGCTGGAGAGATCGCTTCTGCTTTTGCGATGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAAGTTCATGTCAAGAAATGATTAAAACAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACGGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATTCACGCAGGTACTGTAGTAGGTAAACTTGAAGGAGAGGGAGAAGTAACTTTGGGTTTTGTTGATCTACTACGTGATAATTTTATTGAAAAAGACCGAAGCCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCTGTAGCTTCMGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTTTTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCCCCTGGTGCAGTAGCTAATCGGGTTGC----------------------------------------------------------------------------------------------------------------------------------------------
    Prumnopitys      GTTGGGTTCAAAGCTGGTGTTAAAGACTACAGATTAACTTATTATACTCCGGAATATCAGTCCCAAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCSGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGCCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAAATCAATATATTGTCTATGTAGCTTAMCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTTTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCARGTWGAAAGAGATAAATTAAATAAATATGGCCGTCCCTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTGTCCGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACMAAGGATGATGAGAATGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCAGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCCATCGTTATGCATGACTACTTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCATCGCGCAATGCATGCAGTTATCGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTGGCTAAAGCMTTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTAATACGTGATAATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCATACCTGTAGCTTCGGGGGGTATTCATGTTAAACATATGCATGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGCGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTGGTAAGCGGAGTCCCGAACTTG--------------------------------------------
    Dacrydium        GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGACACAGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTACCTCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGTCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCACATGGTATCCAGGTTGAAAGAGATAAATTAAATAAATATGGCCGCCCCCTATTGGGATGTACTATCAAACCAAAATTGGGTTTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAGGATGATGAGAACGTAAATTCTCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCAATTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCAGTATTCGCTAGAGAATTGGGGGTTCCTATCATTATGCATGACTATCTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTAGCGAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTTTCTATGCCAGGTGTCCTGCCTGTAGCTTCGGGAGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTTGTAAATGGAGT------------------------------------------------------
    Dacrycarp        GTTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCCAAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTTCCTTCCGAGGAAGCAGGAGCGGCAGTAGCTTCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGGCTTACCAGCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAACTCAATTTATTGTCTATGTGGCTTATCCCTTAGACCTTGGTGAAGAAGGTTCTGTTACTAACCTGTACACCTCTATTGTAGGTAATGTGGTTGGATACAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAGACTTTCCAGGGCCCACCCCATGGTATCCAGGTGGGAAGAGATAGATTAAATAAATATGGTCGCCCCCTATTGGGATGCACTATCAAACCAAAATTGGGCCTGTCTGCCAAGAATTATGGTAGAACAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAAGATGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTCTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATCAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTCACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAGAAAAATCATGGTATGCACTTTCGTGTACTAGCGAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTACTACAGTTTGGTGGAGGAACTTTGGGACACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGGCGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGCAAATGGAGTCCCGAACTAGCTGCTGCTTGTGAAGTATGGAAGGAGATCATATT----------
    Podocarpus       ---GGGTTCAAGGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAAATCAATATATTGTCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGGGCTCTACGTCTAGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCACATGGTATCCAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCTTATTGGGATGTACCATCAAACCAAAATTGGGCCTGTCTGCAAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAGGATGATGAGAATGTAAATTCCCAACCATTTATGCGCTGGAGAGAACGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACGGCGAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGGGATCATATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTACCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCACGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCCGAACT----------------------------------------------
    Nageia           GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAAGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACTTGGACTACTGTTTGGACCGATGGGCTTACCAGCCTCGATCGTTACAAGGGGCGATGCTATGGCATCGAGCCTATTCCTGGAGAGGAGAGTCAATTTATTGCCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTCCCAAGGTCCACCACATGGTATCCAGGTTGAAAGAGATAACTTAAATAAATATGGCCGCCCCTTATTGGGATGTACCATCAAACCAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTATTCGTGGTGGGCTTGATTTCACGAAGGATGATGAGAATGTAAATTCCAAACCAATTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGTGAAGAAATGATGAAAAGGGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACGGCGAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTCTTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCATGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCTTACCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGCAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGGTAGCAAATGGTGTCCAGACCTAGC-------------------------------------------
    Microstrobos     GTTGGGTTCAAAGCTGGTGTTAAAGGTTACAGATTAACTTATTATACTCCGGTATATCAGTCCAAAGGTACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGTAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGCCTTGATCGTTATAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACTCAATTTATTGCCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGCTCTGTTACTAATCTGTTCACTTCCATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCTTTATTGGGATGTACTAACAAACCAAAATTGGGACTGACTGCCAAAAATTATGGTAGAGCAGTTTACGAATGTCTACGTGGTGGACTTGATTTCACCAAGGATGATGAGAACGTAAATACGCAACCATTTATGCGCTGGAGAGAACGTTTTTGCTTCTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTACCTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCATACCTGTAGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTCACCGAAATATTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCCGAACG----------------------------------------------
    Microcachys      GTTGGGTGCCAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGTAGCAGGAGCGGCAGTATCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGGCTTACCAGCCTTGATCGTTACAAAGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAACCCAATATATTGCCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCCGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAAGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCTTATTGGGATGTACTATAAAACCAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGCCTACGTGGTGGACTTGATTTCACAAAGGATGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAACCACCTCATAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCGGGTACATGTGAAAAAATGATGAAAAGAGCGGTATTCGCTCGAAAATTGGGAGTTCCTATCATTATGCATGACTATCTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTGCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTACCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACCTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCTTGCCTGTAGCTTCTGGGGGTATTCATGTTTGGCATATGCCTGTTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGAGA----------------------------------------------------------------------
    Saxegothaea      GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGCCCAAAGATACTGATATCTTGGCGGCATTCCGAGTCACTGCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGACGGACTTACCAGTCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAAGTCAATTTATTGCTTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGCTCTGTTACTAACCTGTTCACTTCTATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAAGTCGAAAGAGATAAATTAAATAAATACGGCCGTCCTTTGCTGGGATGTACTATCAAACCAAAATTGGGTCTGTCTGCCAAAAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGATGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTTGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACTGCAAATACATCGTTGGCTCATTATTGCCGAGACAATGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAGAAATCACGGTATGCATTTTCGTGTACTGGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATCCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGACAAGTAACTTTAGGTTTTGTTGATCTACTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATCTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCTTGCCTGTGGCTTCAGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTTGTAAATGGAGTCTCGAACTGGCTGCTGCT------------------------------------
    Acmopyle         ----------AATCTGGCGTTAAAGATTACAKATTAACTTATTATACTCCTGAATATGCGGTCAAAGACACTGATATCTTGGCGGCATTCSGAGTCACWCCTCAACCCGGTGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACCGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAGGAAAGTCAATTTATTGCCTATGTAGCTTATCCCYTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACCTCAATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAARATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCGCCGCATGGTATCCAGTTTGAAAGAGATAAATTAAATWAATATGGCCGCCCCTTATTGGGATGTACTATCMAACCAAAATTGGGTCTGTCTGCCMAGAATTATGKTAGAGCAGTTTACGAATGTCTTCSTGGTGGACTTGATTYCAMGAAKGATGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGGGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACTGCGAAYACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTKATTGATAGACAAAGAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCAGATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAATAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTTTTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCTGTAGCTYCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGRATGATTCTGTATTACAGTTTGGTGGARGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCGAATCSGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGSCGTKATCTTGCTMGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCC---------------------------------------------------
    Falcatifolum     ------TTCAAAGCTGGTGTGCCAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGACACCGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTACCTCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGTCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAACTCAATTTATTGTCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCACATGGTATCCAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCCTATTGGGATGTACTATCAAACCAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGGGGTGGACTTGATTTCACGAAGGATGATGAGAATAT?????????????????????????????????????????????????????????????AAAGCTCACGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACTGCAGGTACATGTGAAGAAATGATAAAAAGAGCAGTATTCGCTAGAGAATTGGGGGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACGAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCACGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTTTCTATGCCAGGTGTCCTGCCTGTAGCTTCSGGGGGTATTCATGTTTGGCATATGCCCGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCGCCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTTGTATTTGGAGTGCCGAACTAG--------------------------------------------
    Manoao           GTTGGGTTCAAAGCTGGTGTTAAAGRTTACAGATTAACTTATTATACTCCTGACTATCAGGTCGCAGGTACTGATATCTTGGCAGCATTCSGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGGCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTYACCAGCCTTGATCGTTACAAGGGGMGATGCTATSACATCGAGCCTGTTCCTGGAGAGGAAAATCAATATATTGACTATGTAGCTTACCCCTTGGACCTTTTTGAAGAAGGTTCTGTTACTAATTTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCTTACGGGCTMTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAGTTTGAAAGAGATAAATTAAATAAATATGTCCTCCCCTTGTTGGGATGTACTATTAAACCCAAATTGGGTCCGTCTGCCAAGAATTATGTTAGAGCAGTTTACGAATGCCTTCGTGGTGGACTTGATTTCMCAAAGGATGATGAGAATGTWAATTCCCAACCATTTATGCGTTGGAGAGATCGCTTCTGCTTTTGCGCCGAAGCACTTTTTAAAGCTCATGCTGAAACAGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGCGAAGAAATGCTAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATTGTGATGCATGACTACTTGACGGGGGGTTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGATAACGGATTACTTCTTCATATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTATGCACTTTCGTGTACTGGCTAAAGCATTGCGTATGTCCGGGGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAGCGAGAAGTAACTTTGGGTTTTGTTGATCTATTACGTGATGATTTTATTGAAAAAGACCGAAGCCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCTGTAGCTTCAGGGGTTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGAGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTAGGGCACCCTTGGGGAAATGCACCTGGTGGAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTATTGAAGTGATCCGTGAAGCTAACAA-------------------------------------------------------------
    Lepidothamnus    GTCGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCCGACCAAAGATACTGATATCTTAGCGGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCTGTAGCTGCCGAATCTTCTACTGGTACATGGACTACTGTTTGGACCGATGGACTCACCAGCCTTGATCGTTACAAGGGGCGATGCTATGACATCGAGCCTGTTCCTGGAGAAGAAAATCAATATATTGTCTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTGACTAACCTGTTCACTTCTATTGTAGGTAATGTTTTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCTCATGGTATCCAGTTTGAAAGAGATAAATTAAATAAATACGGCCGCCCCTTGTTGGGTTGTACCATCAAACCAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGAGGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCAGAAGCACTTTTTAAAGCTCAGGCCGAAACGGGTGAAATTAAGGGGCATTACCTTAATGCTACCGCAAGTACATGTGAACAAATGATGAAAAGATCAGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGTGCAATGCATGCAGTTATTGATAGACAAAGAAATCATGGTATGCACTTTCGTGTACTGGCTAAAGCATTGCGTATGTCTGGGGGGGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTTGATCTACTACGTGATGATTMTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTGCCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATTTTTGGGGATGATTCTGTATTACAGTTCGGTGGAGGAACTGTGGGGCACCCTTGGGGAAATGCACCTGGGGCAGTAGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGAGACGAGATCTTGCACGTGAAGGTAATGAAGTGATCGGTGAAGCTGGCCAAGAGAGT------------------------------------------------------
    Halocarpus       GTAGGGTTCAAAGCTGGTGTTAAAGGTTACAGGTTAACTTATTATACTCCGGTATATCAGACCAAAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCTGGTGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGTCCGATGGCCTCACCAGCCTTGATCGTTACAAGGGGCGATGCTATGACATTGAGCCTGTTCCTGGAGTGGAAAATCAATTTATTGCCTATGTAGCTTACCCCCTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTTATTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAGGTTGAAAGAGATAAATTAAATAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAACCAAAATTGGGTCTCTCCGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCATGGTGGACTTGATTTCACGAAGGATGATGAGAACGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGATGAAATTAAGGGGCATTACCTGAATGCTACCGCGGGAACATGCGAAGAAATGATAAAAAGGGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGATTACTGCAAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTATGCACTTTCCTGTACTGGCTAAAGCGTTGCGTATGTCTGGTGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTGGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTTGACCTACTACGTGATGATTTTATTGAAAAAGATCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCGGGTGTCCTGCCTGTAGCTTCAGGGGGTATACATGTTTGGCATATGCCTGCTCTGACGGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCGGGTGCAGCCGCTAATCGGGTTGCTTTAGAAGCTTGTGTACAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGTAAATGGAGTCCCGAG------------------------------------------------
    Afrocarpus       GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCCGACCAAAGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGGCTTACCAGCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAAATCAATATATTGTCTATGTAGCTTATCCCTTAGACCTTTTKGAAGAAGGTTCTGTTACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATACAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCTTATTGGGATGTACCATCAAACCAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAGGATGATGAGAATGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAATTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGTGAAGAAATGATAAAAAGAGCGGTATTCGCTAGAGAATTGGGAGTTCCTATCGTTATGCATGACTACTTGACGGGGGGGTTTACGGCGAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCATGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGAATGGGTATCTATGCCAGGTGTCATACCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCCTTAGAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATGAAGTGATCCGTGAAGCTAGCAAATGGAGTCCCGAACT----------------------------------------------
    Retrophyllum     GCTGGGTTCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGAATATCAGACCAAAGATACTGATGTCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTAGCTGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTTACCAGCCTCGATCGTTACAAGGGGCGATGCTATGACATCGAACCTGTTCCTGGAGAGGAAAATCAATTTATTGTCTATGTAGCTTATCCCTTAGACCTTTTTGAAGAAGGTTCTGTCACTAACCTGTTCACCTCCATTGTAGGTAATGTTTTTGGATTCAAAGCTTTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAAACTTTCCAAGGTCCACCCCATGGTATCCAGGTGGAAAGAGATAAATTAAATAAATATGGCCGCCCCTTATTGGGATGTACCATCAAACCAAAATTGGGTCTGTCTGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACGAAGGATGATGAGAATGTAAATTCCCAACCATTTATGCGCTGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGATCCGGCTGAAACTGGTGAAATTAAAGGGCATTACCTGAATGCTACCGCAGGTACATGTGAACAAATGATAAAAAGAGCGGTATTCGCTATAGAATTGGGAGTTCCTATCGTTATGCATGACTATCTGACGGGGGGGTTTACGGCMAATACTTCGTTGGCTCATTATTGCCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATTGATAGACAAAAAAATCACGGTATGCACTTTCGTGTACTAGCTAAAGCGTTGCGTATGTCTGGGGGAGATCATATTCATGCCGGTACTGTAGTAGGTAAACTCGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTGGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCCTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCYTACCTGTAGCTTCGGGGGGTATTCATKTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTCGTGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGTAGCCAATCGGGTTGCTTTAGAAGCTTGTGTAGAAGCTAGTAATGAGGGACGAGATCTTGCTCGTGAAGGTGATGAAGTGATCCGTGAAGCTAGTGAACGGAGTCCAG--------------------------------------------------
    Sundacarpus      -------TCAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCGGACTATCAGACCCCCGATACTGATATCTTGGCGGCATTCCGAGTCACTCCTCAACCCGGAGTGCCCCCCGAGGAAGCAGGAGCGGCAGTATCCGCCGAATCTTCCACTGGTACATGGACTACTGTTTGGACCGATGGACTCACCAGCCTTGATCGTTACAAGGGGCGATGCTACGACATCGAGCCTGTTCCTGGAGAGGAAAATCAATTTATTGCCTATGTAGCTTACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACCTGTTCACTTCCATTGTAGGTAATGTATTTGGATTCAAAGCCCTACGGGCTCTACGTCTGGAAGATCTGCGAATTCCTCCTGCTTATTCCAAGACTTTCCAAGGTCCACCTCATGGTATCCAAGTAGAAAGAGATAAATTAAATAAATATGGCCGTCCTTTGTTGGGATGTACTATCAAGCCAAAATTGGGTCTGTCCGCCAAGAATTATGGTAGAGCAGTTTACGAATGTCTTCGTGGTGGACTTGATTTCACAAAGGATGATGAGAATGTAAATTCCCAACCATTTATGCGCAGGAGAGATCGTTTTTGCTTTTGCGCTGAAGCACTTTTTAAAGCTCAGGCTGAAACGGGTGAAGTTAAGGGGCATTACCTGAATGCTACCGCAGGTACATGCGAAGAAATGATAAAAAGAGCAGTATTCGCGAGAGAATTGGGAACTCCTATCGTTATGCATGACTACCTGACGGGGGGGTTTACTGCAAATACTTCGTTGGCTCATTATTGTCGAGACAACGGCCTACTTCTTCACATTCACCGCGCAATGCATGCAGTTATCGATAGACAAAGAAATCACGGTATGCACTTTCGTGTACTGGCTAAAGCATTGCGTATGTCTGGGGGAGATCATATTCACGCTGGTACTGTAGTAGGTAAACTTGAAGGAGAACGAGAAGTAACTTTGGGTTTTGTTGATCTGCTACGTGATGATTTTATTGAAAAAGACCGAAGTCGTGGTATTTATTTCACTCAAGATTGGGTATCTATGCCAGGTGTCCTACCTGTAGCTTCGGGGGGTATTCATGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCTGTATTACAGTTTGGCGGAGGAACTTTGGGGCACCCTTGGGGAAATGCACCTGGTGCAGCAGCTAATCGGGTTGCTTTACAAGCTTGTGTAGAAGCTCGTAATGAGGGACGTGATCTTGCTCGTGAAGGTAATCAAGTGATCCGCGAAGCTGCTACATGGAGTCCAGAATTA---------------------------------------------

;

END;BEGIN PAUP;
log file=prap_run.log start replace;
[!

commandfile created by PRAP v. 1.0 built 30.12.2007

]
set autoclose=yes warntree=no warnreset=no dstatus=60 status=no [dropmode=execute] root=outgroup monitor=yes notifybeep=no taxlabels=full [errorstop=no] warnreset=no warntree=no warntsave=no showtaxnum=no visnotif=none checkevts=yes background=yes MaxTrees=100 increase=auto autoinc=100;Set criterion=parsimony;cleartrees; hsearch start=stepwise multrees=no;
time;
savetrees file=prat.pra brlens=yes replace=yes;

[!
*Ratchet iteration 1
]
wts 2: 758 735 888 691 763 241 232 554 948 1136 417 124 1150 339 1137 704 854 64 234 311 168 569 963 947 900 1071 405 329 552 1226 1196 424 186 1273 121 479 721 164 801 1360 1309 960 788 31 1089 408 636 590 494 6 359 316 1352 1246 728 693 1000 185 495 526 205 297 38 197 1256 51 67 1254 363 795 1151 642 356 1205 793 13 1280 299 956 530 1199 1109 28 511 1127 1368 567 1277 20 595 898 846 572 849 491 169 1048 1315 765 666 831 190 637 1186 23 487 648 47 91 403 1195 974 1023 1051 1210 1208 1119 1122 1149 266 468 1293 357 199 66 247 1292 407 370 1001 5 1014 1347 598 858 1295 576 972 938 154 794 151 579 132 1111 211 77 771 80 1338 153 1308 12 1005 1106 1141 1170 824 388 676 465 404 448 206 430 1364 837 1212 1311 162 1224 1336 541 946 1234 967 254 695 142 444 1265 127 851 1369 533 288 726 1067 58 1004 230 171 429 1331 256 1129 86 146 685 664 1370 235 304 133 53 724 924 1155 700 746 1313 321 355 616 458 584 14 1271 1314 219 25 599 1175 1325 1148 581 839 294 81 1237 184 614 720 499 509 591 1178 302 532 531 596 237 705 1284 859 742 1103 310 79 196 349 342 236 1147 976 1066 1351 661 317 650 106 1288 1221 810 1324 122 173 1192 433 1162 21 89 619 1299 775 306 34 601 40 212 892 1296 902 102 514 320 953 202 863 1323 965 760 1230 475 1052 780 1197 718 325 1112 936 1085 550 1 1157 1253 673 1176 683 867 803 384 753 1021 8 259 675 180 1241 1016 833 678 689 469 904 764 437 233 1259 838 97 821 82 991 238 1285 667 223 543 830 1116 1100 318 611 922 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 2
]
wts 2: 493 137 1316 531 738 587 600 1194 839 447 251 52 1012 134 829 454 381 1368 508 443 1143 1261 1029 1147 983 561 564 445 1269 995 652 894 872 11 1048 852 485 932 1329 1058 273 1356 127 24 136 1081 613 856 649 183 596 1229 623 228 1041 1051 1275 340 1106 155 494 1243 879 220 1372 618 888 1296 1349 787 919 64 1188 384 737 420 1196 1299 665 1271 664 1328 1064 1272 1204 1323 102 916 1028 267 1187 318 1219 391 709 1241 1216 670 393 1013 1213 1294 1205 760 249 243 569 280 878 1128 646 1285 577 121 1122 974 366 240 1341 482 789 594 801 413 360 101 537 726 301 1050 1099 819 268 864 630 959 1175 869 223 1297 661 407 1281 1124 99 1190 1304 188 729 663 674 192 429 337 173 1173 779 1364 181 433 1355 746 1228 1036 804 958 1181 1233 601 426 403 1120 504 1330 369 347 269 383 692 179 1352 283 638 998 473 1027 1118 303 119 1366 200 48 562 1263 189 1235 421 328 655 1200 279 863 50 650 847 79 1125 217 1061 319 1004 1005 555 128 10 1044 342 419 34 1321 1018 479 61 124 1065 808 831 1283 1343 896 274 1144 392 77 611 74 662 859 686 905 334 196 767 197 1067 712 159 743 467 111 422 1019 298 986 913 118 676 1376 870 889 1268 719 441 435 1336 85 73 170 82 742 472 790 1179 547 241 682 1264 724 573 289 703 1174 1379 827 285 288 632 792 765 1139 521 836 886 44 95 816 973 1234 1324 333 152 1273 810 949 713 253 1043 184 1074 840 141 1374 81 294 254 1340 36 471 1346 1249 788 272 833 728 363 1359 474 721 654 245 322 552 629 1253 1112 918 747 14 1265 489 248 1039 768 923 1161 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 3
]
wts 2: 672 422 669 1303 1106 1022 1240 1005 175 814 395 315 421 999 307 39 106 330 741 255 182 1228 91 1007 1316 1063 542 823 1008 1071 236 539 462 75 240 192 438 1254 1156 408 141 517 1376 638 1190 437 27 592 1016 923 1053 124 780 1208 1271 1317 955 483 351 875 310 1250 142 49 726 273 1043 1137 135 516 1124 211 1057 138 70 889 1019 23 1247 1198 839 635 860 791 1162 962 434 65 285 1233 275 626 215 718 869 958 522 938 128 145 1207 404 37 906 513 590 560 603 879 1269 802 117 376 1200 164 929 746 1081 862 99 469 87 287 942 537 460 103 294 665 577 1027 1195 826 1 1148 398 534 1108 1251 153 494 1166 419 403 801 800 1051 559 866 1118 972 268 256 688 112 928 819 326 536 809 1059 265 677 119 1330 1372 1188 894 264 599 1078 933 501 959 179 1087 719 498 806 816 1264 155 1212 887 377 1344 1329 1037 1060 186 990 499 325 858 445 374 589 1044 896 1003 50 948 212 170 1074 166 832 633 472 1342 564 549 1152 611 491 1187 1336 488 1239 877 1089 550 621 387 1061 1143 671 401 963 662 1291 11 510 174 849 410 964 1055 366 428 954 1001 274 78 815 485 299 1193 332 1023 1177 1134 1181 507 508 1020 1028 312 391 1084 86 825 389 449 723 623 881 845 364 1311 337 24 841 782 702 686 739 773 1288 1102 271 837 993 989 136 197 956 172 1034 808 1191 82 795 1194 1358 974 1214 446 36 1088 394 1368 558 852 714 43 1323 1127 1350 675 1345 359 977 732 314 1076 399 891 500 710 1010 92 305 234 68 890 1224 647 71 269 282 195 13 20 528 416 25 302 682 827 1261 293 52 919 1369 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 4
]
wts 2: 581 318 297 385 19 17 386 720 1187 1194 382 633 402 113 1058 1369 27 381 201 1087 334 149 1295 370 355 136 220 584 531 1077 964 423 944 184 1071 539 1082 585 465 237 147 877 776 1263 564 544 869 1265 805 895 256 795 807 1099 802 1294 127 587 1143 668 570 309 1098 685 1030 871 1168 628 1001 1271 970 337 1283 151 1031 432 387 542 315 689 1156 1162 66 1258 761 988 1239 165 1279 117 703 1285 573 546 994 790 360 453 921 2 782 14 675 611 820 752 23 64 982 695 680 289 935 863 159 114 251 380 146 1304 196 528 1248 1233 390 374 1237 766 1354 694 967 931 1252 437 566 501 785 957 522 1084 50 377 1075 447 1199 718 132 764 340 1158 16 345 858 595 327 1061 1323 1028 534 955 367 1245 624 1211 1253 887 324 1208 809 674 1298 1104 489 943 469 169 729 800 1291 122 1012 670 1105 856 12 1357 545 1118 653 290 461 1106 187 1048 1338 281 1367 1126 602 211 987 1119 1229 1102 555 71 417 1038 8 103 672 243 335 1000 630 142 690 486 1241 73 1225 241 651 872 212 835 657 9 854 881 1111 847 352 557 1053 592 969 1097 852 588 135 116 1280 1129 330 494 1145 726 74 1161 226 1085 736 1018 682 347 384 1231 673 903 525 1169 980 635 1027 950 232 637 311 474 1243 1232 175 1375 156 1148 1209 310 426 940 323 424 445 239 879 476 594 1351 1262 123 225 841 893 1343 775 1300 732 874 1371 793 286 133 991 1013 213 937 549 218 439 121 275 167 277 308 1007 419 442 641 751 822 1140 1026 291 883 200 1221 183 299 619 1282 224 1060 846 264 868 929 833 1206 45 1160 214 168 189 145 1149 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 5
]
wts 2: 643 250 1129 465 359 655 1222 1238 491 590 800 373 345 445 315 849 75 762 387 1301 341 891 1249 1049 1250 15 1016 459 405 1161 683 1148 140 484 709 1318 524 945 240 210 20 551 735 4 470 904 1274 1107 678 460 399 1296 863 39 1271 316 450 1333 518 245 40 1046 188 1063 114 1020 503 323 311 519 1261 487 890 856 1350 413 78 855 523 1242 622 1254 667 1278 328 73 300 442 740 1012 587 287 364 586 134 260 677 213 865 925 407 400 1309 962 6 874 435 1054 955 644 1199 29 748 927 1135 666 176 1277 343 1217 1177 144 230 583 1072 1329 1352 1071 204 54 378 70 1153 1045 965 1324 1043 231 398 701 414 353 60 281 434 536 895 976 1275 508 1259 755 247 789 883 749 1186 913 59 167 1047 1170 77 217 1204 609 269 1083 294 385 574 696 1284 952 1305 823 62 659 542 1288 1287 1143 338 1314 712 295 1004 1359 180 1176 169 483 1144 493 772 412 494 97 1366 196 718 96 1297 90 1291 28 665 1219 630 1216 511 785 174 1365 371 1044 1322 94 831 456 734 1001 956 444 159 455 125 881 1065 879 882 128 509 832 1120 535 379 203 1116 842 321 273 330 394 753 917 1077 1299 153 1203 602 495 1062 1155 251 1085 1162 662 651 989 1237 707 137 1082 700 1167 969 138 764 1317 858 1 1154 681 1055 841 226 1096 1182 1192 439 310 361 974 872 866 1150 79 661 537 463 274 312 436 769 1235 736 496 1010 1146 301 426 423 293 1339 1368 620 1102 672 63 746 337 625 84 796 82 997 425 16 166 452 941 1039 1076 1255 979 552 284 689 177 1266 706 197 844 798 381 1303 714 1030 784 573 490 121 239 1073 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 6
]
wts 2: 426 314 1108 221 108 57 874 238 1231 668 783 247 122 263 115 1015 185 1234 1369 981 254 445 437 1168 1073 404 1024 831 328 1131 202 628 941 1066 906 363 480 80 711 1250 138 442 1124 255 776 1264 1099 1207 459 342 3 1261 139 820 26 1266 438 364 1306 866 358 284 16 578 1310 361 1277 977 568 1162 964 1315 250 217 858 1313 1087 112 49 300 494 454 440 1325 174 455 1078 458 956 1212 495 281 67 1274 401 181 1236 232 1157 677 928 410 1323 341 449 720 293 584 132 169 1308 1120 407 705 542 72 430 525 156 1239 612 439 953 609 463 506 1334 98 816 1350 1020 1304 656 679 676 12 1169 461 1042 753 733 118 355 669 845 394 1317 817 759 335 332 700 905 452 308 370 460 1259 1181 1379 908 343 650 942 719 581 924 428 331 616 1209 50 471 946 1208 687 93 516 879 1373 869 179 105 997 1041 1232 926 976 20 1243 258 585 269 1246 261 742 1222 626 761 197 754 537 161 129 740 543 785 333 431 1378 627 576 466 117 1224 143 654 11 944 1178 1269 23 22 992 483 1129 963 725 351 287 377 570 245 159 339 919 872 1347 1301 1370 681 522 744 209 1158 947 743 1260 1333 1155 927 974 527 605 1253 1012 224 1112 474 614 745 124 6 352 823 828 411 859 904 417 1069 235 618 1081 1297 610 1071 1237 1058 146 539 968 218 317 114 802 393 523 933 1360 1003 297 1282 502 280 1000 125 1141 294 1183 1068 529 104 243 1202 935 1279 890 657 420 808 660 649 286 634 621 784 1037 824 322 53 950 739 1177 71 607 77 624 644 959 290 580 841 490 889 1216 789 1245 1017 306 1002 347 541 938 307 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 7
]
wts 2: 186 1059 1053 676 510 1070 934 744 785 162 743 1240 437 848 1153 1072 1333 971 1261 891 1238 621 471 646 493 798 842 180 779 262 815 1230 1237 57 1320 417 143 426 1295 99 961 1018 1100 486 1156 806 647 74 13 203 64 305 764 296 568 1183 383 1316 756 52 76 430 1290 1344 1056 736 496 1024 742 1173 1362 923 816 712 454 332 94 1127 509 991 1301 521 597 1159 50 543 719 1244 1340 324 126 1326 1160 244 212 346 678 921 178 209 781 863 169 301 1199 1063 173 1169 297 159 862 1342 1378 322 874 1266 438 1117 732 608 1246 721 150 829 1274 282 142 1055 982 263 1095 1115 18 670 837 62 391 1283 1177 992 655 1037 434 227 1136 459 224 561 281 633 685 267 614 1319 252 847 835 310 797 1057 1139 1268 210 410 551 421 663 994 1308 1104 1278 407 1073 885 708 298 317 1363 1317 72 738 215 552 906 960 68 405 414 754 859 1303 1084 766 980 1211 765 1051 693 42 860 803 423 789 943 823 1064 643 303 689 230 579 1071 1227 1216 56 1101 46 83 196 978 125 362 360 1296 1121 498 1010 881 905 231 787 8 175 867 338 575 975 38 690 777 926 634 660 642 167 519 279 166 1032 830 648 623 351 316 1141 47 530 1143 912 485 88 1250 357 679 309 27 147 1232 595 432 1253 1124 457 1339 902 149 1058 882 59 43 688 908 1103 587 376 1379 694 691 791 880 1131 475 1146 851 1289 1249 1288 1229 389 327 326 969 553 1042 1272 370 984 784 400 886 218 1285 295 818 894 669 207 217 1007 836 664 378 684 395 1208 533 773 515 589 155 359 870 491 286 884 674 695 1009 182 1041 796 586 104 216 79 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 8
]
wts 2: 846 145 110 80 980 1242 1282 782 252 1279 208 1204 656 1127 1201 683 489 791 1197 1041 1257 312 829 196 468 666 688 1263 356 1274 286 771 227 33 1181 186 1091 796 959 142 1065 152 903 1215 51 773 641 382 1069 1014 1363 1296 894 133 438 176 244 26 47 631 1176 970 991 827 821 491 746 907 1191 302 616 1131 570 553 1100 326 362 813 319 924 406 112 661 230 1118 845 1141 830 1142 729 148 627 1130 1103 635 585 548 706 288 1137 1271 378 869 453 317 718 852 13 151 15 602 331 1179 268 380 663 402 1283 981 664 157 1148 180 742 1349 320 177 739 1172 416 1278 1124 446 300 643 651 129 1115 1320 30 579 307 625 461 1093 492 207 455 371 14 98 789 1205 595 360 1314 940 719 788 668 841 552 204 1113 1051 1240 435 979 499 1026 1321 330 187 946 864 708 760 1066 1089 165 64 583 1062 469 313 462 953 325 359 117 615 1231 1059 271 160 811 998 633 1072 802 84 1248 20 732 166 1028 1323 558 990 1045 1094 1294 185 1364 487 231 1036 374 60 190 714 445 728 671 1168 783 854 127 805 266 1060 485 578 886 1297 1288 236 1244 195 581 890 172 899 8 44 820 32 1301 649 982 161 715 386 131 734 1015 1308 761 801 353 731 1251 891 484 1190 774 120 1237 181 1133 1063 202 928 1047 144 976 217 1012 206 700 843 1123 1006 672 505 1162 238 1214 601 815 757 443 836 818 653 524 647 893 488 86 858 239 1245 921 720 1027 1378 965 825 999 748 1335 228 610 1328 171 113 42 46 1200 620 1039 78 200 1286 1030 949 2 3 1157 727 898 617 323 85 1217 929 539 1024 861 975 412 1032 417 1040 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 9
]
wts 2: 662 287 324 1270 1315 468 931 892 3 768 738 725 957 1125 1123 942 541 639 332 827 959 556 4 125 1174 1377 1267 955 448 891 257 456 1257 897 1084 162 194 788 871 708 1076 973 1191 1240 1227 1012 16 1130 359 1183 458 1043 44 1303 412 446 1333 386 161 267 185 776 138 1260 1078 903 1325 1353 965 615 484 311 1071 1233 801 382 1297 683 1060 42 750 457 1286 694 765 918 108 140 1287 578 558 1165 1004 956 1277 1034 1073 1324 737 940 570 739 313 516 995 1106 656 1115 602 612 1159 824 426 61 1072 920 816 1161 886 966 20 629 682 508 1044 606 196 1203 82 789 43 199 84 1318 815 93 1280 813 264 1103 685 305 1150 213 1341 887 623 425 783 208 1314 1278 293 625 716 1209 1143 1085 767 808 628 299 141 860 195 826 911 374 331 244 39 254 952 732 249 506 173 1155 684 306 148 1242 110 1258 1116 1310 772 211 179 1251 687 99 1320 385 634 536 554 242 1070 24 297 1311 1290 101 1375 944 63 882 327 531 1281 335 314 730 610 1350 989 759 1041 416 192 879 1218 705 440 1332 421 154 36 1285 686 1176 186 855 1361 698 798 1171 1256 760 1354 292 1095 373 226 1195 501 1021 96 642 503 967 874 60 463 1196 839 601 397 598 1222 1273 10 806 18 799 913 842 1263 470 905 1018 51 740 1255 163 835 450 1214 201 14 622 549 646 396 149 1017 999 1259 142 490 1083 408 560 15 787 371 392 139 591 796 1046 1231 53 1228 383 780 334 1179 72 1092 1284 144 1358 803 1193 1249 1122 853 715 582 841 1158 636 941 273 1321 507 659 595 227 1007 1136 638 236 477 472 1208 736 533 1063 240 1184 391 837 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 10
]
wts 2: 108 404 889 751 282 962 1079 619 497 290 215 411 764 1250 749 1159 710 674 839 352 373 883 1293 438 21 736 636 936 1360 878 625 473 1362 525 23 1283 321 177 522 841 1083 391 326 1039 1192 628 638 94 844 1207 381 423 1379 192 583 829 692 323 274 435 333 1168 892 1124 1107 948 725 602 968 147 719 1257 899 469 1006 89 967 846 997 959 780 752 1285 45 457 420 877 85 334 1364 831 407 637 396 440 756 496 785 679 1208 458 244 1058 530 1133 461 1185 565 903 543 1081 1144 532 1025 993 981 301 472 1149 311 748 138 363 1323 298 569 1373 1014 847 214 1197 626 669 346 1235 1374 330 552 894 1320 1312 1008 574 1228 724 545 210 83 79 317 350 1305 376 1156 1125 922 347 343 986 559 87 581 904 912 1210 891 1280 932 1377 178 129 1128 1146 17 537 925 384 773 680 459 44 3 1163 77 293 516 515 1346 804 1254 1181 860 1095 859 798 243 520 593 907 500 971 309 167 219 1157 954 56 324 169 390 1206 1310 491 1311 881 474 890 973 484 59 1324 1122 93 776 1260 279 1272 170 915 1204 833 1000 1167 1256 1018 988 7 2 118 882 870 1365 451 1055 268 790 380 410 1111 1054 564 8 592 1328 597 683 288 41 159 742 653 797 315 645 861 1234 119 538 767 1132 148 998 1329 608 231 26 187 468 204 1263 700 76 65 675 547 91 849 43 770 251 811 852 63 306 587 152 1029 340 154 717 528 1101 1348 418 12 709 398 789 296 194 923 1013 90 825 188 283 655 69 1233 434 371 693 906 1130 385 1056 793 1255 303 716 1134 1262 768 850 1313 62 449 1322 729 1108 332 392 431 943 157 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 11
]
wts 2: 78 24 676 339 323 644 11 991 1239 165 1033 136 141 1050 811 934 1258 1205 95 531 94 1278 1063 243 684 1175 1358 179 537 693 1305 1005 408 1264 737 1185 682 890 877 123 1333 315 498 956 574 185 1249 970 216 204 190 1378 154 289 1274 92 1191 282 1082 838 614 38 1042 833 745 764 237 1127 1164 1093 997 856 837 385 943 1244 1189 1257 795 463 1039 16 460 625 528 903 921 1350 485 170 387 1209 338 113 1297 15 579 1338 1369 913 580 82 274 897 953 47 268 1346 146 241 1157 1341 607 891 539 434 157 290 1009 1340 523 621 502 148 39 1168 878 841 495 507 1108 468 573 816 1 799 984 667 829 1135 194 1240 620 412 755 293 2 587 348 446 1190 905 247 548 398 36 1072 1065 1061 374 1242 1013 1273 276 1180 1130 1141 893 1081 300 884 1309 993 1054 122 102 709 1019 854 773 181 1186 1182 174 1247 1271 789 641 723 525 951 628 714 441 278 10 242 1173 458 342 848 846 1064 534 1143 715 988 100 1048 53 1139 497 28 1208 500 1062 345 549 17 917 1136 662 281 1256 392 1152 31 933 246 431 1331 108 451 298 452 1123 652 1285 464 1109 234 930 317 983 439 1336 1179 18 1355 172 602 478 253 1029 367 1345 417 222 969 599 747 1364 1206 616 794 384 867 351 727 383 826 585 225 138 769 1126 1322 178 1266 1128 633 1226 72 428 820 333 803 496 972 55 1176 581 678 130 187 975 781 107 894 911 596 686 1270 1124 592 524 284 1107 1231 814 33 845 671 97 728 1076 1084 889 1210 1120 1026 137 782 1377 195 1238 736 448 513 43 91 1292 1022 1038 520 1113 51 904 1073 530 404 568 552 989 183 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 12
]
wts 2: 950 947 1264 368 998 471 1333 231 645 659 436 1306 983 54 958 64 1010 1157 1051 96 36 127 865 526 679 254 912 29 62 276 1380 475 1206 57 1047 902 1167 746 342 1100 74 112 587 459 187 913 564 563 1095 303 150 1292 1227 414 1330 814 1137 413 932 451 1108 92 858 975 460 790 1174 185 119 495 105 843 1166 757 1240 81 409 1169 1235 810 636 1181 485 399 835 733 1375 744 625 577 789 349 1128 1040 720 356 740 917 506 978 641 793 922 1133 649 1185 604 381 1207 1201 1152 1298 294 610 448 264 708 1007 519 468 131 151 91 542 561 579 1062 1332 581 366 104 578 796 1151 188 751 1247 1323 643 396 139 42 756 653 113 1340 71 831 371 265 1150 339 1220 463 290 327 941 263 31 715 464 227 582 1198 568 82 1352 881 1267 842 525 1101 955 248 382 899 714 737 208 1252 1353 1190 197 771 85 353 438 1156 1339 1245 510 1208 1172 305 498 613 447 1086 1049 706 1212 873 855 734 1013 1346 1065 690 808 1165 880 937 1237 474 921 392 469 258 1224 1033 73 406 696 1188 80 1130 719 178 419 126 1348 115 988 1355 326 1371 1180 685 758 1304 1162 658 214 146 661 486 1272 854 1296 528 1094 1374 223 333 809 1287 956 598 1189 41 1146 19 565 232 455 1014 1002 1288 945 1325 1255 75 837 953 618 444 676 1215 801 1307 1102 1009 266 536 301 1223 936 282 677 584 40 539 357 1088 99 461 321 914 1029 362 995 375 695 1031 966 541 1327 559 802 848 755 857 590 1238 1187 190 521 792 1077 2 13 1328 1263 198 1314 1178 384 1148 343 14 1143 4 1364 874 807 934 393 25 273 1057 1265 1312 1164 470 1336 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 13
]
wts 2: 1173 524 568 4 1075 620 1046 223 1354 969 145 332 977 712 700 673 806 1072 903 783 493 1027 1018 1260 769 336 875 668 968 808 411 279 357 601 819 1321 1251 789 406 217 716 160 795 315 1283 468 242 485 1049 827 386 1364 680 438 516 577 186 832 519 1057 253 305 909 984 338 846 659 282 321 388 109 665 648 1229 1101 702 854 162 30 943 879 946 309 800 822 463 374 917 986 552 1253 1248 76 166 1056 397 853 997 119 785 1185 689 1119 77 280 1142 499 480 414 979 495 359 165 1111 454 606 1060 933 143 52 281 86 1108 1234 420 233 1329 1363 1091 1360 205 859 957 5 726 704 25 470 84 527 1277 1276 394 1109 966 1358 503 34 572 1224 286 530 41 141 534 1370 950 215 833 1331 772 855 981 1088 355 7 1071 1199 383 1194 196 690 476 504 221 646 1332 916 1093 872 53 351 254 431 1042 974 1255 695 532 195 1357 922 558 1159 365 1107 67 71 214 1068 837 111 560 1175 190 137 404 20 1346 674 1294 715 590 899 705 539 1010 1380 1136 1307 275 535 1020 952 878 856 48 99 188 81 471 971 49 675 1150 1102 473 664 415 924 398 667 1271 1290 88 553 102 1066 942 213 893 619 312 1158 22 932 1231 1298 1371 1220 767 1322 1217 379 625 1015 1082 250 392 56 428 1053 362 1104 409 989 525 187 460 153 507 955 1190 1222 79 89 36 211 895 574 1008 563 681 64 1263 207 1269 122 130 728 640 1038 746 1375 920 246 479 115 440 774 231 1304 630 90 442 1110 1024 1368 813 128 910 1148 569 1292 588 1359 549 1005 15 110 908 299 249 1096 927 730 300 656 565 824 85 68 548 733 225 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 14
]
wts 2: 376 1156 956 673 542 634 576 431 114 969 824 782 106 889 864 580 362 593 1095 1342 1360 948 884 1185 810 497 213 952 1199 1263 1284 713 366 148 790 1248 1375 508 977 1120 500 545 1274 234 892 983 1168 1325 1110 1131 486 873 316 37 815 1242 541 337 162 152 1097 1255 700 686 1080 668 1007 570 943 847 12 506 804 559 534 511 1305 820 998 303 1195 1345 1209 22 718 751 753 1275 1235 874 370 1150 1081 411 53 616 842 974 319 280 407 726 959 523 819 1127 1020 14 294 1281 611 1308 868 380 1368 141 770 1067 965 176 54 900 453 55 1350 1154 351 550 81 267 1142 153 878 6 979 980 553 182 7 748 797 701 137 809 200 222 1262 1241 600 447 191 703 792 1012 1112 474 1056 1061 752 272 1212 812 744 832 602 887 1332 1290 871 778 551 45 1341 195 439 266 48 699 928 387 291 1285 538 1005 3 964 794 1347 758 1210 622 741 1354 739 747 1286 1085 951 372 643 1268 607 1160 315 40 1172 989 877 329 942 946 43 1088 807 135 89 1254 1050 183 1373 462 193 87 353 281 1363 417 914 1094 822 1203 801 211 1040 855 638 796 445 1036 1113 438 464 931 9 17 1181 521 738 1276 1310 714 1378 947 4 734 881 110 488 125 1016 531 1137 967 175 1001 1146 764 522 441 198 77 992 783 1280 811 369 1330 1201 1333 938 775 1326 876 1303 709 988 805 84 292 151 1297 849 850 274 203 350 184 579 65 41 896 548 1298 1111 761 1102 60 695 33 1178 867 165 999 1075 625 710 118 1038 524 990 917 1077 756 906 1329 839 771 1086 95 598 1343 866 529 300 472 317 1096 433 806 1307 420 1293 490 409 827 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 15
]
wts 2: 409 1069 770 622 1353 639 549 1359 1066 1238 999 146 1014 664 99 1230 1259 1122 33 610 1125 432 478 1253 1174 906 287 268 421 1179 174 700 117 76 751 1372 841 482 480 286 182 1217 318 44 408 788 718 20 1262 852 1376 1003 1102 1047 337 1294 1331 1278 419 1175 963 771 1025 879 1054 453 1056 1067 719 620 912 679 1121 83 983 1027 396 529 922 905 350 697 25 573 321 901 847 1219 196 1093 829 1373 619 272 386 270 932 606 317 1021 504 1346 925 1366 198 755 947 417 378 704 1265 457 125 600 1127 748 739 428 43 969 532 178 97 865 853 955 670 1004 1228 1161 411 657 488 1002 1348 293 121 228 167 803 193 449 681 132 1046 214 981 468 636 1119 553 368 78 331 291 1361 413 1221 271 454 1129 1145 192 888 105 1345 1148 1360 689 1274 34 849 835 1035 24 707 393 1309 79 607 980 534 1314 1250 245 1098 1061 1302 310 601 250 495 979 864 603 285 496 323 171 498 1140 728 206 1034 991 1301 1335 1358 789 779 1304 1377 1194 579 1094 297 1200 246 55 218 565 1199 1244 1168 1189 224 251 635 1060 243 592 554 507 8 644 646 479 1285 1085 247 114 137 1151 547 660 305 1236 1378 828 747 764 871 717 645 389 1224 1317 1001 1201 185 355 1139 624 1243 815 1146 723 21 126 48 451 497 122 1070 618 1133 280 542 777 837 1000 486 555 1198 826 612 1267 441 649 611 347 762 1275 1169 1031 833 1009 605 1103 94 1068 743 613 154 655 100 787 1349 237 584 1090 877 1325 792 406 627 1153 712 303 62 960 501 988 248 1293 1050 1271 1087 1303 188 756 244 1181 544 531 727 902 663 570 1350 820 1247 295 187 1313 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 16
]
wts 2: 1333 134 496 993 855 228 655 84 138 504 1195 1049 1128 802 326 177 265 1102 473 50 282 990 965 103 1196 646 1290 943 628 1005 327 335 1143 1103 272 967 106 1125 942 833 1180 387 529 1358 1123 584 757 111 405 773 1006 670 1095 57 1096 330 1163 200 269 1368 404 929 959 1182 186 711 704 1010 1328 24 999 361 223 740 1220 224 1101 678 108 559 1243 280 850 516 454 1036 262 520 368 1121 571 488 917 191 358 540 279 661 310 605 876 573 1286 1236 390 1209 511 546 556 379 998 132 1178 448 783 325 1045 808 323 748 1153 978 433 423 1003 230 810 842 1175 225 659 324 62 202 150 909 879 1136 719 1380 1379 1300 1296 907 334 796 1263 431 1084 1250 102 1372 625 632 1019 346 203 791 1020 92 939 590 1025 133 709 274 126 172 664 449 1114 1035 550 1320 1085 738 1337 182 1247 481 966 159 281 1111 1359 535 196 1086 614 1139 337 146 479 401 841 754 291 722 128 1319 285 660 699 1334 1200 70 195 1016 828 1318 1142 731 1275 422 854 613 185 85 637 856 304 161 1048 982 494 15 576 541 377 1033 491 610 821 1256 996 244 805 1051 329 543 1186 470 1172 1108 607 523 1069 4 98 514 199 930 249 925 242 68 397 1001 1140 175 34 1281 870 1027 94 621 627 1284 1240 426 319 836 696 1115 116 12 39 609 1330 1043 1345 536 1168 1342 1361 715 1159 441 344 831 179 616 104 119 475 364 1002 1311 47 688 1303 865 1348 1076 1116 359 1310 512 121 292 983 640 1282 1326 837 1070 1265 1169 391 517 589 296 552 1224 591 336 1015 487 911 467 900 611 1221 1314 197 1343 800 1081 1327 1191 231 774 169 1273 1252 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 17
]
wts 2: 634 904 981 756 730 1370 594 496 1215 874 1061 985 652 101 5 217 1171 255 119 1281 239 798 271 108 1099 19 38 724 1264 156 58 143 298 1078 1111 789 87 866 413 761 1308 177 1119 853 548 632 799 116 674 997 1250 740 627 1060 1141 1201 805 1246 518 1075 833 1251 571 951 1040 1052 505 387 18 373 1140 113 965 903 631 155 1300 1318 758 924 1295 702 73 1029 1186 538 1130 433 570 246 447 1050 502 1007 603 1003 600 1299 1257 219 1352 1104 589 28 47 881 982 683 818 622 1006 767 60 252 157 1165 232 580 572 305 68 757 905 701 825 86 1079 1248 501 467 774 204 678 623 556 1183 1129 415 206 1039 476 524 72 813 1041 41 118 1002 289 1236 315 314 562 749 354 1023 750 1015 439 656 180 503 842 51 1013 15 434 1209 1035 263 1290 248 326 1331 316 989 665 435 803 34 337 1017 1197 193 342 926 1256 466 153 1084 11 1164 810 617 163 500 1148 30 64 941 991 963 753 377 614 356 321 834 1082 1255 975 644 1373 338 1072 1137 300 1240 784 69 1033 1349 930 340 148 715 422 661 40 484 936 1146 1292 744 1224 809 188 247 295 705 1321 1365 426 134 1229 1273 742 765 343 909 457 1230 189 772 225 830 679 1057 1326 1168 17 49 1213 1096 1138 1361 726 956 127 400 465 202 294 1089 638 801 533 718 558 1020 292 376 1102 269 915 268 709 1098 961 16 166 405 763 277 471 1265 231 348 452 440 552 349 526 27 681 815 574 1205 1244 46 1027 461 968 1074 969 578 713 1360 341 462 129 42 1267 808 920 304 775 221 1178 927 759 251 399 1225 257 26 1324 498 1334 510 959 24 1093 998 1156 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 18
]
wts 2: 292 857 110 1131 284 1365 88 1283 524 542 14 1106 431 1023 1373 903 1153 394 554 899 411 534 1128 1251 803 62 1231 293 771 331 909 511 958 343 390 936 978 543 1009 794 594 1280 281 880 1017 1250 957 400 1312 927 11 708 1273 1246 728 709 204 205 506 1196 570 999 1182 820 744 116 214 1204 1319 801 671 146 439 629 1137 291 1265 1361 660 139 1200 240 650 40 902 1359 716 1193 414 1266 622 684 854 651 294 1282 1101 1211 1042 785 816 590 994 657 592 971 192 618 1122 1114 249 811 1369 733 968 686 938 759 698 696 493 7 473 742 579 1315 934 1048 384 257 850 807 398 1293 244 85 644 446 237 1039 1371 653 1170 1166 305 781 1038 1306 416 1358 1111 711 704 528 695 329 430 1262 967 226 1171 130 480 138 1342 113 1297 1290 517 630 1201 1070 149 772 894 1004 440 949 1195 1032 608 475 1194 1067 1031 197 497 1208 1066 375 236 242 1304 784 775 607 358 674 1053 199 1002 258 835 166 1332 666 560 643 494 59 736 924 228 327 155 1136 137 61 609 918 1324 73 406 481 970 170 316 1261 1236 1267 873 397 732 896 753 587 1268 935 898 312 372 647 147 556 1095 1227 596 1307 435 1037 389 851 1072 1340 1206 621 371 1239 161 721 552 806 502 172 595 1133 315 391 353 582 488 368 1320 875 15 246 210 27 1135 642 1311 378 1121 944 392 563 364 1341 255 881 558 448 409 1270 75 879 992 987 108 1216 174 421 562 492 30 840 846 682 491 403 1105 669 1173 731 454 1350 114 457 947 1094 1175 215 102 283 990 672 5 263 612 341 299 1274 92 42 576 1046 1348 606 637 841 1160 540 1301 974 1343 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 19
]
wts 2: 1171 261 284 1093 852 1107 825 751 938 356 702 736 1137 62 939 1201 593 56 784 837 460 863 1293 306 1344 479 143 828 766 680 1136 1126 1067 219 1101 772 80 728 1270 21 535 150 927 520 880 718 1268 871 227 1102 1052 315 895 388 46 465 1375 850 129 407 121 1144 1307 1296 1069 499 964 640 332 651 233 437 530 559 512 746 112 551 804 859 398 672 237 291 1302 45 57 742 198 1118 25 71 552 1291 957 910 225 420 364 967 312 184 569 701 1006 269 898 601 1147 217 1028 97 1333 1058 1048 810 1196 1081 747 501 1308 509 294 780 641 1176 996 650 165 627 290 1125 1318 1066 844 335 357 90 1200 774 1031 1311 896 370 540 456 408 293 477 273 787 532 1061 189 892 319 152 481 1367 724 1 955 713 173 745 1020 678 544 830 1218 89 900 159 966 389 1076 508 63 867 1122 733 461 576 126 124 974 322 130 1281 1085 596 1183 541 1228 1057 488 1335 1371 1162 471 435 1166 998 525 1325 1300 1294 1214 1083 960 635 484 656 1114 307 251 732 314 418 1051 111 925 932 533 43 1016 1160 1260 441 250 726 597 561 74 928 442 128 1063 856 345 1315 99 358 788 145 763 1096 737 24 132 276 948 662 912 14 350 494 953 854 1205 1075 505 245 665 1173 1153 704 480 266 1191 59 791 1077 1282 15 457 1328 413 206 918 887 836 1070 752 220 1280 1257 292 794 514 975 267 66 1283 1298 814 872 286 1002 1094 659 834 1182 813 1206 1306 11 158 866 513 949 1265 50 1209 648 562 697 1320 1350 18 708 368 1192 977 1364 904 1216 181 612 1220 466 1091 1087 1323 263 507 536 838 750 1163 381 1336 578 399 101 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 20
]
wts 2: 463 225 1173 1123 973 57 563 380 307 452 49 782 713 630 135 1074 233 988 816 582 1376 78 697 649 422 500 1335 1014 338 1143 296 306 1158 1163 1095 1 1221 1345 682 1150 911 328 285 692 427 1069 377 446 1175 745 1300 1136 1357 443 277 1265 320 923 860 795 1276 1171 487 454 728 1336 118 1306 337 567 505 607 1068 1205 1333 591 642 903 321 781 864 1161 909 507 2 174 383 636 213 433 956 145 752 436 870 1166 1196 602 1114 1377 1155 396 1250 772 1230 1352 1165 148 241 390 476 460 878 939 210 1235 872 835 834 1288 203 971 493 236 1341 785 829 706 92 146 1008 975 743 1267 195 597 557 1257 1380 880 312 640 388 1199 798 739 202 879 1198 700 58 404 774 1256 538 625 373 197 1077 271 639 1249 250 918 157 253 1156 1131 1090 1284 368 184 168 255 546 138 234 917 529 596 890 1035 787 1135 1154 172 1122 310 34 1295 791 748 1321 430 1266 960 445 1245 1167 554 482 420 1253 268 1153 1120 1338 707 50 72 185 758 620 1378 231 618 684 162 532 552 997 947 1016 1255 319 128 313 158 492 1023 1369 416 44 178 1280 769 712 176 802 531 815 347 827 8 1055 76 484 564 698 1138 1037 413 1083 1348 667 1111 660 687 974 374 361 623 161 473 85 124 613 675 830 29 177 228 88 47 970 401 469 863 1303 1264 448 350 9 902 15 1201 1286 751 942 645 382 1000 1324 251 375 1137 1204 244 635 1323 616 1071 962 298 1168 491 127 754 455 330 106 1174 921 1342 12 958 490 1050 428 1184 693 355 418 1258 543 1132 419 1213 495 366 647 1006 218 1240 449 780 1337 61 224 1206 922 208 750 967 1152 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 21
]
wts 2: 998 1218 1025 1061 1117 943 914 587 755 1034 351 1144 101 1163 1098 455 984 790 467 153 185 1226 97 1339 1024 1016 795 791 1351 716 701 1196 604 257 805 766 827 633 333 1257 332 37 1039 222 792 265 150 1223 444 1303 632 583 507 485 313 595 571 1056 1138 1112 117 172 765 100 79 223 146 61 833 675 1235 882 209 1204 586 592 938 1058 312 308 1234 1157 972 245 751 890 460 372 857 1201 454 311 48 912 770 953 1047 466 1240 768 1353 762 28 643 126 283 1150 1231 365 193 527 1198 203 784 1368 135 247 1084 631 89 289 973 634 533 1258 1186 670 1075 735 1265 423 1088 1090 178 161 291 1357 726 486 936 182 714 1208 77 962 456 967 1087 702 542 1190 1360 832 1100 439 779 230 554 742 52 282 1074 740 615 341 591 816 1091 1042 565 568 168 1017 706 75 1161 1097 250 577 758 608 3 474 777 1279 438 572 787 823 96 318 1107 506 585 982 640 804 29 133 873 343 154 104 1272 599 1237 993 303 566 666 861 969 373 978 562 60 876 1124 1116 1154 1129 430 211 985 1209 226 422 59 1222 63 421 661 495 1162 672 534 1007 844 893 1064 278 1031 1105 1108 371 848 314 573 140 229 93 243 508 1284 1057 546 764 376 487 995 885 1216 1032 175 30 1175 1160 228 294 266 1251 53 1101 1099 803 1130 651 233 1375 1185 412 927 369 625 986 916 375 1011 269 600 91 170 320 997 911 490 305 409 219 1205 783 892 109 1329 1214 878 258 580 35 22 1132 492 1002 328 903 384 411 85 1158 505 690 1076 440 1179 1261 25 942 295 1041 66 1266 306 1355 81 1335 801 868 671 1241 545 1317 416 659 477 750 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 22
]
wts 2: 1317 1322 1375 510 204 24 1131 707 467 1089 260 582 1153 406 1095 877 1127 710 856 349 83 116 115 1270 1378 1254 56 852 130 283 1050 1132 114 111 1223 1092 434 1093 173 1213 441 345 942 934 928 216 585 1144 651 591 531 25 234 715 1218 1084 751 681 712 573 455 1344 337 1122 43 217 1162 1315 355 1114 180 571 977 1275 214 17 471 209 1046 1189 1227 812 761 857 762 916 1264 1373 255 1099 1175 688 482 1040 1364 16 432 1010 1073 1152 1055 281 669 631 604 147 1346 1030 359 830 3 508 1296 637 1174 38 196 178 1052 767 862 690 1347 81 1074 544 697 971 232 1372 1135 1148 644 948 375 1248 1259 69 425 297 873 956 875 475 361 484 743 494 502 438 1091 1289 79 671 534 412 254 33 1310 1011 841 28 127 310 1118 709 383 1308 972 479 102 499 34 1324 1288 87 182 1185 162 1036 463 1087 1380 92 492 1042 1033 758 1192 343 1366 315 1156 692 822 993 818 869 473 964 464 724 243 410 419 731 187 123 556 131 1014 602 1311 1353 840 962 917 372 85 394 202 1126 478 144 1269 52 616 143 62 237 360 472 565 165 560 673 1008 1292 1002 88 725 926 68 481 203 1191 1159 949 1058 570 809 1107 580 405 503 104 853 549 739 1300 745 126 389 370 91 779 423 371 312 654 1204 1341 879 296 720 211 1240 940 735 433 1047 1179 1161 435 269 429 74 770 408 14 820 341 1102 1026 1096 1294 1140 1293 1260 721 517 364 1035 332 1025 153 965 1104 193 1226 265 1297 488 60 407 252 927 261 86 705 596 657 1193 641 477 976 262 1369 379 957 112 914 1234 80 1173 1182 799 1216 167 592 1070 10 525 31 1333 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 23
]
wts 2: 1123 178 118 272 502 486 739 379 1164 242 424 1080 620 1084 234 1294 331 1313 873 485 908 947 890 975 356 1363 481 1038 1162 930 186 1112 1221 1045 938 352 371 1272 1002 812 594 1147 885 1167 612 8 519 1133 402 1210 405 355 627 1278 1040 295 292 965 1257 999 1205 1046 838 81 636 689 652 1098 972 822 43 1047 687 799 606 979 1325 1071 1061 775 428 1103 729 1057 703 1125 93 429 61 1217 1007 200 413 547 944 1063 85 491 1070 990 86 577 614 451 585 996 891 1049 4 697 728 621 496 1200 751 711 1033 1306 89 500 1277 820 57 962 212 425 191 1372 17 548 1335 1157 1235 51 98 832 663 733 797 136 417 658 223 712 754 544 193 24 724 1056 565 455 675 1186 322 582 578 1111 1281 867 328 1359 561 695 1322 973 404 952 217 460 310 1309 1031 1178 981 231 819 1184 821 254 303 364 180 1208 222 87 681 232 183 1337 734 475 230 1008 1264 319 167 469 1298 1128 940 138 534 436 915 1013 949 1218 450 569 846 73 650 541 523 484 1268 206 872 925 1079 864 1055 349 1172 693 704 1362 1225 926 1340 1344 829 1256 473 976 3 520 351 1081 605 120 1025 1122 1368 350 1236 342 987 906 1283 452 23 1105 116 1173 533 205 529 414 430 1330 391 657 199 320 899 1246 742 1286 421 1 653 814 240 769 26 1108 244 130 448 640 525 318 773 1195 148 181 1380 1365 1154 2 477 314 194 1044 608 833 1326 634 1198 1074 1059 1180 149 59 524 1232 1006 1009 5 910 474 538 619 95 1364 726 416 211 470 903 1050 1136 71 34 1373 284 811 53 1336 985 988 756 390 334 714 919 1097 281 360 671 804 935 1290 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 24
]
wts 2: 36 524 593 1163 837 756 316 244 760 39 1052 335 1271 964 899 587 746 1317 231 1342 672 608 1022 656 294 1106 429 991 277 127 1097 193 541 602 851 937 866 1169 597 59 259 1379 221 632 925 477 810 1209 1057 769 581 245 897 797 1073 778 886 376 580 676 803 1076 487 99 130 1199 870 254 1049 445 279 508 1151 988 388 225 512 659 1090 590 223 850 136 628 829 720 1202 303 1008 78 1300 1205 1356 32 1330 967 1353 941 75 204 290 732 21 286 805 86 931 790 982 806 721 682 923 1034 668 1195 485 961 762 1253 30 151 1041 958 586 892 832 929 1185 1237 13 297 1167 396 1144 901 585 1234 768 117 709 1141 718 731 1293 41 1210 529 564 926 907 1032 1315 356 547 733 177 1072 124 397 1148 1309 1373 19 984 1100 693 617 645 771 919 413 1362 517 879 1329 710 1297 935 1091 1313 164 336 630 202 624 949 942 169 18 1361 592 71 1184 342 1285 357 1108 745 1104 1173 116 319 387 65 343 975 1286 1336 91 9 216 715 360 969 561 1129 1172 896 1132 537 1220 1327 380 252 825 971 1378 407 1241 1371 1112 913 823 1216 1047 856 266 570 903 647 1212 496 379 774 415 1248 178 845 205 612 873 285 1229 556 1325 1078 481 840 1332 1061 1206 955 1146 864 887 174 1055 72 691 314 454 1200 459 1321 385 404 631 186 317 264 366 468 883 839 799 601 1338 482 1089 1372 1098 726 1048 1291 1349 339 1062 497 1125 616 142 985 147 426 821 1222 1308 355 663 867 44 140 20 621 76 1074 23 1174 618 361 722 334 1033 993 88 1268 94 764 123 1312 1051 1030 411 2 261 69 584 938 1242 530 767 15 826 16 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 25
]
wts 2: 444 774 1276 983 340 1372 606 837 666 111 222 570 1057 704 1052 317 519 775 1354 918 153 440 338 247 640 730 1211 87 540 1030 664 997 725 711 1270 126 1213 1310 6 19 817 1201 185 235 919 592 425 665 1177 455 84 79 467 733 518 227 884 1013 318 1157 899 888 861 323 1223 843 401 1084 1144 1041 1152 753 999 103 905 1145 382 536 1247 589 718 198 881 280 738 404 756 1197 1073 621 1151 59 783 676 509 766 869 827 1071 29 965 764 1267 577 1210 179 391 1111 307 902 836 1074 574 1312 367 995 1294 119 61 1039 1063 245 1189 535 643 1031 734 282 985 683 1072 550 148 908 887 1014 290 478 1009 637 483 45 924 543 60 152 107 354 67 155 705 1003 697 76 771 780 1012 259 912 947 857 1045 112 935 891 662 1099 975 1008 1255 996 1186 1244 937 871 865 626 1262 722 358 395 867 728 694 1104 1345 1060 463 849 1128 793 580 386 915 1293 1070 352 684 1042 468 489 1342 986 1237 816 406 339 641 381 1131 500 1107 454 422 800 892 1175 370 953 776 201 1176 1234 328 569 1191 450 970 973 1367 502 798 714 1097 1004 962 140 136 622 1165 230 233 355 3 120 721 1181 1318 1134 135 615 216 98 36 220 991 491 1058 330 923 154 539 818 792 1011 1194 790 950 1129 149 239 113 1284 486 1028 810 628 938 548 15 231 1321 534 748 435 256 272 453 964 193 804 610 692 842 376 456 1098 241 189 1330 1299 129 170 839 634 677 647 298 971 654 493 1150 278 106 1375 600 1261 538 419 142 968 1239 1278 862 363 629 820 470 1130 147 1086 503 957 1371 271 476 896 1038 1108 599 699 747 630 1221 651 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 26
]
wts 2: 1070 218 854 980 398 912 1267 304 230 695 215 326 879 376 302 1077 202 868 399 438 581 1217 400 1277 1169 529 272 767 545 431 462 590 222 673 504 694 227 1119 573 403 248 1157 910 1303 359 1031 1027 955 112 918 833 339 562 1295 849 896 1068 540 720 622 1315 111 321 1072 1243 445 604 67 891 46 1319 856 28 1190 817 330 1291 1025 555 71 663 1219 806 557 1088 316 442 638 263 443 558 905 61 1073 842 1278 837 343 1024 548 1239 325 286 718 713 382 765 607 439 953 937 1234 888 522 68 369 1162 100 307 931 677 426 1342 209 10 2 213 452 1306 1116 201 636 490 527 503 461 18 1189 435 328 1271 639 1145 297 196 358 838 684 1233 702 501 786 244 902 1030 566 563 822 1269 275 11 511 859 1228 281 1265 259 791 159 72 1112 781 839 489 773 1232 140 899 834 1177 290 730 468 867 1106 769 108 92 387 528 132 753 1118 703 487 827 1282 1136 941 265 746 972 1264 803 40 1369 1202 1320 1326 519 76 1193 751 1101 971 630 1176 183 1207 874 235 463 153 982 241 58 1279 19 41 592 802 805 341 262 1273 1280 726 7 514 1096 1009 1197 508 1247 308 3 1058 173 537 360 13 1298 73 814 556 1035 1185 288 1281 947 317 176 368 278 1006 1329 9 595 1037 909 869 664 1015 1124 79 1022 919 264 644 96 419 251 1163 741 844 1324 629 131 944 1335 1325 599 280 535 512 991 1029 394 1377 355 1304 249 701 930 78 258 787 908 1290 182 397 1102 99 472 1209 211 524 353 855 162 1218 1098 238 220 172 526 59 1076 464 1289 107 160 1266 603 915 16 678 710 583 30 389 1358 414 696 589 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 27
]
wts 2: 395 980 300 512 1214 337 319 1353 11 475 1212 807 231 617 1123 144 508 174 389 716 501 957 588 358 767 1312 310 80 1159 916 631 838 245 438 1259 516 646 649 1268 910 831 383 1288 937 3 1357 345 1368 949 750 221 68 280 846 1093 1340 945 814 1330 919 859 1294 375 1011 10 530 834 275 996 1115 372 405 849 839 7 832 333 557 570 875 553 339 203 63 912 448 1248 663 491 312 612 681 848 1279 1136 19 725 792 1344 1032 50 808 1177 370 330 430 763 535 145 1045 1015 594 761 1207 902 248 2 722 273 679 733 5 154 671 862 1336 718 87 654 105 1158 171 1186 1046 543 740 914 1107 1191 143 1116 1305 692 131 684 20 1352 1053 1147 833 632 509 253 564 30 21 960 132 1165 1036 446 1261 598 225 95 1266 780 531 877 1078 422 1180 660 1104 586 1085 149 26 726 1298 1324 868 164 606 406 997 1269 1378 1282 864 926 1325 773 417 803 487 241 1278 282 1337 711 589 360 911 197 522 43 882 450 386 816 1296 897 698 1362 179 1220 1135 129 1124 1048 1209 806 1342 94 83 1153 1050 1121 790 16 850 377 677 561 871 596 585 1140 285 984 898 223 1346 853 748 262 1071 1202 1106 932 873 220 894 219 1068 785 1176 1255 703 732 182 1219 1363 650 471 206 924 1307 215 676 260 930 72 626 322 1120 687 329 217 583 514 772 120 580 176 359 1003 1164 447 354 403 810 685 467 847 431 362 746 815 1087 1200 443 18 992 981 226 634 1000 844 119 956 192 1358 54 41 829 579 723 193 286 379 691 1263 1310 929 709 1151 1281 517 466 941 313 134 31 710 402 27 470 148 1020 506 775 86 342 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 28
]
wts 2: 230 749 448 1086 1182 1038 1172 754 181 128 832 595 305 897 377 667 494 873 670 1124 1217 1162 751 456 1127 276 913 42 1261 1012 298 576 413 1057 581 938 861 374 1036 1216 74 664 847 457 1204 90 953 768 829 1080 172 1131 420 219 3 1046 1301 145 286 1317 7 132 206 521 1380 65 1256 163 798 1189 1120 126 98 1187 1186 659 630 1181 229 940 16 461 602 345 1331 79 104 671 593 360 618 385 151 835 1001 975 880 700 20 1194 596 785 1098 929 167 372 203 1288 1313 152 640 888 27 675 1037 19 770 223 1200 731 378 1323 1343 689 668 1265 980 460 647 102 1322 734 92 337 225 918 1278 1061 1110 1250 294 220 1271 1092 747 325 442 222 1100 735 558 936 1267 424 651 48 290 801 1314 1208 484 763 1088 562 969 297 1119 520 1117 1167 501 828 185 436 432 964 1123 502 669 529 855 97 740 69 1311 1050 263 1218 478 778 895 748 848 1373 1234 313 149 451 270 322 56 131 233 1219 84 1134 1350 1238 307 891 473 1347 52 262 1192 1353 844 527 950 50 860 773 568 814 1004 606 582 628 605 235 875 1275 765 1240 1072 1091 123 556 561 984 209 37 538 1336 710 440 531 467 673 1292 1202 319 366 767 1177 745 1153 987 709 410 1146 732 948 923 441 477 156 282 1282 8 146 1365 268 1176 272 293 653 100 519 715 1005 1108 1121 362 560 43 232 611 623 384 522 842 243 369 890 383 1135 679 955 1368 296 464 1094 571 32 967 657 1178 335 1344 982 271 406 497 1337 914 435 1084 1099 826 1364 476 783 1089 300 6 343 901 821 621 766 1332 419 236 1277 59 1137 1115 117 893 645 1011 295 253 200 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 29
]
wts 2: 593 159 609 62 1135 525 1015 1034 1086 806 975 1087 1267 175 139 878 843 202 411 792 508 865 782 1011 1315 1082 1255 580 120 416 773 1287 463 76 316 475 279 1005 174 340 303 160 913 1356 1365 1354 621 45 1284 699 1203 1341 648 1260 803 825 399 466 61 835 1297 516 145 469 624 712 1164 775 27 672 1084 954 388 856 17 55 770 1370 1201 1304 659 420 1262 254 743 267 655 1040 105 1009 836 577 405 421 1074 1282 1117 19 1243 189 1247 262 1170 829 166 1295 1298 647 104 644 885 692 348 558 535 936 224 1363 1248 346 310 561 1 387 889 1256 943 1142 1137 280 969 39 70 799 814 933 386 1375 355 95 40 935 941 1047 738 555 706 810 1090 440 532 1278 291 366 1147 650 690 599 970 540 813 1085 734 766 1068 185 798 1114 1150 1252 406 288 226 570 862 211 193 916 750 515 222 923 1197 296 313 404 1076 1149 590 514 618 248 604 1116 1021 1306 34 1207 1327 1376 72 1254 382 479 960 562 528 596 194 1296 967 556 801 499 1016 345 290 977 328 1222 1219 994 1130 1166 709 684 588 83 615 779 918 1070 378 414 536 702 855 1192 794 482 1044 37 12 90 269 903 385 1261 805 963 442 827 489 952 927 412 1333 1080 492 1107 1242 920 29 852 905 232 673 352 526 503 318 305 983 764 26 359 306 1307 735 339 809 152 1124 1216 605 1156 966 886 902 13 1060 1180 376 926 341 663 295 383 107 619 64 212 1050 973 981 1275 598 760 1200 573 351 1088 832 1127 627 925 613 394 1342 756 1294 831 642 1283 38 1318 1033 942 968 260 959 586 165 349 1083 1059 1069 156 1072 559 612 531 1168 221 957 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 30
]
wts 2: 385 175 1023 72 750 453 474 243 308 888 66 2 321 1024 1153 912 20 67 852 656 935 142 163 4 1156 635 260 564 306 113 889 1378 876 1373 1232 270 302 647 275 1088 567 1286 354 1216 746 347 776 1281 1295 824 1103 1345 43 1051 1258 1021 1152 206 1185 1040 1196 927 289 607 723 548 1172 1248 545 203 105 1121 253 375 1342 254 1037 189 1167 411 728 334 187 1149 1307 299 582 1077 697 100 468 360 1365 1197 146 1377 255 1311 120 628 1303 838 154 1357 1035 1087 1014 394 1093 1168 836 982 1300 1017 798 926 915 1049 766 130 896 31 230 502 978 1315 1245 387 1329 811 339 1367 962 1340 1256 954 418 398 1022 1211 631 197 819 1379 403 851 522 914 1301 913 1019 1264 432 129 1230 707 1057 662 1200 269 440 574 605 1310 709 517 853 122 186 985 165 423 606 767 488 8 670 1341 1082 1251 415 1233 1130 1067 680 352 918 396 1069 1036 539 1074 872 1319 447 555 827 648 60 335 651 209 340 587 1364 1105 193 109 655 298 1351 866 78 1254 318 5 1065 1123 941 773 311 636 75 505 911 967 717 1360 736 987 1009 541 261 855 575 1195 1157 1189 664 434 763 712 760 420 1267 472 18 899 469 27 1312 247 955 307 1299 1366 131 769 1008 576 1372 314 294 716 356 994 19 1104 6 1201 806 1066 1291 944 462 1109 1237 960 1076 1346 500 1144 1046 350 161 676 931 114 738 596 672 652 98 950 634 179 633 650 1218 534 501 779 690 1094 598 494 701 895 229 343 569 325 536 1073 542 495 1225 733 964 30 726 279 1204 1020 939 330 1239 283 286 804 499 580 281 1298 125 1332 749 223 1139 246 86 854 1178 1164 844 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 31
]
wts 2: 427 962 734 536 1070 112 1138 301 560 440 535 483 547 1358 1263 1017 818 378 699 336 564 442 1309 166 78 816 1003 300 642 282 690 1105 435 574 58 898 1316 24 426 1212 199 697 1344 682 1330 1231 771 622 362 847 1157 1016 539 305 658 870 604 1281 354 1035 246 1223 429 418 9 1342 254 1100 159 1167 339 1091 1015 1044 481 414 1120 1168 659 1241 248 74 786 684 767 827 288 597 918 509 1190 756 41 53 1189 780 650 1075 17 25 790 1154 297 108 964 369 1262 506 912 858 589 79 232 992 73 857 1019 873 403 943 512 1159 1225 1010 76 341 768 973 228 383 871 903 1314 942 453 813 77 1057 499 1228 882 880 829 384 13 701 648 102 872 1328 397 147 803 1086 90 1037 1020 460 1147 817 374 859 186 1211 600 477 290 994 1345 1268 110 304 419 615 214 841 334 179 432 762 1218 1045 1188 469 1253 352 474 207 1083 1294 382 949 1132 1087 1113 388 422 1233 404 1125 225 308 1242 223 272 28 219 1285 157 98 39 137 1171 1273 285 359 1127 1155 406 625 1360 491 523 125 1213 663 1267 158 989 1355 939 1207 505 1377 462 1313 1143 981 1351 833 710 1052 217 457 887 932 1068 1064 777 534 576 343 250 1277 554 1139 1175 192 524 1290 689 593 821 502 455 1235 1308 911 23 441 1030 375 731 559 497 111 692 787 1376 978 99 1322 1074 1224 603 1006 1234 165 356 1014 538 267 681 997 346 1217 678 322 1255 856 1177 1184 281 4 401 1349 993 188 1126 150 15 909 365 1232 204 824 51 210 148 464 713 1329 1227 428 533 1271 253 70 855 421 1246 89 345 1371 774 743 501 586 8 402 81 1327 433 986 423 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 32
]
wts 2: 17 1367 1193 1145 948 1257 1286 32 1115 719 943 744 299 207 1080 1110 43 248 1047 1117 627 430 1337 1378 821 340 289 732 1301 380 726 188 1068 187 305 1352 782 514 1186 668 277 638 1292 245 926 1229 15 601 902 1351 1198 1130 1109 34 1231 554 1358 130 163 1101 796 691 765 941 775 518 463 639 1261 1174 1106 1372 885 966 1342 800 660 1277 393 548 628 670 1294 1334 247 362 725 1246 168 519 855 887 673 1059 101 233 1065 702 1113 113 1105 828 910 589 611 1011 866 503 367 1219 1328 1019 1271 619 65 311 229 1085 667 293 66 1324 1227 284 416 63 384 156 653 1073 112 573 1289 568 1104 143 632 1264 291 237 580 560 585 417 47 831 967 850 217 1197 395 737 557 1304 912 919 1243 1181 920 297 576 346 355 69 1118 805 883 685 874 1256 588 1218 496 493 1148 681 1014 99 279 252 159 462 830 244 970 507 730 1166 987 25 178 74 1321 996 772 1153 663 107 848 1230 1353 201 950 928 359 261 1017 255 1359 781 76 1180 857 292 418 323 1066 915 338 1273 569 501 896 540 265 591 751 959 48 1354 904 40 1002 1134 365 995 505 785 320 924 345 1077 280 803 106 1362 690 1024 12 795 739 606 4 498 144 1 969 656 1173 1278 164 208 1094 339 921 843 104 997 1360 453 1060 1245 1154 1075 315 798 1306 193 1142 1267 1320 882 841 704 124 980 718 1297 1317 409 792 839 241 515 807 333 1070 1111 894 1281 914 1300 1350 447 1299 183 1237 615 870 918 898 337 1191 746 1143 439 906 422 1116 720 260 1043 379 206 502 905 290 1331 388 1022 103 251 1254 220 753 594 840 184 1316 595 957 582 847 936 1212 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 33
]
wts 2: 300 776 506 704 176 485 472 80 519 801 311 308 1022 837 4 850 854 149 437 795 1240 467 15 1352 478 136 464 13 99 1089 952 332 586 1225 828 602 1149 1237 274 572 1018 173 1229 215 301 148 507 78 566 57 735 388 1024 483 510 1221 85 199 1345 384 1326 629 1362 1028 137 892 939 635 642 121 102 739 761 608 523 382 527 287 881 1203 28 1189 118 888 288 406 236 1271 275 180 781 910 1320 1168 436 259 994 1155 564 716 841 864 918 694 487 782 1310 943 811 514 1067 328 756 1042 1006 476 955 1173 17 290 698 81 1182 1319 796 237 1379 1286 1365 530 320 1034 182 220 403 1254 345 982 69 401 631 96 355 51 657 443 207 771 79 868 1146 695 1250 86 928 718 1294 144 1325 780 1307 815 432 661 1302 1337 407 877 1333 539 335 1090 151 1356 552 1363 350 140 634 768 398 925 201 863 1253 298 433 1197 163 248 827 1264 387 89 1044 124 261 273 1216 1339 1284 677 1290 1261 416 493 291 561 2 427 447 691 759 822 367 1194 701 313 1255 1167 791 846 880 567 271 1304 253 762 799 760 917 633 474 1249 277 1217 266 239 626 606 625 217 690 128 578 750 198 481 292 1052 1188 1357 402 454 923 772 365 898 1243 480 649 484 1143 1317 1241 377 884 208 115 655 790 1026 978 1212 1029 777 775 593 255 431 620 373 1109 851 338 983 362 363 575 1170 336 1190 94 392 570 1048 1166 927 1186 707 555 816 894 1063 225 16 839 323 1031 607 1017 988 644 947 814 856 802 91 66 610 786 87 1153 344 161 1349 604 866 1299 1370 1008 1158 82 1041 980 1152 32 646 315 702 745 1351 665 455 1366 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 34
]
wts 2: 272 663 269 1342 339 1231 1015 521 505 904 1196 693 278 1045 522 225 427 283 1306 692 270 229 156 207 306 480 1379 469 1166 551 1093 1209 726 29 280 490 1234 990 572 275 856 1156 311 1372 462 1003 429 247 482 2 555 543 623 1286 1058 1296 295 438 635 228 704 1213 424 85 826 542 155 713 1033 212 737 679 1243 1191 1157 307 967 1009 836 255 1135 634 1132 514 376 1353 184 185 50 595 661 648 1370 117 571 62 383 677 504 519 617 671 19 968 1322 568 372 106 52 365 285 193 610 863 5 1077 337 819 468 204 217 313 277 89 1240 274 1115 1252 1016 638 240 642 946 1023 1186 149 1075 750 878 641 346 152 618 731 1121 65 345 1320 1301 971 375 974 1065 1262 197 213 503 882 758 675 1329 1223 689 775 748 958 1290 1318 1079 1110 107 653 805 558 1032 1343 1049 706 1099 1326 327 739 1171 98 282 1144 208 14 696 767 607 658 1141 175 1201 191 314 384 1259 646 1352 1028 222 746 102 562 717 517 319 627 880 762 594 1021 566 344 1035 1161 567 1325 718 1260 1197 764 70 1321 437 765 1214 1071 876 626 804 481 960 716 492 1228 1095 1217 1230 1362 893 1287 367 1246 1113 547 590 911 450 1042 9 733 1347 575 69 520 747 67 1006 1004 371 28 898 1098 202 615 724 159 763 525 441 665 205 32 657 147 390 1151 1090 133 894 1309 719 1298 1044 1187 933 881 13 169 936 780 273 579 676 818 1124 1167 1317 406 233 788 394 223 1268 407 957 1254 649 518 301 1154 849 112 328 459 1330 399 811 795 581 644 123 927 11 736 922 1128 476 1275 425 1272 1081 622 993 673 1001 857 179 234 1340 844 1206 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 35
]
wts 2: 298 241 1105 1036 68 683 848 589 254 36 469 1206 1346 152 1380 1032 850 138 937 887 120 900 853 1292 1227 543 629 1375 879 1247 287 961 43 613 625 346 395 1020 973 487 1141 621 214 659 1329 915 1107 1 385 1155 661 950 245 619 35 632 460 48 319 13 875 349 674 1374 1162 657 1229 1297 715 2 145 1040 929 1090 1031 749 446 1015 1129 593 1277 828 991 781 151 256 161 102 1122 366 1160 1349 130 140 95 275 1017 184 579 553 670 1003 213 943 1054 913 437 1133 734 1027 188 24 251 824 438 763 1343 462 3 1299 25 218 790 347 592 1376 838 1018 886 506 527 694 1251 127 392 797 1048 541 1315 40 787 262 806 496 1168 540 643 570 447 1051 439 740 1351 1258 756 329 57 958 947 649 79 72 1230 515 1248 257 32 873 647 475 678 1185 504 307 509 901 286 666 428 1280 641 963 1016 667 571 360 481 862 457 753 710 1140 467 12 1091 1257 923 1001 141 204 1314 560 927 284 526 545 1233 440 1216 1026 93 1222 160 55 69 583 948 859 762 1204 878 872 376 292 544 354 311 196 200 686 1246 1286 833 83 418 158 210 299 673 290 89 1353 62 1305 992 1324 751 1138 266 303 176 476 987 272 1296 922 590 826 1239 1225 80 1085 623 97 339 264 1266 405 857 1354 414 1009 1149 969 139 773 205 433 1132 1301 322 452 1060 968 394 1234 731 906 698 1321 425 479 793 614 1069 175 1033 64 167 1092 1378 1010 591 199 934 458 374 655 561 209 365 604 413 606 359 1053 999 442 464 726 340 1274 978 633 511 401 741 618 552 326 84 318 523 396 398 881 1005 274 202 707 692 717 410 928 782 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 36
]
wts 2: 1090 258 724 510 1283 616 520 7 1203 16 1137 1344 211 396 866 450 993 386 880 371 493 761 227 72 1338 835 383 58 618 9 947 567 4 234 313 1123 933 277 682 1022 231 881 1121 1348 390 316 801 1042 69 146 1370 1002 12 1193 409 1158 349 99 15 805 779 940 11 1122 525 935 1317 777 519 41 508 1141 271 959 655 389 279 1343 159 443 216 5 267 778 615 762 736 311 1065 754 781 466 346 1366 1334 710 1 294 1221 970 974 64 1315 304 908 8 1009 1015 329 695 657 270 561 1013 760 626 1011 263 662 885 1165 241 904 896 676 840 1358 1198 201 1232 1151 507 382 620 819 394 1069 897 472 1312 783 604 198 194 402 38 1092 158 1124 1169 1215 1153 1186 1160 442 586 26 596 96 590 646 366 1272 61 431 612 343 991 461 1325 447 1314 1094 976 782 816 554 398 1218 167 305 1164 44 592 1166 438 1146 882 716 1082 527 1187 818 140 1175 284 1140 704 79 666 1115 365 356 203 1012 76 259 553 789 891 860 1076 759 850 1297 170 372 702 1081 774 1301 751 145 302 945 81 867 1230 1145 324 763 972 1107 317 204 923 223 1180 20 173 651 672 453 183 982 37 765 17 550 901 310 127 728 1176 955 597 492 671 249 1292 509 1222 407 730 1025 1233 834 627 306 360 275 1352 269 529 687 647 684 729 367 1247 406 861 841 892 961 320 1030 154 994 862 358 1157 895 149 1284 178 1209 1114 1055 1246 1070 1038 975 1110 55 224 868 429 157 85 1048 642 330 341 381 601 89 345 1143 1355 475 1212 1273 142 414 535 930 172 1168 1293 877 1173 871 1072 552 992 139 1311 1063 832 1280 749 445 1008 1142 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 37
]
wts 2: 455 764 188 1046 286 708 192 327 198 941 703 942 754 12 1041 994 1335 756 895 853 1300 1058 464 883 135 241 1306 288 892 225 631 998 219 598 71 237 22 1121 1241 647 46 767 145 748 739 679 759 1077 834 625 685 546 405 709 158 866 527 638 741 644 825 1119 916 1090 487 529 960 466 968 276 393 1358 877 1263 407 191 1168 803 486 1262 1059 1179 1107 1258 90 69 266 96 983 939 172 117 656 214 229 396 1264 513 737 995 1375 1120 577 575 1374 808 193 648 984 809 1167 842 1226 760 41 551 483 31 66 403 677 184 171 74 1307 884 728 138 830 47 32 1235 408 1082 885 890 230 1016 413 314 1267 943 839 1011 1042 1209 874 183 1013 662 694 729 120 362 1178 718 565 467 491 867 510 862 1103 333 236 498 437 177 562 414 293 306 262 963 1009 139 404 268 882 1231 92 1163 269 932 425 676 370 251 820 950 757 569 1170 1169 265 698 1324 412 899 1127 894 1177 245 675 366 323 287 935 589 821 365 517 1212 1098 1242 107 1171 745 1240 1131 518 896 173 1138 1003 800 257 606 736 1000 901 733 78 1195 908 264 1162 913 1069 742 255 1372 579 174 104 911 460 189 250 260 1094 434 714 1257 1020 40 543 114 1156 652 233 775 1060 303 213 1080 587 898 9 356 750 449 99 55 54 981 1158 377 622 223 801 1166 715 829 1155 166 684 599 1330 1161 792 165 1361 593 481 1017 561 1200 629 793 1247 1097 528 457 758 572 261 313 1015 106 1150 1256 817 1146 666 1255 695 337 409 831 256 170 420 915 360 441 162 724 1239 586 604 699 1187 910 367 1024 463 1220 281 576 654 112 394 1329 452 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 38
]
wts 2: 782 712 1268 93 450 1302 1133 1096 1076 988 480 321 268 672 127 1064 231 572 834 1289 237 905 1035 819 66 1136 1232 558 1057 1177 1348 580 1206 1197 726 1229 153 1255 1332 37 831 1217 556 1252 1221 857 330 1040 1093 1116 683 732 1193 455 1094 272 746 1084 382 1304 1153 83 827 660 854 384 366 960 1186 1364 399 217 591 195 133 494 178 364 70 199 871 361 1138 799 1254 610 240 798 923 492 396 87 1282 940 1227 371 282 537 1016 187 229 226 1101 804 1350 119 991 753 518 491 203 421 74 1134 1129 1110 113 640 109 563 235 955 918 1303 883 339 664 121 589 30 1137 1066 171 716 365 863 156 892 658 1007 1251 99 24 924 1314 986 355 845 1339 162 794 546 1286 810 1316 548 1103 173 832 351 309 80 26 1149 1371 475 644 1294 560 54 528 72 403 234 1317 105 828 1085 1220 1086 865 981 1276 699 248 853 932 1278 895 29 17 256 92 444 1176 999 1159 2 1073 774 476 1172 757 194 135 1370 490 1077 377 584 738 1196 756 373 1154 1025 116 603 922 993 1052 772 930 418 778 770 730 1233 996 408 1179 1044 561 710 391 791 1253 434 317 755 890 877 189 761 368 58 227 793 1269 622 709 65 989 598 260 962 247 1298 983 302 649 542 471 281 1181 1078 59 73 1247 998 214 1060 376 347 183 68 693 530 1212 745 956 909 253 673 695 1377 859 1100 594 460 661 1342 1099 527 818 1000 326 982 71 1266 856 246 776 1089 815 280 467 903 103 790 388 638 151 353 1323 583 305 1082 320 869 511 700 67 780 170 409 297 1234 1058 33 1182 691 754 669 454 172 760 1218 1240 1126 961 964 327 111 1061 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 39
]
wts 2: 716 854 346 180 581 1277 1358 3 914 1371 331 476 353 431 1256 1047 1238 186 485 944 425 486 1140 847 366 407 507 650 1001 1042 801 553 654 1164 315 1323 955 978 327 129 910 1095 1282 527 809 41 1190 926 299 429 931 951 574 909 942 237 595 991 1157 1078 1230 1101 538 1241 1059 735 473 1045 1179 1199 1351 277 1150 831 319 804 631 753 1194 1339 820 72 1307 85 375 1249 24 1051 1185 298 243 1348 1105 1250 1354 772 292 676 19 950 372 1088 468 1070 1092 403 701 417 100 1133 128 1013 454 608 1183 920 946 555 563 501 496 997 1343 322 1110 127 1145 819 1184 104 453 714 1318 1077 1284 1103 539 702 46 1378 6 1304 348 780 711 923 777 500 33 861 281 689 367 9 533 88 964 935 651 169 575 94 1049 393 113 273 550 975 295 1119 675 56 22 395 967 730 601 1361 905 646 413 540 1076 269 833 1020 1186 456 796 30 576 1312 1345 917 863 695 139 1259 351 384 774 321 1288 1263 43 219 890 609 762 59 378 34 760 849 846 166 1221 394 1198 973 212 718 224 960 813 522 1091 1118 202 994 843 990 1081 1252 848 1313 1130 721 495 1161 69 976 637 86 880 288 733 124 338 1174 738 597 42 798 47 1143 83 1032 1115 1368 325 1041 427 152 995 655 821 498 330 164 799 148 1104 374 624 160 768 825 188 605 1377 897 1080 758 264 118 5 467 1203 479 957 187 450 1232 316 1064 4 903 516 304 627 674 810 1325 582 977 1085 727 32 134 463 1152 1121 1347 158 734 506 21 876 822 1260 171 1207 583 732 1050 349 29 906 1097 754 1344 1253 93 1287 686 261 901 806 1375 1065 226 208 263 58 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 40
]
wts 2: 1246 1220 504 855 503 186 218 322 1263 1295 1168 178 1000 699 1188 886 1064 158 519 849 296 797 484 1019 573 1154 1326 1283 615 85 73 1149 1302 30 1080 751 768 703 161 1301 20 415 288 490 124 623 1369 1203 425 1047 679 393 406 1144 651 704 111 755 43 481 930 951 865 1289 400 82 769 334 1116 942 851 872 1039 455 502 80 545 575 1197 669 718 357 196 792 973 335 916 1167 578 618 1261 567 532 984 1193 312 994 1032 314 518 436 801 816 64 1179 788 386 991 807 291 798 234 465 1164 533 1094 556 721 1046 1223 709 1042 626 1336 912 1005 937 1373 825 616 372 108 1344 59 888 67 104 878 606 557 783 1331 683 344 175 78 838 452 771 1380 102 1254 924 54 1008 1030 28 32 236 757 1176 730 365 461 541 889 195 146 141 83 1024 1228 650 853 438 590 1077 882 329 727 1184 320 27 1205 283 219 207 923 868 784 588 117 1242 1148 1240 1066 414 319 1012 1023 36 524 1111 231 799 474 443 198 1026 862 897 79 76 1101 247 49 110 1122 915 239 325 330 1321 943 1074 434 1015 1345 395 542 713 898 257 894 692 1335 731 1041 190 171 170 249 402 875 1319 693 361 1095 126 660 1363 873 309 1370 758 302 536 72 958 1204 980 216 57 691 99 1366 543 857 437 86 628 1043 223 655 483 310 1173 68 53 619 1264 1233 1260 903 1356 331 640 470 1287 355 610 475 6 681 723 1364 1343 595 482 471 1298 242 612 1037 166 1165 398 523 1110 289 192 917 144 1211 591 647 45 716 266 815 1152 1249 130 834 1367 446 992 1219 290 1115 375 1372 741 1181 585 805 1337 378 182 932 1190 740 1310 240 800 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 41
]
wts 2: 1304 296 241 427 928 1265 483 189 289 577 874 834 1091 703 1346 448 957 814 608 556 365 291 774 488 279 999 781 927 109 820 1228 1086 1048 1179 239 136 864 1049 880 198 840 110 782 29 389 11 1252 760 1299 765 1135 25 317 994 376 10 249 684 1211 639 493 463 1231 305 635 219 1209 183 244 51 744 306 1349 695 423 726 1242 598 740 1263 37 27 353 603 1156 941 867 138 30 228 668 43 648 1074 676 1151 79 56 386 606 7 932 709 623 357 585 15 929 355 699 536 512 358 1069 1101 385 194 905 1028 546 559 1244 1267 343 328 644 835 586 220 1238 1051 902 660 436 1153 1075 287 896 1351 57 26 901 755 893 1202 538 223 147 605 1002 757 625 930 366 92 461 129 881 1019 435 410 1321 511 516 675 139 599 430 500 490 104 1284 752 671 330 214 1240 1318 1111 1171 810 1246 271 754 777 91 809 647 1076 547 55 1194 374 719 286 199 897 974 1260 465 304 439 1269 830 412 1376 1204 685 555 528 924 904 952 1113 590 551 377 969 672 875 350 763 1143 290 174 987 621 571 791 396 451 471 869 618 359 860 548 119 1310 998 1353 450 469 1291 789 1286 521 140 28 18 845 855 1115 467 772 541 1013 364 1223 1088 4 1128 1109 102 1068 34 694 591 822 106 84 885 1 127 920 950 979 1229 454 149 263 1282 47 926 82 90 1130 533 1137 848 80 252 527 945 491 1294 993 543 797 1041 856 1183 256 1213 76 962 208 156 1369 986 1020 211 327 696 1140 680 966 1081 778 1057 186 879 1152 431 524 641 539 326 281 170 517 74 1331 1197 1226 620 440 58 1185 1329 177 1015 368 498 1024 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 42
]
wts 2: 1002 432 884 181 941 810 764 386 685 130 992 597 894 524 476 932 1082 1045 232 876 710 797 777 689 833 1057 137 98 498 1239 1367 419 92 954 1359 811 926 210 345 143 1189 726 1000 962 1128 1205 303 110 859 459 367 856 131 501 896 505 935 1086 1352 1350 504 796 409 575 928 252 84 446 569 1120 703 1048 1066 1021 403 590 1110 1146 1348 1283 939 78 1030 905 901 1126 288 942 30 632 438 379 1206 1217 1123 812 1366 653 719 1376 1090 142 196 1261 852 882 162 1338 271 156 491 716 187 626 1208 1015 708 294 757 1360 246 1294 381 265 977 658 233 1254 1271 62 1150 579 749 1104 1196 531 946 119 315 28 31 1213 742 435 991 15 304 1094 548 440 253 321 56 1019 853 1380 738 416 1288 496 550 1034 220 454 785 924 610 175 365 1317 226 1108 1343 193 67 480 955 925 153 1163 1117 839 869 108 43 372 218 222 114 1274 404 1369 895 328 322 159 206 776 886 707 1325 1024 735 225 835 1014 634 563 696 843 885 1041 1031 645 1236 933 520 766 13 489 525 1092 832 1267 979 305 1344 1223 1144 1226 758 690 1300 178 290 177 1313 261 1351 34 720 5 972 516 301 1003 914 1316 1147 996 58 168 411 565 510 412 984 628 605 855 1190 1243 23 360 1299 259 940 380 1278 681 547 993 718 350 1298 138 437 467 580 378 458 1230 74 848 357 1284 763 934 825 542 723 1172 1285 1371 570 1001 326 1375 1198 1062 171 964 620 219 481 452 500 1010 1269 420 393 9 1282 1017 3 462 279 40 1051 24 1266 631 527 150 1099 273 878 133 910 669 755 287 1149 1241 823 1328 349 666 146 502 684 629 1043 564 1124 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 43
]
wts 2: 1303 617 572 565 933 163 453 441 692 323 680 723 355 1260 1182 821 541 105 867 1150 756 1325 386 555 1113 125 900 338 845 1324 941 922 529 1009 56 51 217 233 917 365 185 846 615 834 439 305 881 416 1264 690 419 655 705 544 505 483 1014 1103 231 616 350 1026 1222 727 380 485 188 595 957 675 524 136 534 1037 222 583 43 558 205 1046 1108 649 888 833 622 1270 161 542 788 882 44 299 765 1104 263 1192 283 455 1020 85 164 1255 1209 72 1128 180 405 737 658 234 1181 1066 343 165 1124 836 650 1208 947 376 143 223 431 669 246 560 679 685 1226 934 873 98 1021 1074 398 265 1249 356 406 519 1168 584 839 109 886 832 1248 589 828 807 1231 1347 422 1146 1223 358 530 45 142 52 953 121 1036 287 810 102 903 596 364 1188 192 511 472 674 951 64 428 988 503 1089 119 168 1106 198 653 329 1310 1023 1276 293 413 889 870 986 940 732 1298 1339 1117 62 693 1164 486 1205 1002 195 374 1286 1289 1049 183 514 795 1018 571 993 1256 838 418 123 804 460 1076 820 1274 721 662 1252 769 173 47 467 557 614 219 133 624 802 1109 1160 510 1052 1065 420 427 709 129 253 1234 384 211 273 1173 1376 775 1088 1279 793 640 1230 818 768 153 482 1319 407 100 1025 581 490 159 1309 48 1195 1133 877 497 257 716 767 980 14 216 1284 1100 465 452 288 600 298 1246 31 1219 170 757 585 295 82 938 243 1161 1139 204 638 1008 1098 892 132 636 286 248 274 1297 1137 865 225 532 235 860 1024 1031 681 332 895 110 924 498 749 189 897 547 967 570 916 1099 931 1038 549 1084 784 914 1235 1369 166 773 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 44
]
wts 2: 77 191 1260 1312 809 134 1246 631 380 1145 498 90 333 874 762 55 121 244 923 617 940 416 644 1197 1259 1361 889 561 785 1068 351 763 592 274 462 1091 1058 620 706 163 1018 798 746 1100 722 78 860 981 958 511 1192 955 1362 911 579 87 770 143 1019 562 1170 404 507 1330 235 362 131 394 594 1261 569 158 408 256 739 1080 240 636 1353 998 1302 175 273 106 906 1254 86 344 938 289 972 233 760 1279 715 953 685 1055 971 781 1047 1308 1166 1177 271 216 68 3 827 1118 974 504 767 645 615 877 210 584 192 423 542 837 1360 1267 384 1158 992 1201 368 547 738 986 1313 933 1057 545 905 1285 931 168 331 1376 505 1240 1061 554 1276 1072 997 393 119 1335 48 514 61 772 108 727 1352 1088 220 282 1116 1000 1045 564 1275 1073 296 6 427 1247 1124 208 609 800 284 560 89 932 110 488 320 464 1126 56 22 450 189 1153 1374 164 871 295 1042 1131 686 1008 1053 308 502 1023 586 337 403 689 818 32 1257 1277 1223 412 634 178 461 862 11 85 1222 120 5 252 429 19 1016 1316 1372 1092 1094 1321 1078 846 392 225 1044 144 939 313 226 708 989 364 1111 214 1178 1022 1028 790 186 619 222 1196 81 453 201 792 891 1307 723 863 787 784 1340 353 1334 1186 129 510 1242 492 1370 950 774 115 1233 1327 588 1112 878 405 1320 924 1315 66 725 1085 1176 1130 146 1346 517 135 473 563 79 1035 929 649 1161 954 718 234 1034 759 676 1010 828 1212 839 474 679 1056 1162 1194 1046 1245 1180 283 1288 1067 23 1173 1075 141 460 1304 729 803 1115 840 1264 329 402 618 825 943 360 196 366 1167 1364 475 275 959 238 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 45
]
wts 2: 588 679 1335 803 236 1260 211 673 160 401 452 535 154 1295 319 496 29 1168 420 906 187 941 966 1358 1343 306 914 467 532 1310 358 715 204 779 882 844 886 968 1210 1104 1102 1 1372 1121 295 17 1267 330 329 145 1371 952 1200 915 212 682 676 533 23 302 1174 594 1099 294 621 1060 641 288 499 494 47 1162 1068 377 315 9 819 770 1327 60 373 190 651 206 706 485 203 1263 80 1056 1040 1176 596 714 763 163 680 230 284 513 863 1231 1061 1182 709 192 1370 56 1357 1320 175 599 987 233 712 769 132 1275 1349 1355 934 1289 459 61 878 1026 1129 1109 1020 202 1017 642 905 123 57 266 908 1342 488 231 648 1093 1173 639 813 929 384 802 799 406 1317 97 720 340 1009 255 337 1247 77 1116 1254 339 1192 438 689 510 909 248 549 1209 27 692 400 1049 1196 458 683 137 702 731 486 216 607 904 436 732 865 887 1150 33 286 766 608 35 265 780 1101 6 836 965 757 434 447 765 1273 1202 975 1084 855 129 957 1285 741 304 1161 244 254 584 390 1115 775 949 598 1035 491 808 890 419 178 177 624 538 277 783 1266 1156 412 854 195 237 665 1053 1164 296 1339 744 576 861 199 1191 995 1001 1227 405 764 159 11 14 44 186 1321 694 223 1277 240 440 179 162 859 455 942 184 118 70 26 1296 786 668 792 442 81 1338 528 969 719 1318 876 348 259 322 1282 530 514 312 8 181 1048 883 1217 943 310 1011 276 126 1365 482 268 1138 586 425 1333 42 734 98 208 823 433 1008 623 298 1242 1330 356 30 209 1304 1228 666 933 955 958 448 931 917 490 1351 66 291 616 900 781 593 127 416 846 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 46
]
wts 2: 323 352 545 1271 212 649 176 217 1167 331 1046 108 769 109 525 153 423 1195 470 1328 593 772 1170 400 1155 500 934 943 552 832 401 955 1009 886 376 733 238 148 958 565 1332 877 1290 156 623 110 708 842 845 942 1308 604 758 1264 904 564 1300 1233 245 1174 1319 878 49 936 801 444 946 1056 883 1242 1337 285 1298 367 232 418 424 473 1322 945 791 1222 830 36 821 751 669 1220 14 5 99 1032 8 1064 1303 619 824 304 727 1310 275 240 900 1162 588 737 319 793 1080 65 1012 713 1184 1 1055 554 1117 657 140 779 305 1312 1067 613 456 1262 771 600 507 671 290 976 52 1334 445 1154 348 896 464 1364 1031 670 6 320 624 761 739 421 183 1309 72 1356 57 1169 865 274 210 185 723 84 673 956 1039 93 637 947 520 1237 410 1047 1200 152 50 555 960 753 206 358 371 1186 745 1153 81 963 754 804 514 785 333 952 558 1114 1078 1002 916 497 1191 965 645 257 3 412 1105 388 90 182 1051 1335 1380 168 599 222 1151 815 1321 1266 1093 56 728 710 1181 485 289 353 164 1180 146 244 259 1076 1350 1052 999 918 799 22 493 42 827 911 428 717 1088 901 407 1268 748 1253 1156 1232 740 237 436 864 1240 617 707 806 1256 1082 461 1115 1050 98 518 880 486 915 214 528 216 888 1112 975 242 18 102 863 644 106 1199 950 427 988 429 553 1297 1302 997 272 134 85 923 762 944 508 1295 472 1345 715 559 1189 266 688 1143 861 340 1263 531 181 982 1365 1353 322 149 818 840 1066 640 476 548 435 589 246 1193 959 1236 231 1018 1198 760 234 996 770 35 627 788 892 1190 307 1267 227 416 797 684 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 47
]
wts 2: 1177 701 1148 746 23 206 315 584 7 628 1108 1269 565 1019 1371 908 914 168 326 41 1332 5 643 438 1317 1217 848 73 521 1219 708 1119 1270 303 433 686 151 1194 901 921 1290 1264 419 790 533 655 1374 624 903 561 555 45 167 1346 65 469 827 286 24 954 690 1106 1286 254 1016 752 765 93 293 677 1151 226 931 824 1239 1196 796 197 970 473 462 1361 920 354 49 918 730 983 289 560 212 200 1061 454 1018 778 794 761 169 1256 562 703 363 377 992 1250 422 139 1255 83 1053 1258 1028 629 658 528 952 282 600 855 218 409 430 885 604 1013 69 965 973 737 172 457 1378 1105 880 508 755 1023 91 661 551 1052 116 210 879 450 505 334 854 299 513 1201 728 337 756 1112 1056 532 554 753 345 1065 466 1257 642 719 602 689 1031 1101 456 1328 742 1073 1307 12 152 741 938 657 895 1165 947 861 370 1144 465 740 213 1121 236 1206 652 727 691 424 590 129 104 25 16 757 238 264 155 317 905 864 725 2 1210 634 1057 800 1166 936 1122 30 1111 644 620 782 40 156 961 189 1154 1372 850 987 1049 1246 1343 366 37 406 1247 1038 1335 1283 915 621 1020 816 185 710 384 1310 165 592 1067 436 937 1339 654 198 258 1123 391 603 873 17 1233 1190 103 870 386 926 498 1092 588 1327 149 814 510 1124 1195 188 570 239 164 1313 1341 975 147 815 789 145 567 48 29 802 6 636 669 818 412 143 1215 314 1141 571 807 967 136 420 347 1347 645 502 1004 82 709 823 1333 440 14 1337 613 182 872 1047 1231 707 514 534 1222 270 367 877 1234 1077 927 313 1074 793 300 1320 90 583 1048 357 764 1010 591 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 48
]
wts 2: 1101 42 644 254 914 997 428 514 870 625 907 76 13 1312 893 862 1033 50 639 814 973 56 291 100 278 1161 675 1307 93 73 1069 470 1177 627 170 947 460 508 520 901 988 779 356 46 287 319 338 176 992 932 157 314 696 1027 513 812 725 517 811 147 429 1111 306 370 1071 1103 789 1119 1288 909 420 81 1052 184 478 36 463 448 507 298 494 451 1196 109 1358 171 609 49 1348 1256 1190 1112 227 1061 1260 79 1327 87 391 802 80 1210 417 887 407 656 1150 876 271 255 735 410 1077 311 1372 439 996 1369 580 1285 874 1283 1145 217 226 45 681 146 388 554 337 425 833 797 708 984 503 626 464 1178 416 273 765 690 809 1097 1148 1233 241 722 33 701 612 1270 993 1295 307 820 236 939 1076 145 553 1064 263 1375 709 65 1302 1222 234 192 465 562 1341 404 1125 763 213 1044 89 1163 897 1242 717 1131 936 819 721 1167 369 603 111 891 92 1380 69 601 1291 173 279 594 1036 1137 1034 11 1321 918 1186 436 841 141 880 1264 484 1129 755 98 21 900 31 856 118 712 1252 1376 577 354 1066 738 406 1094 1157 195 766 798 1219 806 539 1068 585 481 437 207 85 401 737 178 445 272 778 393 348 423 430 156 1366 851 565 919 23 740 260 300 1224 110 34 435 638 400 1194 1230 757 303 169 455 1107 832 1221 126 422 1098 545 377 37 1262 155 1259 742 415 699 967 1124 602 1251 528 1282 1053 454 860 258 161 1045 776 1364 1338 920 1329 835 72 1057 387 29 760 250 1001 1255 341 74 749 557 456 1184 980 956 688 1284 1105 707 1206 1253 223 1289 534 1024 752 1360 489 274 125 732 734 424 665 54 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 49
]
wts 2: 1079 1343 1228 857 818 1054 208 704 960 773 1339 593 1090 498 332 1024 1200 1136 497 1340 1082 1100 684 1059 969 1216 362 259 255 243 1124 1178 1267 657 193 715 830 1185 98 1016 735 1360 396 705 292 517 1105 614 644 692 877 421 1230 769 1068 1023 505 176 540 89 456 962 312 111 827 1066 695 565 178 1303 1275 740 675 1208 200 1117 248 1085 356 5 1315 623 6 1211 1366 1158 469 168 161 732 650 385 1135 888 931 9 463 204 864 272 514 214 999 896 1005 1099 1240 1217 716 865 1091 1245 591 1329 992 786 425 115 636 778 696 777 294 157 87 811 371 813 445 482 779 229 1181 823 1051 1293 492 341 73 731 1180 867 1113 1163 1369 537 1034 874 175 787 604 424 603 118 39 242 1094 878 206 24 96 431 125 775 1047 1197 812 64 579 1116 841 231 645 781 788 1 215 968 520 1330 533 807 697 624 198 1326 801 1317 1212 491 742 825 965 1231 762 746 1320 13 436 1277 104 1089 1087 1131 730 729 519 665 83 398 608 220 572 797 1146 828 61 1362 315 357 281 1322 706 1189 433 799 158 747 961 1335 599 54 560 1365 282 859 561 244 748 203 816 536 982 660 1266 671 8 726 30 842 1109 586 917 1001 819 739 246 698 322 225 556 712 568 335 910 488 447 897 23 700 622 455 595 642 619 524 1274 252 1202 127 1227 734 270 654 1161 1156 139 658 408 1075 620 1162 933 674 1118 943 1261 585 32 323 976 145 634 441 320 1153 1375 656 404 659 838 809 625 428 1101 1112 19 113 1367 74 499 557 224 28 278 210 664 529 744 868 717 667 871 1004 993 38 16 863 947 245 77 164 1251 218 892 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 50
]
wts 2: 1303 1068 1315 830 1202 740 105 38 1261 1121 1360 838 597 842 1250 632 172 381 647 1262 152 1254 1112 534 634 496 510 466 629 1308 21 537 678 262 594 154 480 520 1049 1136 948 1018 1239 1247 68 725 932 48 1026 1339 967 565 177 161 265 990 844 1196 676 301 628 598 376 101 1314 1231 578 982 875 491 612 570 707 623 409 473 287 783 317 284 151 731 350 654 27 815 1168 807 896 1304 1208 146 392 858 1190 126 790 651 36 705 952 876 922 22 765 180 17 163 142 794 25 1174 32 779 921 1153 516 421 138 657 1125 1293 552 803 1073 1120 157 797 1088 1225 698 518 85 1263 536 1214 1368 1305 855 454 198 195 972 898 377 735 106 259 357 457 82 1020 997 1369 1313 401 1106 685 751 750 870 841 40 1273 1000 28 23 1086 93 325 805 708 112 328 46 1001 755 147 849 315 1009 160 231 275 1048 1184 1070 671 949 542 1249 856 1080 860 475 397 1101 443 205 1321 558 709 247 1183 1324 590 149 1037 550 1056 1061 1318 1252 1237 1122 1042 1105 975 209 424 1177 130 1108 406 585 839 1150 307 581 762 923 118 1191 777 700 580 1340 641 1128 166 669 423 656 974 165 399 69 845 312 614 1355 1275 672 1336 506 387 890 422 367 185 471 569 1149 653 1075 880 168 1023 4 456 847 591 947 140 268 59 1265 596 1258 99 267 390 1297 903 346 551 1200 3 812 398 122 730 1341 747 459 620 1169 1162 563 222 133 891 1289 1276 886 90 212 741 1188 1115 1187 543 288 327 562 773 448 6 768 237 579 1163 846 994 788 30 554 819 1092 599 227 281 1099 499 1194 1134 604 107 582 533 497 1244 897 1189 114 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 51
]
wts 2: 131 366 565 259 793 95 811 951 382 359 898 1060 1080 202 940 394 298 418 1152 85 403 958 619 32 128 132 859 1034 648 101 536 763 1334 786 139 159 229 605 745 59 44 1233 960 794 1072 936 970 1368 1046 735 706 1347 646 574 1020 206 363 463 980 104 722 242 551 1005 115 531 1329 178 1195 93 1269 923 133 1310 215 425 1137 1379 891 1204 1105 78 54 912 1159 342 315 1304 354 22 279 649 694 58 840 915 100 161 972 1132 1277 629 772 585 583 509 761 1276 395 957 528 842 928 288 849 487 589 486 1106 193 600 947 688 10 347 1054 1200 305 1190 427 1260 597 52 532 691 76 43 498 263 1187 1346 1369 97 1202 579 999 867 650 1198 417 1299 897 1076 404 676 245 74 1136 788 203 1125 929 1142 1028 609 322 996 1313 790 1040 212 473 956 1244 147 1336 232 1101 489 527 593 27 723 419 964 797 1298 1118 1041 770 234 1081 1235 357 184 301 125 171 410 358 889 1355 1359 838 1193 851 630 541 639 1222 904 182 754 669 330 176 278 1143 656 607 117 254 349 353 1375 865 1246 1262 13 998 921 1301 1344 230 297 30 521 1117 1288 715 428 23 1306 1349 1289 1191 1006 1051 538 275 697 695 614 422 500 217 756 881 238 282 281 21 266 258 187 624 186 1084 129 753 1256 884 1352 670 308 1181 302 582 515 446 385 522 1363 701 679 704 220 350 1019 617 296 355 749 460 841 645 1311 1170 654 602 1217 802 658 177 7 1097 1001 664 987 720 812 949 241 113 783 1016 660 8 792 1275 818 555 1251 73 1058 943 550 1095 612 1378 507 31 1291 91 1151 351 65 1292 1377 488 174 352 744 321 160 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 52
]
wts 2: 401 747 542 429 684 717 1294 413 11 1021 297 532 1285 959 1283 1134 61 64 819 639 1290 1078 87 674 343 427 781 1179 853 345 970 208 146 18 929 707 648 76 505 60 205 1203 20 15 884 496 1164 943 1171 246 672 411 96 195 16 98 694 631 45 817 795 1177 1085 253 1230 324 1352 44 461 760 1288 1368 989 1316 1114 483 255 945 693 497 1264 1187 1326 515 755 941 1235 335 559 1073 1325 743 441 1362 1229 765 814 607 301 1232 369 889 546 692 485 667 511 285 1231 877 534 910 1299 890 368 1279 651 1145 292 1057 1319 735 874 470 800 1166 304 783 772 1032 1256 35 547 58 932 832 954 1304 1096 994 671 142 468 812 828 961 1305 371 270 99 663 238 419 110 374 574 595 435 520 625 524 633 1225 886 1122 2 855 647 115 224 1090 731 1275 454 77 182 149 1077 6 1097 1040 1009 396 637 1185 621 882 1339 1016 1083 1103 1025 802 914 120 665 664 137 389 503 367 24 636 79 1039 1159 1146 860 1176 724 907 464 1331 982 231 1244 820 773 883 507 403 1228 1174 538 400 1183 714 109 1144 93 78 433 136 548 822 948 1210 320 632 934 1013 1027 161 634 1268 734 226 1198 1123 581 55 1160 1065 1267 1178 963 985 1378 810 481 1313 1147 196 949 478 1309 592 1084 132 445 523 749 10 52 1324 330 722 971 1118 32 836 1296 1245 872 533 620 198 911 31 459 140 1063 846 425 869 762 287 410 662 1037 348 1105 179 965 1061 317 969 660 1278 243 1318 1154 351 95 277 940 1186 1006 1284 388 436 1212 736 51 1297 197 1071 513 1301 1208 525 681 377 387 434 732 1342 1344 786 691 777 1371 409 112 9 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 53
]
wts 2: 795 245 277 893 392 530 1206 928 1221 1287 348 1264 1319 608 630 597 683 179 1222 421 832 734 815 1344 1378 432 1107 772 806 981 1253 1052 34 824 186 625 252 1113 112 1165 776 1197 43 54 704 341 1353 886 596 1200 606 308 805 728 1272 698 744 1053 215 618 823 1359 1115 496 1049 812 514 303 974 1251 273 876 994 121 1074 163 1314 529 69 477 1365 198 490 1223 1285 673 441 1360 748 1060 264 331 261 231 572 1000 903 702 340 545 26 139 1094 200 1292 259 1063 551 1110 780 538 711 879 548 528 861 443 359 690 184 249 532 609 322 1377 109 1192 310 154 1147 662 852 889 649 867 965 29 87 1124 1306 1374 36 840 1284 1148 1201 1262 52 1062 995 1075 1286 1153 1186 1352 655 707 130 888 238 736 588 365 369 64 1256 194 293 250 1003 1123 942 1138 1216 1162 860 420 408 1090 511 611 114 896 204 914 652 1244 42 346 779 1092 312 391 182 932 674 274 289 165 1224 752 913 203 1273 103 146 1152 587 883 991 493 1117 127 389 465 124 479 416 1190 546 1230 388 1007 599 1209 729 512 1149 1122 1268 617 413 1364 1156 962 1004 386 827 67 213 185 149 1010 233 170 1105 567 1294 397 407 742 675 1103 955 143 502 986 856 1373 387 682 941 1261 206 1295 113 454 724 916 5 703 846 239 1247 494 1111 977 1212 670 1158 129 390 459 350 491 555 133 278 786 1064 1126 1139 487 41 148 1339 1038 358 288 1077 1178 62 418 843 82 834 885 292 648 847 1372 844 349 938 1076 3 253 564 771 712 755 1371 401 1208 622 681 809 1078 758 119 449 1059 678 117 667 60 908 75 1357 472 570 842 1302 115 1342 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 54
]
wts 2: 835 822 468 430 1342 126 412 1373 1222 1036 540 102 1328 168 419 1348 267 353 622 772 1108 1297 694 1139 1046 469 1324 100 1224 421 692 606 1204 1229 524 600 570 1115 1103 86 647 906 165 779 1179 1047 965 913 509 481 538 530 420 944 1371 351 602 503 702 851 747 1077 803 517 189 596 373 1218 1329 117 1056 466 719 1177 238 480 550 308 586 1128 871 657 413 252 1114 447 378 486 652 436 542 1280 1059 333 345 107 736 1268 682 610 860 529 901 905 141 1072 931 698 841 1007 463 672 1225 499 348 1377 919 410 1201 506 581 1350 492 1120 1116 1160 500 1351 808 365 1054 786 316 656 462 746 1123 575 1013 759 995 909 1206 488 842 557 874 1078 801 1193 22 26 279 324 1249 1325 145 850 400 520 637 564 955 137 21 892 716 327 371 947 952 90 650 1009 1196 110 427 215 932 1032 418 590 209 896 1322 363 943 34 1024 1071 193 722 697 1295 725 1027 1040 925 1378 167 612 866 1083 737 595 1211 762 63 360 889 628 173 241 1146 213 1198 910 553 683 543 292 658 42 962 7 837 1271 411 1156 2 950 1138 603 251 800 1019 852 286 369 328 1270 724 1173 926 73 645 765 1158 227 1277 544 329 490 1051 1364 849 526 958 804 395 374 1124 1035 1147 1149 1227 285 111 1234 1045 487 482 1207 811 937 9 1310 1223 688 653 534 782 632 881 415 298 385 1283 394 516 763 162 592 878 1067 706 244 1088 262 1150 942 949 175 1205 821 20 225 998 1367 485 1003 1246 891 46 163 872 1023 288 116 1353 1178 157 806 1247 940 1081 438 240 569 686 1228 379 1005 915 1033 236 640 934 200 1307 1208 1070 343 966 523 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 55
]
wts 2: 332 424 531 340 1316 1276 891 591 1083 56 347 1124 1165 50 1297 328 1149 283 1155 549 1222 723 1150 584 1257 759 484 1063 213 20 747 15 45 457 351 1038 1043 405 38 805 1246 954 1317 646 1258 593 731 620 526 49 664 1224 294 93 191 947 1175 101 177 215 458 274 52 261 548 627 615 953 1324 292 98 1259 240 840 430 1201 349 993 777 245 305 1103 1075 339 1194 813 309 1145 329 1081 1156 71 271 1105 260 690 397 988 184 907 1040 783 1311 1046 333 725 1353 1287 792 990 752 666 1284 1205 835 355 48 1112 91 459 1318 1014 618 876 693 558 28 144 335 1067 1068 809 436 566 357 478 714 513 1340 1230 77 1022 112 877 684 589 500 407 334 1331 1144 1137 869 1087 59 496 11 1313 12 83 352 1218 410 448 743 423 401 982 445 266 828 760 751 1104 854 654 1085 1009 987 389 1050 337 208 364 225 2 61 853 905 674 402 1117 399 1021 143 628 46 1214 919 3 836 348 831 1167 1375 1377 197 288 1153 821 157 450 930 912 18 497 322 103 1365 827 69 766 636 625 246 1306 1299 1198 483 981 880 482 209 716 474 1160 1217 491 176 1342 857 344 922 303 1349 378 503 607 270 514 763 574 23 580 1260 539 161 36 249 1061 734 343 186 1113 47 724 925 408 1323 749 290 1119 671 55 565 432 1373 420 774 837 386 1158 902 705 53 1300 884 791 119 414 1073 762 571 1129 1131 881 1172 737 733 480 1031 1210 1025 546 915 346 1320 1255 533 1256 505 252 588 287 1189 1200 1161 992 95 277 181 1267 302 638 948 758 387 1 785 485 547 819 900 536 946 392 979 1298 578 1177 106 280 612 148 194 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 56
]
wts 2: 91 229 849 784 463 27 607 1071 1289 648 1008 666 270 640 1036 1091 368 993 1219 246 542 144 815 97 1179 531 171 891 327 1055 46 184 758 1376 226 552 410 1205 888 137 1298 938 278 104 313 536 818 602 601 62 281 1195 682 983 676 395 513 234 446 1231 164 179 294 1210 508 280 1187 842 1067 1081 629 1060 451 1292 1020 1215 245 385 501 872 884 927 429 734 1363 982 481 448 455 1377 1314 633 1168 1246 80 185 1197 31 563 227 1000 897 594 850 1226 1073 610 855 685 632 1302 1233 195 844 737 1107 704 882 21 583 895 443 1331 1365 838 885 792 639 1183 943 70 1137 712 1199 248 953 1223 924 38 991 692 774 587 101 620 449 401 199 39 765 183 728 502 1155 903 233 414 962 26 871 354 1062 748 762 247 1034 1269 506 921 5 596 960 372 1156 1286 286 283 155 1307 931 616 212 693 1162 1102 605 1278 1337 147 382 11 928 1328 1239 972 1225 585 1263 558 1192 1301 1313 592 490 1186 452 579 300 371 1045 1139 30 456 123 1227 440 1105 1078 667 181 935 568 584 678 413 562 556 759 630 1380 1264 555 485 484 340 1154 230 1146 1329 1041 499 591 525 1011 1144 88 1347 191 333 302 419 990 25 686 1002 544 56 577 843 910 902 1206 1054 13 1243 1290 204 877 1166 608 274 143 488 1220 408 380 1319 1013 462 834 265 694 1128 165 285 103 800 916 479 1074 617 1134 1281 812 654 1378 154 840 491 711 255 122 741 1370 947 84 1024 760 126 51 619 557 543 860 641 132 1221 566 50 651 1255 1083 829 1321 200 528 836 507 956 82 755 1343 509 243 636 1170 1094 222 1160 739 355 696 981 561 643 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 57
]
wts 2: 1311 938 1253 732 16 1221 694 807 1232 1271 1295 230 600 668 583 376 493 672 675 937 715 1226 209 1350 929 602 1121 192 828 399 774 137 903 699 882 182 1222 483 473 819 658 599 1090 881 1288 207 802 927 461 474 869 1022 153 1062 1260 1291 1228 1091 222 980 1283 794 26 1259 920 260 973 245 1041 1322 1120 263 1070 77 634 105 544 102 1008 880 589 861 422 1039 995 167 477 205 1170 1276 1345 253 466 1356 223 5 852 1314 555 883 1152 733 499 243 690 546 799 168 327 984 523 714 1315 914 539 121 619 1067 623 1368 1089 281 307 414 1108 315 741 534 946 495 497 1132 34 637 356 247 701 604 654 291 63 1024 656 888 369 647 439 884 215 726 290 1126 972 299 1272 702 960 1251 33 100 1145 1290 700 1265 1361 527 681 1264 1164 1021 355 954 197 122 895 1201 457 1209 679 498 1299 390 251 663 547 1332 907 1140 140 76 1177 479 1001 311 217 918 762 1301 469 224 219 933 893 1308 421 1316 993 736 666 778 220 719 418 803 118 32 579 1309 535 213 415 1110 1147 707 22 1138 886 48 982 435 716 92 651 813 72 465 1378 1092 401 1037 753 693 1107 319 1060 712 285 605 38 1306 238 1203 346 250 342 357 1305 925 1030 437 68 718 562 294 766 870 584 878 1307 977 108 593 915 750 1204 194 871 590 174 953 652 1212 552 737 734 710 236 330 358 1047 407 769 618 919 393 1084 540 1151 1188 1279 851 395 1176 894 392 280 1139 1266 965 91 467 941 452 625 749 752 696 614 743 800 1278 1352 948 113 1343 295 6 1117 1087 1007 998 200 1325 571 210 839 402 398 617 1035 632 610 773 476 441 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 58
]
wts 2: 146 899 1150 599 1286 507 969 273 892 162 1334 1130 461 242 1081 607 683 1129 331 40 786 1011 1048 695 938 541 743 73 406 372 389 1359 843 280 519 842 1356 41 689 1250 227 762 1300 872 690 2 800 150 574 597 736 139 1071 1254 43 140 939 1225 1232 1192 421 1357 483 268 310 187 861 1195 650 395 1120 21 362 1164 167 725 1284 819 631 1005 137 271 935 270 756 170 773 748 746 908 979 1270 856 193 457 1262 785 357 1316 447 775 444 649 477 1345 295 1010 1133 716 799 269 164 451 371 228 1275 248 108 364 1317 63 1078 509 636 984 623 133 1075 721 106 142 1249 901 864 1351 1285 1267 520 1281 1186 276 1279 431 911 615 277 848 825 323 767 693 232 1379 1110 158 934 813 758 584 115 433 1258 203 1141 42 479 964 266 70 989 1303 312 235 1257 1036 20 794 1377 1093 912 186 303 416 659 1263 1092 543 692 225 1213 932 538 1274 528 942 49 491 1118 95 300 356 895 135 851 1069 390 1324 205 1190 537 827 101 334 318 1068 1016 460 763 208 1371 557 891 738 1237 857 670 596 570 284 986 1244 12 442 221 627 999 267 1265 1197 1369 352 634 1067 1008 888 878 157 1117 959 1114 398 555 60 445 595 1240 616 535 1310 1152 1136 351 1306 337 591 117 817 1058 1212 790 1107 1174 1051 523 715 11 640 997 966 490 249 654 1121 239 556 1156 656 671 355 1268 1083 175 1246 1201 647 1252 104 27 1308 485 199 663 354 279 1109 342 1135 427 1245 951 1168 396 967 1328 307 618 678 387 48 97 184 419 1128 299 224 1327 903 873 500 123 198 771 453 1331 1314 19 860 867 1185 201 1023 1025 1200 1336 110 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 59
]
wts 2: 308 1011 411 264 87 277 391 1199 566 338 173 1040 316 336 104 407 841 109 1255 108 6 224 1024 752 51 681 1279 348 516 576 755 342 898 821 955 472 353 1018 855 1036 1311 30 824 27 1242 726 113 226 708 99 687 913 1097 779 539 69 268 864 738 443 1231 883 906 463 506 80 232 980 1358 622 228 435 1181 1186 1142 139 1172 1075 803 1262 994 1263 462 730 1140 1046 751 387 251 533 919 543 831 450 1087 140 920 377 1182 1044 909 551 59 601 1280 1117 125 1015 968 234 1332 680 877 312 459 230 753 311 822 891 710 629 257 969 586 43 758 46 562 1160 1307 214 176 345 1176 405 626 676 213 636 162 7 518 973 701 430 1290 259 1074 1119 1205 271 1352 711 587 254 999 434 739 183 1086 673 229 974 1157 1110 569 1066 409 591 1023 624 1111 878 492 1113 861 884 419 236 640 690 422 1007 250 267 1133 749 63 857 180 1317 1121 720 1156 1228 740 414 504 908 156 871 670 70 1363 1354 1129 706 1134 924 873 252 1246 1001 1362 747 544 40 101 1137 1033 22 1041 742 15 594 418 190 581 218 439 608 721 150 395 564 386 1183 1233 318 427 1356 62 814 1299 1139 535 531 54 1192 412 19 790 11 1210 561 515 809 235 110 678 1072 1089 1349 1008 191 1012 663 497 2 340 1372 124 294 1335 1271 1201 299 975 639 199 361 600 106 393 1229 5 245 540 1376 729 116 1010 1218 21 927 1375 217 417 853 1019 186 452 280 1131 899 1214 168 436 858 1302 1155 154 444 206 510 1235 432 242 1166 68 1361 630 1239 478 363 1056 538 584 18 1339 484 1300 398 651 893 1080 327 300 248 902 425 1088 24 137 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 60
]
wts 2: 53 970 539 928 62 257 46 1314 599 710 226 848 657 484 815 428 543 684 915 960 836 1275 789 1248 1212 1170 699 431 1009 126 300 284 1041 299 485 1147 286 982 1048 478 496 884 567 811 618 1371 681 192 601 505 678 1142 1204 370 1288 898 481 1346 1172 654 1014 885 530 659 778 1068 503 12 1201 256 435 1194 1234 603 1086 934 394 172 1015 696 1235 317 612 230 139 863 1323 949 291 1099 224 842 366 852 357 711 1108 388 569 20 312 781 1075 1121 307 739 271 983 890 178 149 1083 1052 1348 1175 445 951 200 549 1339 40 1159 834 252 587 574 324 1262 298 352 1357 796 276 894 896 222 613 155 780 1040 78 1244 260 1126 407 713 18 1128 384 440 477 31 994 981 1315 1106 542 717 977 372 277 552 773 570 1178 1111 492 871 1279 8 1087 597 1044 1284 118 795 872 1249 989 103 390 546 122 456 73 1117 469 95 653 573 157 347 1378 732 162 1138 501 1300 1280 1024 361 522 964 1181 596 761 329 90 727 111 671 920 444 1173 244 817 476 905 493 827 143 100 997 140 121 57 673 571 912 59 234 1250 144 463 499 1255 1163 33 759 1243 1069 375 176 950 441 51 958 231 855 695 174 245 697 466 1335 125 341 1089 1200 510 259 882 148 133 1340 723 914 424 1131 1180 106 927 856 1127 962 1157 753 158 334 1198 1343 26 704 808 239 1197 1361 1355 462 656 211 84 504 1187 733 378 255 513 243 1146 416 27 1226 432 667 1056 1080 693 1292 1353 1305 1008 183 583 442 204 1011 862 1253 1006 602 1372 1277 1252 1220 1278 295 1182 1312 136 1273 645 169 323 214 36 274 289 1102 588 1018 851 464 16 865 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 61
]
wts 2: 428 1351 372 626 1011 253 491 564 727 373 511 846 120 731 897 942 1230 47 1196 862 1244 168 1150 1033 543 1024 1159 132 514 1251 643 575 560 963 459 1171 457 882 271 387 1050 1009 131 1162 1060 206 35 119 556 561 1041 277 1318 1065 1277 51 1352 1206 809 1121 213 988 848 153 1349 1052 421 273 211 547 743 998 385 1054 770 850 154 1369 486 446 327 1098 55 834 644 1037 1027 894 1231 572 573 1198 1125 619 554 306 297 629 74 557 800 450 912 581 138 1209 801 1184 1338 1079 440 1132 523 102 784 101 230 3 921 613 512 810 1215 1264 1225 369 293 533 371 789 996 879 1208 24 189 1102 1191 237 85 87 937 330 872 1339 50 234 1151 67 384 1126 135 1029 684 274 1163 426 1072 107 546 1218 888 562 53 1061 180 1133 130 606 1077 1173 10 1303 494 649 1071 1064 1092 316 142 1168 1149 1309 663 624 488 659 1311 1224 326 766 642 239 600 1174 413 932 954 432 940 916 1000 38 815 1324 714 370 880 1034 1353 1084 589 1044 73 86 18 1365 1335 25 1358 1156 1289 453 1055 709 975 1248 479 435 41 1001 982 7 1103 716 157 955 1379 885 668 98 1376 374 753 13 298 311 631 966 1345 1012 396 1067 926 1344 444 1276 602 1051 1223 962 814 336 58 1375 905 1278 1056 290 1138 227 618 1226 93 1129 1283 531 980 1240 1091 1118 70 30 1137 953 315 929 747 201 1316 96 418 344 1241 463 279 359 320 400 434 522 481 964 755 246 1271 408 891 934 1086 677 1320 360 286 164 1291 11 1178 777 113 484 675 261 1135 1003 291 658 1194 1261 1265 883 474 835 29 1010 771 833 1123 585 1127 193 1130 1081 317 1040 1281 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 62
]
wts 2: 140 244 1034 731 447 280 425 1206 734 643 164 305 438 840 190 1273 1323 851 33 1014 216 981 1029 1237 1248 1351 139 1197 1260 294 288 796 978 409 266 1362 898 964 217 49 88 564 363 1187 1087 393 973 318 117 1082 575 196 418 1099 1026 391 659 529 1196 384 774 839 81 880 197 28 1328 348 178 750 1202 687 354 625 681 1358 708 114 1192 922 1349 994 943 1049 993 1338 1062 647 1017 699 115 807 1039 992 995 473 250 389 50 560 719 287 1373 208 1377 474 385 1005 251 1198 402 387 99 339 896 1183 510 313 1256 182 824 154 268 772 218 1074 741 1174 1105 142 541 517 1268 955 240 1287 443 133 1055 46 460 591 373 169 1294 307 785 27 477 868 764 471 281 631 1233 179 426 990 617 173 1 989 1177 578 220 640 1363 352 446 720 69 1261 1155 1326 614 675 930 1222 755 1180 838 441 308 317 970 212 1324 540 48 546 911 241 74 1151 710 885 1352 843 214 895 1175 622 1321 345 786 632 1028 199 1083 1340 915 350 256 902 189 1299 205 375 301 799 1255 491 1201 582 1093 1009 1296 290 702 528 417 1010 956 515 155 782 527 776 500 1125 569 553 933 1091 1208 1240 826 945 1278 512 906 1015 113 711 953 765 1236 31 844 1064 1111 1048 421 263 745 1306 549 415 679 526 1200 816 858 486 1141 246 493 295 609 876 132 100 64 1244 134 89 754 1065 1006 371 1086 10 672 390 948 879 272 303 950 503 499 1047 94 1297 783 661 1114 63 187 1249 226 665 1316 343 222 469 209 583 606 533 544 1041 6 641 1271 705 594 959 878 166 616 342 149 86 793 1078 1050 420 1116 585 105 310 514 854 598 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 63
]
wts 2: 70 562 314 387 109 1227 188 704 499 66 403 400 374 1263 382 303 977 730 1121 493 958 641 110 526 1075 128 1172 724 693 156 286 136 199 628 122 806 178 851 1281 1014 1178 662 644 320 571 350 1185 212 257 144 1264 261 986 246 276 124 721 1167 782 86 111 325 607 497 764 956 1087 215 948 1135 1015 467 1063 1050 1243 789 946 2 928 1102 589 505 886 565 473 1018 423 604 810 1003 1355 680 1219 825 831 1117 181 907 1085 293 867 278 1358 367 899 53 1211 1301 454 1203 421 472 1012 262 248 557 15 1327 366 48 340 330 1037 766 551 1033 363 942 1141 576 1200 819 926 1147 817 529 1043 568 1345 204 935 411 141 522 966 160 1331 991 533 748 65 1155 417 1028 191 183 150 550 392 1027 1288 1274 621 501 224 798 630 1266 678 564 984 932 1039 149 844 759 1154 937 539 169 516 1349 1316 486 318 76 255 268 957 1298 1334 510 428 343 639 1309 378 1208 119 1094 908 359 1374 587 364 408 683 74 1084 1089 1277 520 971 1372 573 1134 1225 797 1068 451 719 1231 673 785 1359 379 412 1210 1107 1246 746 151 458 1193 349 967 843 265 940 300 686 1239 386 397 250 814 241 434 898 1006 94 34 1083 640 514 1024 943 299 626 1022 622 507 371 830 577 632 929 707 1265 1139 1076 1364 498 322 41 780 291 39 1029 438 891 13 753 1292 638 637 238 442 544 845 629 769 433 422 480 653 158 357 771 1370 20 1371 155 981 668 897 1013 750 1161 58 11 35 781 555 1164 615 180 824 407 369 289 1256 1197 259 1016 256 918 682 1310 495 585 627 714 1066 821 779 556 708 559 210 388 594 242 618 1047 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 64
]
wts 2: 571 71 36 860 403 288 716 1335 50 1116 243 1207 709 1006 447 362 1227 251 200 128 328 263 1115 1337 269 1189 691 732 770 752 1258 256 1129 356 40 616 741 279 1296 754 449 1111 614 94 1298 681 1293 51 936 419 1272 416 1121 730 17 72 393 1139 1369 14 355 812 1053 232 560 1309 847 1313 42 628 343 216 473 641 960 1125 442 244 530 801 1336 1036 170 395 223 314 360 751 584 129 431 458 1023 965 134 610 258 398 1267 62 842 1231 246 1295 1107 1357 499 475 1072 1260 746 338 337 816 580 472 1263 1138 687 928 22 1134 387 428 723 600 998 932 674 602 972 291 1322 214 1195 108 677 454 221 345 230 133 298 587 1339 772 903 694 995 861 594 496 346 1232 923 896 1351 793 432 1249 1344 116 289 147 1194 676 1323 1235 702 1238 1135 964 1005 52 317 441 760 632 250 1075 885 1201 497 963 1318 695 795 645 680 909 483 585 887 1120 1223 81 833 1319 911 386 1285 166 178 808 301 378 160 573 876 820 39 207 380 558 843 1277 330 61 164 373 1092 189 1012 894 706 487 1117 1300 396 727 1350 240 335 546 650 1251 1074 479 70 278 947 1174 750 64 245 1188 870 803 652 100 997 389 854 738 821 630 1 524 151 1095 690 319 55 1130 561 204 255 375 422 935 1373 383 392 287 550 591 302 303 1089 353 953 1375 24 1266 1198 215 1063 570 1310 238 119 341 460 394 789 1108 115 765 1018 742 185 525 756 38 56 517 226 186 385 1047 167 588 653 1225 708 97 603 697 1034 388 623 883 224 817 1106 1088 1168 804 737 698 1030 556 1068 1122 1248 402 1017 1221 621 865 1270 682 655 1008 401 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 65
]
wts 2: 424 740 403 329 923 634 364 1143 542 387 1126 1071 354 825 99 286 41 1236 1068 591 418 436 697 2 722 1307 1370 1104 1082 106 170 866 787 346 438 603 813 1163 1088 1138 136 669 510 489 1092 1339 402 123 456 808 1316 512 720 1313 781 1283 42 659 939 125 775 233 1074 987 1157 1164 68 711 794 1067 593 765 1168 560 1058 1271 98 1001 348 946 751 899 265 292 1235 242 161 1275 463 1034 1170 84 891 949 864 1140 476 715 921 944 1348 858 315 1038 268 764 381 446 769 1107 1246 971 1277 491 1006 1046 739 1036 779 1018 1362 665 783 345 859 1166 935 52 1302 318 602 567 1091 241 1373 648 1209 723 153 254 917 162 1160 100 900 209 17 572 1327 1284 122 465 331 632 610 496 232 1244 73 1188 353 919 911 1269 393 1241 1120 357 654 38 831 88 1217 734 727 507 39 824 3 605 815 806 90 982 688 237 731 1207 93 168 1374 304 190 1315 1240 75 423 649 851 369 450 804 940 221 1029 306 72 846 1011 811 684 883 178 114 452 757 443 1112 201 1050 904 384 573 1228 271 575 27 1359 798 309 1372 501 668 766 366 1253 1342 1194 317 1289 262 95 1171 152 776 1010 550 1024 820 736 570 1208 1139 710 474 724 747 823 1308 583 206 179 784 1376 339 240 1142 1054 414 48 293 1052 833 698 1301 1007 1291 756 351 619 165 508 549 885 336 160 493 667 595 437 1288 434 338 657 973 1318 920 425 29 1237 635 910 1371 492 955 596 380 30 66 726 896 1181 1169 1004 481 533 359 115 45 706 754 638 1106 197 194 63 413 266 1178 840 1070 1040 195 1101 77 227 1247 887 897 1195 187 890 704 845 59 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 66
]
wts 2: 223 1007 403 1308 745 587 1060 300 758 419 217 1174 594 1239 239 110 405 1097 334 878 935 183 127 725 755 1366 1295 21 828 571 583 400 706 654 285 1205 936 916 658 728 125 572 888 1042 260 344 295 636 1320 466 201 807 65 1140 2 997 429 1180 1170 1206 399 330 349 1059 308 489 1010 768 150 585 1192 1261 107 433 1315 1134 858 690 1150 817 657 75 374 96 763 197 539 998 1267 203 600 290 310 474 301 64 606 487 519 412 447 105 1193 928 672 1127 853 1177 956 1247 1204 579 1355 1237 462 971 1069 692 273 254 1300 360 1119 371 306 84 255 1317 1123 1133 249 704 822 115 813 222 191 443 1053 505 575 867 892 610 208 671 71 437 228 1343 655 438 1259 509 270 793 1310 89 1034 524 169 742 490 1028 1257 635 1098 681 588 1179 827 1356 1111 574 927 1006 49 1226 177 407 1074 1319 1112 699 1291 180 151 196 321 937 444 522 1008 428 1158 1252 612 92 34 947 781 1198 1357 516 723 339 471 729 753 520 542 469 1246 1302 1376 205 386 1167 385 764 674 652 305 656 141 207 611 142 739 60 116 272 769 662 1362 1070 647 481 365 885 994 1278 954 796 688 537 377 232 413 802 709 94 1128 1250 43 711 1327 1351 311 824 756 991 868 1057 1318 833 562 1316 453 1347 717 62 149 1048 748 382 323 491 347 375 61 397 633 175 1163 1096 1003 1103 456 275 483 194 865 774 513 686 304 1334 117 1054 86 192 912 590 974 1092 138 329 16 78 981 624 1045 1359 1195 1215 1256 1219 9 44 801 1181 154 831 874 23 561 40 924 111 1258 213 87 1286 395 77 1178 259 352 22 559 834 88 314 1216 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 67
]
wts 2: 932 1117 939 347 881 42 177 103 235 204 122 655 1208 1241 315 1190 309 405 503 203 1328 628 1153 949 757 1098 798 643 1174 186 1364 76 523 812 151 1172 925 905 417 1000 818 1078 1265 455 796 91 822 534 848 475 492 616 478 684 1072 1220 678 511 533 1301 265 433 833 517 457 483 721 1151 711 737 599 1028 291 1169 279 1061 657 382 746 1141 572 1074 465 60 1324 1279 1125 217 59 999 549 199 1205 1199 899 970 1204 65 1166 305 902 667 987 1064 1091 106 877 474 188 385 716 829 72 450 419 313 601 539 163 1163 1193 804 364 495 851 440 345 283 1198 792 720 674 1254 452 1223 295 1342 468 1027 414 38 1039 730 266 806 1083 454 802 381 940 926 146 708 272 1152 1346 1366 115 287 584 780 639 128 1016 1282 147 1372 810 634 803 1003 866 331 124 960 855 921 222 751 258 490 626 472 505 480 847 111 58 1135 374 1284 1277 61 308 113 900 244 775 1004 934 714 487 770 652 164 1170 31 46 420 182 187 298 550 998 615 853 350 738 1308 1059 335 125 1022 254 1280 600 1341 410 161 158 1070 647 1230 1347 488 223 1012 718 701 916 638 680 384 1326 662 78 64 306 846 950 816 1137 606 771 123 735 1103 178 51 198 390 933 1087 654 1094 754 856 479 761 338 941 991 1200 903 1124 165 948 215 5 260 557 592 1044 1359 1105 1035 1292 329 857 274 973 55 1071 49 929 398 285 908 1018 30 1047 100 876 585 699 619 349 541 83 459 668 1253 659 238 207 1314 524 377 993 510 156 676 1126 671 610 710 945 342 466 26 108 1050 1299 888 340 1049 1057 1257 86 1214 446 966 646 892 1264 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 68
]
wts 2: 12 966 880 282 232 1157 340 1106 301 590 1198 480 1081 423 351 500 1100 963 11 208 1030 256 422 634 254 900 179 482 1250 939 978 1361 754 202 536 894 478 1351 1195 378 674 169 793 436 984 1059 26 636 1230 1111 38 88 1182 410 1038 94 646 615 1007 862 908 1031 991 1046 479 829 1235 995 1070 354 502 1115 297 556 229 132 1039 406 337 882 805 366 412 559 445 214 1194 799 820 325 76 22 953 1089 1366 1083 848 348 1022 641 619 217 330 1093 1173 1257 1082 1104 207 974 541 403 395 581 135 1107 111 1054 645 114 772 248 555 649 1369 943 681 789 266 936 277 447 979 840 610 1220 398 517 1210 438 305 1362 764 1354 408 626 206 1271 1301 338 36 680 889 1034 1132 281 918 1086 491 463 144 565 1350 656 396 56 468 597 17 31 705 1346 729 917 804 1092 888 1208 189 1021 444 770 959 34 1244 435 20 1109 240 1217 1125 916 780 437 929 860 136 975 942 46 699 958 910 937 1343 1333 417 758 1330 534 1364 192 740 592 726 996 1074 287 722 1221 813 957 265 211 314 715 1002 707 1237 778 523 620 796 756 1247 1138 632 13 83 1012 1133 576 670 682 1363 1376 1037 6 720 103 107 216 1078 203 558 1232 119 385 498 125 249 823 181 1035 191 1146 59 516 19 925 955 787 1292 62 564 259 1243 391 1321 662 1033 1149 1166 158 1344 1112 331 150 785 129 841 593 318 735 387 370 947 902 546 1303 1027 475 1008 954 324 1024 650 833 405 225 1316 718 547 1165 692 1339 571 790 637 1120 1051 68 245 459 1186 586 858 399 553 1156 164 941 166 1278 1280 312 440 526 236 1241 792 514 1332 180 1005 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 69
]
wts 2: 359 1260 882 15 1055 107 1137 666 215 196 254 1372 660 74 54 992 893 947 208 928 127 174 961 903 7 194 1252 797 1249 1082 211 203 616 1086 362 720 679 322 420 1203 643 68 1214 1032 1287 1363 302 1040 202 155 28 482 64 408 41 671 1122 1158 1092 572 851 217 1240 311 890 543 445 823 1177 1318 104 1078 143 281 761 106 786 1346 531 1242 224 743 162 1134 451 921 628 873 292 670 926 1367 52 895 553 973 1239 1029 763 473 904 729 137 262 750 30 603 503 598 699 210 227 1104 285 1378 240 1354 483 39 821 1292 987 58 201 941 1373 789 18 638 905 842 896 484 551 918 933 990 684 1232 1058 900 244 501 188 544 406 897 199 774 1182 876 169 1264 474 617 1018 1117 47 110 423 790 10 122 101 523 1276 1045 1019 1253 119 1046 972 1125 861 1330 422 136 1185 1099 228 759 1219 1112 258 830 337 452 105 1227 707 953 449 856 1003 84 472 129 172 1194 966 24 647 83 1146 1093 511 469 1234 800 67 59 753 1258 351 352 534 22 310 430 959 36 656 655 1256 776 246 386 125 1056 636 1068 1168 1377 466 1351 389 1080 574 1284 1170 269 1221 49 465 1213 409 1036 575 978 191 149 134 85 278 1313 1054 916 1075 167 1028 415 632 760 1116 845 1285 1304 212 193 951 476 532 1166 1309 1142 370 346 948 1297 600 4 1320 619 1022 1211 777 1347 78 605 1113 752 113 198 1298 1241 618 1072 280 844 711 1073 653 577 229 1127 368 582 27 695 111 226 1357 187 939 952 1291 1355 413 1091 994 1038 171 819 1155 734 131 464 1266 1274 1167 649 1121 1179 859 298 1063 108 446 815 231 1135 487 1225 1283 264 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 70
]
wts 2: 52 221 420 1221 1147 364 1089 263 289 827 1206 954 436 789 344 1230 875 1081 311 218 3 372 1314 1142 500 1252 88 928 1311 908 1376 1251 1120 28 330 784 881 1255 269 605 1250 275 283 822 313 478 640 490 877 1113 345 828 350 659 1287 632 552 1379 914 1185 1067 735 1061 1021 1203 366 1080 211 1076 198 453 454 1209 49 115 814 15 466 587 660 923 800 50 272 726 1117 909 722 378 1222 806 527 951 178 865 891 911 166 66 425 1101 840 714 1225 750 997 544 728 1059 871 1271 831 225 1030 1130 792 1146 793 1175 441 1000 1299 521 643 833 702 755 719 102 426 327 67 1136 505 388 1161 294 1254 483 962 346 208 695 508 304 958 1354 990 319 413 1025 160 465 238 258 60 1211 682 1013 894 229 386 477 1063 669 270 853 670 1368 543 1281 1124 1243 339 651 462 169 46 290 5 652 250 764 588 124 692 223 773 342 305 987 772 1149 1023 280 769 1143 419 1285 182 142 1224 207 890 809 107 595 1343 551 116 99 663 762 1195 1016 572 882 1092 1015 87 1207 851 1279 1267 969 571 1043 1012 78 946 1312 1097 1220 859 301 869 1035 1153 760 631 1262 717 1083 1284 33 1122 710 249 1323 1077 213 271 576 558 966 111 836 568 961 1261 776 971 788 380 254 1360 1045 1019 227 705 916 374 1296 1348 302 780 870 308 212 164 688 365 625 105 328 1055 641 1039 1215 787 1240 618 1028 855 608 555 1010 252 358 10 1173 439 1309 65 135 1212 57 209 703 1164 1104 163 243 1369 340 748 852 231 699 1126 843 970 1258 1165 1003 1115 624 1235 617 492 104 1363 938 498 1073 893 43 485 615 145 187 1129 1308 1319 839 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 71
]
wts 2: 128 936 831 434 1078 1133 233 941 176 573 1179 1300 628 597 401 539 572 1053 908 85 782 1002 804 1223 229 321 38 406 1158 57 109 672 785 74 732 769 33 278 927 288 1139 417 715 112 1042 253 10 828 407 708 489 1108 145 1375 1186 1164 328 81 1268 996 1302 939 1263 446 1219 1101 1322 64 650 773 186 166 1142 1083 102 301 741 210 174 197 1364 48 546 184 827 506 276 1167 837 879 348 220 630 1246 52 1029 46 989 519 1065 125 1349 193 272 412 44 359 1085 678 170 945 287 116 946 469 150 921 1110 1238 530 1314 780 557 1346 1269 503 1245 1339 739 766 673 395 728 118 343 352 240 1275 234 1058 716 1256 714 490 1105 1178 1273 16 1099 1321 20 90 1295 316 1077 282 1032 889 1024 964 53 275 1183 943 131 37 1213 192 299 902 1257 893 882 88 436 660 917 1184 122 252 98 1145 922 821 467 706 564 1169 206 1230 894 107 498 1308 566 928 1316 181 375 445 461 965 531 471 5 884 313 481 1122 1125 414 1215 532 1116 384 1253 92 280 1045 258 1233 791 625 868 264 910 1317 940 1351 1034 492 1092 1072 957 101 696 677 955 7 175 669 513 920 1354 422 801 1151 718 695 100 962 1064 734 173 742 246 353 142 204 24 620 493 930 357 447 1240 663 747 456 1012 238 674 213 349 992 598 808 1194 1363 949 759 289 35 1084 591 1201 872 540 225 713 1165 1154 257 76 975 898 580 1189 494 1251 1091 990 805 1224 1318 810 1098 281 1195 160 56 1323 201 518 268 310 370 866 795 525 704 703 888 1135 1232 1185 67 517 300 139 555 548 121 1199 219 944 404 585 1076 783 45 248 1368 515 83 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 72
]
wts 2: 101 530 882 526 1098 211 601 57 532 1172 372 1037 1281 1016 772 1045 505 894 260 1108 762 450 653 465 871 621 712 1155 132 969 1369 1021 825 1197 1141 97 679 686 175 744 386 254 202 630 356 1005 965 766 750 890 899 195 1010 700 265 808 457 609 462 299 312 857 1105 1206 1325 989 72 730 152 981 728 77 1358 1156 785 787 768 38 1038 823 922 11 732 258 1196 151 921 231 753 487 625 481 141 822 1203 689 726 1261 221 642 758 460 944 1168 570 1158 1324 192 1322 770 358 541 1320 145 1050 617 395 411 1173 125 418 174 691 139 261 531 172 42 945 224 676 579 1118 751 1092 912 262 517 865 249 351 485 701 478 983 858 1265 1162 370 1146 1152 1213 501 1278 354 760 1094 1073 52 212 600 449 998 419 792 561 1279 1345 1335 1313 1315 1171 666 878 993 810 333 801 520 654 339 306 571 134 1338 1086 1114 1039 798 31 1378 1368 364 903 371 314 1109 1210 901 908 909 1234 957 1053 54 854 116 1331 468 1283 620 717 692 1273 1175 290 1061 435 1321 1095 928 398 1014 307 303 253 1199 815 567 628 793 1297 129 952 828 612 10 657 936 1150 536 4 144 438 1272 380 1240 22 807 814 1089 1018 852 32 1288 1170 831 847 1032 336 455 1380 381 222 377 1153 1377 53 779 166 522 437 816 1135 1145 459 296 1289 432 1246 337 1007 367 1078 389 733 1280 110 119 471 484 87 1314 48 28 1047 317 963 845 1096 1250 176 154 251 1165 155 723 421 443 6 316 1347 1227 699 187 671 1252 140 382 1181 930 1029 806 104 1154 1147 1221 503 971 572 1001 1025 239 842 245 508 1174 1112 594 740 824 694 1200 19 687 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 73
]
wts 2: 434 195 834 547 137 1335 323 776 1009 819 1302 540 1013 614 1003 208 419 529 302 745 348 629 519 1374 628 309 498 1172 694 325 473 460 511 1018 1120 1330 1171 671 436 1 556 523 318 749 1203 952 389 393 1224 117 220 708 496 1176 1170 1370 1251 1099 902 188 696 637 441 566 939 232 345 1149 1352 527 156 1303 985 421 1222 616 751 598 1274 604 1325 173 1184 92 901 218 106 904 923 1297 557 62 1152 815 1031 859 140 1291 943 602 690 1086 977 728 352 1237 885 445 252 504 340 1377 1036 1323 597 772 1363 827 688 69 417 497 229 72 1232 257 350 1307 1183 1195 558 70 1123 586 591 687 510 376 311 178 87 294 416 154 1219 1125 603 48 269 354 1318 672 505 151 363 1319 945 268 388 74 143 1367 387 768 927 879 327 326 1316 657 1293 1204 555 185 1167 15 1028 622 283 312 179 554 279 1280 750 102 147 1174 1056 411 741 13 839 514 635 1168 1233 43 1073 119 158 713 767 837 872 1041 812 477 601 280 792 1186 1053 1313 245 1087 474 661 1019 718 698 980 459 764 1024 922 1159 212 386 854 1072 332 371 521 890 1250 1017 120 1258 917 133 828 1002 1245 753 941 503 105 112 374 468 162 14 707 544 692 907 1360 963 45 205 2 1124 1205 6 196 870 610 299 1356 453 337 1047 396 937 1051 410 542 139 1242 26 1213 982 1188 587 669 570 876 347 206 1290 695 744 531 924 310 908 1021 974 1321 612 706 1359 909 653 1163 553 451 437 502 328 1295 306 1075 873 621 605 1014 862 493 1109 1164 46 439 464 482 1350 1202 227 1336 833 593 520 841 1194 1269 1221 1119 506 740 435 1046 801 465 717 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 74
]
wts 2: 576 923 710 234 136 1280 131 543 250 979 47 1058 1190 245 711 718 199 232 1130 1046 1045 616 1238 1345 1276 509 562 588 458 1202 1114 1115 532 766 1261 1026 1322 189 27 457 922 357 1192 1360 1050 569 177 279 716 1056 1063 284 1331 1299 742 954 804 1174 811 228 1364 68 1367 628 1171 1108 464 185 1265 174 502 491 624 1230 203 1083 483 1215 176 1234 46 389 276 1198 699 1021 198 1070 53 700 1259 627 802 885 950 1066 665 205 732 1133 134 434 544 399 635 1 80 659 929 520 330 878 554 44 563 453 34 1283 109 1209 589 1368 145 970 169 420 1071 288 843 173 1313 17 1293 1219 1339 915 603 795 622 55 278 105 1178 1002 355 723 662 1285 61 428 67 610 545 172 1302 402 838 139 127 650 1200 369 869 216 805 213 1248 374 352 850 592 259 747 83 947 776 1374 436 870 182 808 466 1247 8 1220 656 695 686 377 1277 142 908 1104 137 21 488 397 538 398 1241 1242 292 931 1320 1289 404 126 556 291 337 1151 900 253 1111 7 996 796 1158 748 1080 1132 1226 633 334 1147 860 376 138 549 197 461 158 438 1346 998 1146 944 901 1087 244 657 984 854 652 1015 1358 824 793 38 147 1296 1204 1269 427 1232 764 1175 196 891 1352 160 37 353 962 528 614 1183 415 989 971 36 478 879 1112 770 1139 445 902 1088 817 601 729 499 241 928 140 1143 335 1077 425 814 1057 917 3 535 750 709 755 1031 1319 935 1185 1098 816 1180 673 1194 1065 1014 959 24 590 1243 1343 1370 881 1092 1036 886 263 907 1373 233 1037 674 262 1375 1340 955 731 1093 913 168 141 39 35 1323 1024 49 1155 167 712 446 666 1164 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 75
]
wts 2: 298 133 886 844 1268 518 1089 1288 805 548 102 1160 985 1162 371 82 520 153 1261 945 453 1300 610 463 964 1066 1257 1143 527 738 1150 1114 757 1122 1289 619 1221 11 346 1263 768 967 982 1366 1362 127 1093 951 179 1264 804 997 104 785 512 288 1317 934 783 1074 927 1213 478 245 1345 692 377 1118 1247 399 1274 537 566 870 688 471 923 1342 691 1282 142 254 49 995 496 475 502 56 627 241 882 674 1279 78 77 376 151 900 849 238 149 795 771 1175 513 1232 606 731 701 1246 86 968 519 875 278 871 654 1090 101 735 1218 168 1140 754 81 306 1170 760 345 911 873 703 29 234 1187 468 622 1294 161 413 702 574 716 534 1168 55 712 1124 1082 1243 91 1057 650 820 789 1061 891 680 921 814 559 552 1361 708 1321 960 470 1048 169 247 1248 507 17 331 1331 248 829 21 273 430 223 626 1333 1033 53 918 431 292 695 1200 509 1051 1174 1375 543 108 347 942 1177 486 803 57 173 1149 1008 576 547 725 617 190 889 332 744 631 255 96 1179 866 1009 1068 1075 565 1355 260 176 392 806 1086 202 293 185 121 526 506 344 284 595 1270 485 810 1287 1343 349 737 733 405 1319 1157 1188 1185 290 782 442 857 1003 106 477 1310 1173 961 93 802 560 571 984 311 291 242 652 171 685 1378 612 666 947 231 1335 287 895 800 1340 138 367 825 756 348 867 1191 417 30 658 337 747 1298 267 1112 1307 1240 36 1292 75 143 822 415 915 116 535 449 1316 180 217 1172 1301 1107 1042 1062 1130 213 1377 1256 1106 879 641 561 807 1309 1236 859 66 1281 523 1103 831 419 6 340 797 761 952 454 313 686 210 1194 228 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 76
]
wts 2: 1242 379 850 346 52 611 964 1315 1237 692 292 524 1215 548 372 335 1172 575 848 256 1 812 674 822 800 238 1223 627 133 1208 602 104 760 841 1319 1136 184 166 175 45 35 1123 1190 503 288 604 911 1119 879 97 896 521 1030 37 338 33 1232 1187 1201 403 1209 870 74 582 73 1180 640 605 1259 1249 702 493 1082 541 986 509 749 1339 1154 817 257 126 1273 621 308 236 931 464 561 122 788 1236 491 1188 720 427 318 1333 1015 1316 871 139 1331 656 1285 214 1174 629 218 1292 366 479 648 1300 999 39 112 1049 47 772 1317 231 1245 1320 1222 803 341 690 539 423 192 1336 161 239 187 311 135 894 1005 1268 1324 1160 1006 638 1354 1171 527 666 630 246 697 456 826 299 641 1246 158 988 982 855 136 31 606 810 157 482 672 659 66 71 1211 237 585 156 733 951 266 1122 205 1244 115 1103 1070 519 418 1304 1370 657 326 609 652 170 276 755 1214 913 478 741 1027 1025 1375 1260 1002 924 1126 361 1335 290 785 216 1283 1059 240 646 549 1125 4 777 1134 583 466 673 385 162 819 1206 168 1276 940 718 766 827 1184 1224 351 1081 661 1239 1332 475 528 174 1113 844 8 608 49 1295 18 1118 1325 828 146 965 1091 852 428 180 935 779 1291 546 281 268 344 836 925 1294 1372 1250 728 433 1265 1112 824 791 710 1340 798 504 1189 907 43 618 1141 962 350 634 1168 1121 191 260 1161 1359 707 532 201 725 189 1270 529 438 512 1108 224 513 96 1344 261 1142 267 169 333 1031 254 1210 1328 932 1277 234 274 699 50 1104 1321 339 108 751 29 929 525 959 625 118 1289 206 556 681 250 1326 773 717 863 1130 534 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 77
]
wts 2: 246 321 1005 1174 500 58 401 1345 629 784 631 899 1027 1076 862 1114 13 107 208 957 967 837 94 120 1291 713 184 1251 638 380 167 261 847 955 541 20 163 1184 1012 640 258 868 883 1372 734 959 552 790 213 277 1124 397 707 1053 1325 232 1278 54 1305 842 450 296 267 672 423 179 383 1343 1254 1120 618 77 651 1359 329 494 99 189 78 431 1229 130 648 358 1377 1025 332 39 1041 858 838 757 448 30 873 174 655 1052 1008 377 1232 104 860 605 1157 60 691 467 1375 669 938 132 175 244 978 12 336 562 2 682 970 949 717 254 770 1113 248 1193 1290 940 113 1137 785 411 1059 1160 1003 62 579 102 1246 1329 533 92 1078 73 1311 845 958 1060 47 1302 462 788 945 628 447 368 287 1281 1227 231 599 1182 360 279 1087 753 695 1189 908 166 741 137 584 342 430 751 1379 877 150 190 481 671 647 15 1051 1263 922 773 807 535 362 1079 748 153 1009 1284 1338 1 262 1332 515 502 779 197 881 361 285 386 716 3 463 51 1203 875 1335 1166 256 1346 1224 1190 962 186 125 151 263 1135 357 985 1240 581 1320 643 187 1362 298 1084 1081 1143 928 523 328 122 177 1125 89 347 719 518 1380 663 1139 887 1104 816 1312 558 301 826 495 951 1210 755 823 763 299 977 933 1212 403 812 422 639 398 1225 1110 1280 158 1080 355 828 1072 699 870 281 746 160 1089 1200 419 1034 1013 623 1140 824 75 399 259 570 313 994 466 19 45 247 176 351 968 700 35 556 756 650 57 683 511 294 444 438 123 408 1205 121 690 507 409 41 348 141 56 306 604 1327 595 1024 83 272 572 649 1236 109 22 666 375 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 78
]
wts 2: 1123 1179 769 1227 841 651 745 328 535 1325 991 1277 1172 794 779 1334 912 682 231 86 120 531 731 256 460 235 1197 642 6 739 167 124 1152 456 817 869 1095 1352 1372 1029 978 610 348 995 1120 44 46 858 1351 889 510 289 1380 726 981 1213 1218 1065 550 43 131 173 1198 379 854 735 1184 1053 1228 133 690 1104 10 669 774 107 125 532 563 283 1291 1180 1146 597 1016 615 484 258 1230 508 132 646 910 557 941 391 139 161 387 1238 1220 307 1102 1125 265 97 1081 1350 1068 154 78 570 1118 66 441 1223 271 190 633 355 656 684 331 55 202 1002 533 200 661 1260 1106 1241 416 1113 304 1376 1189 343 785 193 201 1159 653 418 1082 93 347 455 337 486 568 851 945 110 276 1245 1244 1148 183 649 89 236 270 856 853 273 776 899 800 1174 963 481 49 765 565 638 1177 1139 156 976 57 698 968 87 1279 127 1091 581 645 1133 1312 431 367 605 429 1026 881 433 248 406 1294 977 180 932 897 381 1162 827 215 876 415 474 1280 444 317 512 1168 329 1252 364 744 488 54 263 585 470 662 927 121 939 1322 1145 293 20 77 624 815 5 1171 95 1258 1266 1155 688 1001 1050 224 82 1039 819 546 1013 1096 1231 1225 507 300 1313 562 39 30 1141 725 848 269 297 677 220 948 18 1047 536 788 359 1088 1314 849 494 543 511 1136 1300 349 402 282 926 1346 750 554 356 741 1064 551 436 309 94 1349 204 1317 103 301 888 1031 1353 147 718 1287 1122 935 227 1150 1344 772 864 579 840 198 363 62 1215 1199 191 801 1163 1373 168 1293 691 296 140 797 692 715 497 695 860 246 1074 683 1292 902 1154 84 606 1109 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 79
]
wts 2: 937 331 56 1317 1096 1133 1074 682 1001 957 909 845 647 1207 362 883 325 865 17 525 1359 1170 260 1188 857 1331 953 1243 1351 322 1300 853 237 969 1286 663 460 393 1135 918 82 23 1237 951 1260 1100 626 818 478 1091 455 255 550 452 524 694 1329 147 403 453 282 718 120 487 553 251 1164 1241 470 296 947 214 18 926 1129 346 834 1316 1173 1275 728 993 844 1153 155 305 40 1060 1146 1193 567 1033 1285 602 337 91 98 578 233 867 1357 622 1282 1262 1113 699 955 1059 58 1233 897 933 693 200 1274 1071 1168 628 725 689 107 359 118 544 572 172 563 871 1369 317 477 800 10 593 4 597 496 138 1048 151 1268 717 1197 638 565 225 705 400 1217 980 683 899 1077 372 866 1303 1023 828 1085 1126 22 42 256 656 678 425 832 479 1368 228 783 680 39 1006 798 1263 1024 1171 1245 1019 983 336 659 1231 764 1238 142 588 304 1354 932 864 203 392 232 648 601 1037 1053 618 456 1140 526 887 1342 751 139 450 15 458 1123 1007 839 1365 608 604 664 170 404 368 88 462 803 903 1311 568 891 1295 287 878 272 1094 744 856 1084 701 858 631 517 1244 1108 1229 1121 361 129 75 710 961 1013 979 1163 1336 490 943 434 265 121 949 600 7 86 355 1097 78 768 774 451 528 1358 510 128 1185 1130 267 36 141 43 1150 636 136 424 1120 833 555 696 1095 1334 1253 624 1265 958 874 1255 321 692 294 168 1216 1005 1249 1213 1293 630 820 813 812 1081 159 1375 1236 1220 1364 1258 721 1240 150 127 1251 350 978 1137 73 711 720 876 386 990 753 112 227 566 275 738 654 1110 211 231 302 177 1290 1003 667 239 1040 790 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 80
]
wts 2: 906 1367 854 116 241 134 111 269 64 1373 576 1368 1193 708 841 1205 127 135 688 222 1095 471 1202 518 384 736 715 1284 1025 17 695 1005 35 1043 1327 1311 1376 1305 1074 534 1321 295 530 1115 893 1263 1017 260 165 14 386 143 1072 175 399 327 464 1264 786 1016 466 1237 150 154 605 1301 614 1039 864 966 46 1065 1240 756 1166 783 774 283 1281 1038 1009 1055 699 941 1375 1227 620 316 639 65 1132 1347 246 468 603 691 95 109 950 513 452 1096 575 1110 931 998 416 880 18 266 45 685 1108 705 721 667 1228 1057 867 907 891 1031 1229 146 419 1293 1149 767 1003 281 850 1262 856 760 1316 847 77 1250 555 479 1322 57 1245 339 954 1032 843 1155 502 351 618 221 943 98 913 1168 1103 512 147 478 1062 1144 1081 860 67 336 113 981 884 2 58 885 85 683 220 1097 999 689 628 74 371 12 420 405 677 409 132 389 564 672 145 131 746 315 1120 284 528 631 151 1204 366 22 341 591 156 874 1105 589 1230 579 803 1199 490 1150 256 648 1372 106 48 701 920 908 1320 177 837 335 406 1182 507 438 1171 287 612 661 408 748 1124 1102 332 1226 1268 888 634 537 568 1067 915 577 1008 1119 646 581 771 827 1010 810 877 1026 1082 379 892 726 662 1090 1324 342 506 1030 105 377 495 1177 1212 595 655 1260 378 1350 47 862 41 868 169 1142 88 1052 520 1160 669 29 202 1219 811 1098 451 188 250 979 608 590 196 637 217 679 89 1275 193 828 1117 476 363 190 727 203 964 75 407 82 291 1116 493 1217 192 905 155 1181 879 402 709 103 1068 481 140 252 720 1191 286 510 6 477 604 166 27 118 1059 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 81
]
wts 2: 1330 458 520 781 760 1185 711 1379 1191 621 643 1032 1079 875 1044 446 416 679 1229 913 891 1259 483 73 256 618 677 646 1377 960 762 688 185 1128 629 443 832 921 898 1197 144 1283 710 1378 109 610 42 995 1327 266 1189 796 817 1038 983 453 258 1342 938 966 1078 99 1102 1084 376 437 764 879 1057 636 1178 1154 100 1180 797 89 96 113 1221 132 740 633 172 1152 524 354 1225 943 44 626 908 546 951 933 579 925 1355 1000 684 316 784 912 656 485 527 777 40 381 515 1093 1149 1052 950 347 1103 528 1325 1049 154 21 469 514 68 102 426 288 628 162 444 575 1222 1267 868 1263 167 199 20 623 1183 863 87 34 929 1082 1072 681 902 375 1252 1374 398 1246 349 468 178 1060 1099 603 682 331 389 1294 334 1177 1081 589 997 741 1322 915 46 18 752 504 424 255 1092 370 695 1242 1006 708 785 500 1110 461 1019 1305 431 163 72 634 1239 1088 33 723 1067 1148 429 940 1105 1380 968 1255 1017 254 324 845 701 186 357 1309 1232 302 794 508 240 329 612 1005 747 655 1168 911 642 22 554 1261 659 192 746 11 602 283 1106 542 275 1133 433 605 106 394 412 173 737 1306 1224 779 249 1333 454 790 676 1029 1160 1121 704 423 161 788 1009 1085 651 1321 282 724 1233 139 705 475 1307 650 118 742 1353 525 680 418 991 142 86 981 744 772 736 244 309 55 1188 233 224 1159 440 137 890 823 837 1132 263 1317 989 1227 1141 476 1146 549 949 1297 749 395 855 291 970 1158 530 1164 640 987 238 719 583 1070 1347 587 1012 484 466 1131 1304 1174 588 840 145 871 827 552 953 53 861 1096 1109 368 1015 479 97 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 82
]
wts 2: 1040 1251 1346 440 952 375 721 789 465 279 868 1128 832 259 89 1259 844 150 693 1124 791 221 554 4 646 1257 1364 481 1019 755 105 290 393 94 1334 1331 711 58 891 975 695 339 1351 645 512 957 1252 213 872 1096 766 744 1079 159 1037 1044 612 432 114 401 17 1185 1377 1181 346 1006 202 352 82 484 814 714 438 183 698 602 1332 538 53 1238 260 953 919 884 1003 348 828 28 1365 626 291 414 900 906 1064 128 772 129 351 1279 250 700 441 1326 985 436 1007 385 800 735 537 1286 839 332 118 1261 1302 1321 359 151 1227 1 343 382 225 542 933 496 1123 664 349 1358 1043 582 806 1263 1101 490 1315 653 1319 1330 869 144 730 809 43 780 728 184 145 1339 1186 860 139 1100 165 42 927 822 1284 636 893 1067 456 252 803 180 360 799 1171 131 1076 707 885 1195 873 1376 1373 104 528 335 127 682 590 752 736 1042 685 10 1271 606 179 300 1056 357 322 932 460 1303 716 311 1021 1292 59 758 276 67 722 901 410 91 20 1158 457 256 138 500 831 1293 748 587 485 790 593 819 1187 233 551 1104 1230 423 672 961 675 1288 842 1255 1245 726 568 574 472 840 1208 1188 618 650 1380 1338 248 161 1197 261 1160 824 883 1054 85 434 938 963 1247 525 699 686 642 1105 1018 280 1041 52 1032 154 798 88 614 134 566 1316 585 880 987 718 1253 474 408 601 57 966 1147 486 90 630 31 588 1008 157 615 482 1130 1224 1342 608 563 1031 725 875 849 416 673 1126 378 487 850 1099 405 1310 1372 1313 449 918 45 935 1176 226 1066 583 710 468 14 163 13 720 411 747 545 671 1060 640 1367 754 79 56 368 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 83
]
wts 2: 272 1128 1132 466 694 404 30 80 426 166 970 206 46 269 227 9 1279 1020 578 355 1244 1148 586 719 876 835 556 681 177 1233 130 313 1014 521 381 640 1343 214 233 126 344 907 139 633 1053 527 225 439 372 1165 502 768 865 1275 1203 32 1004 1346 1191 1208 1061 1227 1164 1033 773 430 325 781 105 840 692 300 583 1251 441 190 1197 1234 1341 724 886 888 393 526 567 64 1022 951 88 548 301 67 1204 786 167 873 621 944 725 1041 1242 993 1179 1263 1135 994 712 312 1059 302 391 915 1085 1253 339 138 1355 595 471 1326 956 529 904 453 1136 104 700 1087 609 920 574 997 338 6 1217 704 353 663 1064 580 1281 1300 1063 1174 935 966 565 1196 867 1374 351 427 932 1278 367 42 184 797 491 630 392 75 1276 1228 804 753 1366 954 236 902 1232 967 503 171 257 919 113 662 1338 568 1356 205 169 665 415 729 128 331 377 1299 922 17 987 1082 1013 33 137 889 371 1218 1311 1133 278 1003 657 1246 258 93 1144 1239 927 55 411 1027 854 29 596 823 267 973 116 1245 1078 268 279 1291 930 535 1216 334 1235 1185 874 1147 1288 200 230 228 1318 136 91 684 931 560 1316 561 892 92 162 71 792 1067 747 661 818 1037 615 650 1026 8 877 149 1255 170 410 235 433 505 1192 323 185 875 216 683 1006 543 618 655 870 1261 1360 924 478 181 318 202 245 1323 492 941 697 1086 1162 1243 750 1038 1040 1320 73 408 152 645 1344 70 887 1054 221 60 5 802 77 1241 879 1269 255 691 858 253 148 416 95 210 1221 845 231 96 220 850 198 793 741 1327 246 594 722 282 1024 1198 758 1139 1170 1188 134 990 953 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 84
]
wts 2: 583 809 819 485 533 1327 283 530 1167 1325 1332 1277 527 923 510 166 965 981 649 268 314 80 1035 571 633 747 1304 48 859 576 696 787 54 476 1239 216 414 1313 174 1140 587 337 914 443 1206 1020 1004 678 235 1012 421 1227 1027 584 722 1221 461 448 184 811 350 709 21 156 937 493 1241 373 203 1301 452 693 12 346 1171 703 856 178 1005 1285 71 1170 610 667 189 110 567 1147 105 699 1373 151 942 1192 1336 580 211 1308 145 1002 916 640 778 1082 1028 372 572 1237 655 771 1165 1369 114 806 1214 998 273 899 843 172 425 779 465 714 30 853 728 1078 1319 348 622 508 943 1359 1153 383 416 782 910 1117 857 675 983 86 17 758 441 975 479 1172 1115 1229 3 683 1377 1018 913 795 75 1102 1133 707 363 922 507 34 250 578 1121 202 170 1126 1110 1089 686 740 303 208 726 765 674 212 982 911 319 1265 107 438 984 22 929 969 304 905 775 206 1129 590 773 588 320 316 277 318 61 183 935 179 1365 65 1283 670 386 936 1183 807 1021 1168 200 1302 1164 972 245 553 285 164 827 684 100 774 956 781 1337 102 31 20 690 855 650 798 111 354 1242 838 477 209 1118 1014 1252 1244 870 1007 27 392 264 1104 389 322 1349 700 1299 869 730 666 1284 934 540 400 1088 741 593 317 175 926 299 525 671 904 985 1256 474 374 746 526 954 586 997 900 463 849 187 871 1040 1039 1137 1204 639 1274 1163 412 468 625 698 1050 966 832 341 575 10 51 220 1215 1211 38 833 546 1363 153 663 1329 1317 1210 736 803 248 1095 213 659 39 902 513 1022 1305 192 143 1036 1368 284 395 258 1034 1105 1263 978 330 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 85
]
wts 2: 1292 180 1309 1264 868 405 966 1282 515 343 304 1113 267 521 1114 958 313 475 934 1352 748 864 879 429 574 1084 211 776 1313 441 645 995 627 813 661 86 900 225 69 416 1197 73 894 1326 513 992 693 474 547 950 2 1333 1083 7 517 53 349 169 28 1357 702 1073 391 47 1190 65 1074 928 436 1187 1104 414 630 153 195 1059 754 912 741 41 192 1355 930 263 1294 581 75 647 219 921 1364 1141 496 45 896 120 763 780 597 599 1224 1147 998 1154 902 1139 1306 932 952 1245 637 931 1215 1186 244 437 838 1247 268 355 1380 1226 783 609 44 256 653 591 1048 685 478 150 356 373 588 942 626 34 593 381 673 270 721 904 1233 11 306 809 1132 124 472 808 1281 1240 1148 490 13 758 260 1017 181 924 1138 400 651 337 624 1266 141 881 1199 410 856 970 695 724 435 822 766 648 16 106 1056 394 1378 601 1198 46 962 866 1064 874 586 1007 488 1067 717 919 871 703 240 859 775 462 291 1317 918 1185 658 1276 530 853 737 352 727 30 342 851 810 393 194 392 652 1343 1105 949 235 1337 687 4 923 1002 123 639 994 188 732 1157 286 1086 1253 533 390 445 208 1213 175 420 1071 569 480 1369 939 372 1375 1255 1280 481 346 1151 989 234 1046 760 723 145 829 1108 427 1244 473 1209 17 602 226 625 294 262 816 1051 1283 1316 321 1026 791 1098 143 42 925 55 915 233 284 618 1293 578 1020 944 812 834 366 52 128 224 532 876 1057 979 350 67 1075 1131 1094 379 161 5 207 176 216 1146 1043 804 92 255 1109 339 202 438 402 506 1191 888 518 682 1058 560 1155 459 1001 890 39 276 972 606 1201 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 86
]
wts 2: 512 732 1351 148 1106 899 465 1255 834 1262 169 210 430 31 12 1339 126 655 1002 1182 365 383 757 1193 486 1266 997 1224 304 30 133 680 610 637 931 274 854 548 1298 540 374 1253 786 454 1183 537 837 1066 878 1219 318 1171 519 1174 43 943 498 916 105 258 1050 413 194 186 251 360 233 476 192 1071 578 446 387 960 1053 301 532 450 421 422 836 881 1126 720 1248 1246 675 1014 523 1152 218 774 26 1018 619 734 585 1378 394 448 307 670 1108 818 306 132 1363 1132 955 442 1251 1155 268 352 621 1009 528 907 951 424 248 298 640 1141 222 553 936 1115 447 749 1075 1045 11 20 1176 1242 1022 983 142 120 143 1120 1249 3 76 636 1038 927 198 1267 953 1010 1205 906 232 594 766 494 1142 414 415 279 124 1356 1306 662 874 962 380 1357 1338 1323 1138 1030 509 634 586 467 660 977 42 1067 1074 1070 1321 426 722 1041 243 253 945 1204 402 996 624 1169 534 74 1281 107 1083 96 406 36 242 121 59 855 174 338 94 401 1122 1128 1361 330 1168 747 529 451 679 690 1380 118 605 864 716 946 758 167 879 217 715 702 674 77 220 235 876 259 1117 579 423 1263 381 735 580 28 1309 871 62 419 437 5 88 1331 742 444 959 247 672 941 768 57 630 1073 1301 926 806 1151 929 66 417 135 974 443 257 1305 950 320 141 840 1368 746 608 1124 293 72 1279 764 1042 622 1275 1342 760 332 27 6 18 620 168 510 289 935 549 89 803 336 627 1055 503 613 391 576 53 207 280 1366 1052 303 166 700 729 321 403 158 339 386 184 561 719 913 600 428 1076 1264 411 676 10 557 714 1303 435 984 1276 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 87
]
wts 2: 1003 706 307 540 331 1252 1311 646 463 530 1326 951 280 330 579 58 1187 1336 768 145 1271 404 520 730 952 365 1292 136 709 413 912 464 657 440 38 1039 355 550 1228 571 622 618 1211 603 962 671 827 569 1045 30 1120 48 1227 466 79 185 904 389 808 1029 492 1365 34 719 1279 412 1073 880 135 1168 1205 593 1369 804 377 1106 1198 271 1155 210 958 1166 667 227 449 623 723 211 59 1145 1329 838 220 109 1137 284 242 17 237 1158 1000 1184 803 178 219 155 347 701 226 326 1133 258 341 1097 308 314 369 1103 814 684 637 306 405 697 760 165 985 14 832 273 1038 400 15 1291 76 60 1022 1185 694 696 1072 866 8 884 1349 167 794 460 1289 276 969 1025 1138 676 1035 234 541 409 721 497 157 315 621 675 375 40 1300 399 679 1173 1005 324 664 626 213 1114 896 1186 528 947 758 212 542 278 1156 263 500 1063 1229 1280 533 262 1246 1257 1151 849 39 1149 473 556 78 510 1085 1204 296 1278 563 708 925 360 346 960 594 81 642 121 1316 450 517 918 1047 739 349 807 71 416 558 260 391 133 577 619 348 975 1142 1065 325 176 291 1008 1290 1276 560 785 1139 1098 565 786 444 615 828 532 943 927 421 144 69 65 502 322 948 1179 647 845 323 352 477 1244 678 761 1194 613 1216 132 93 954 316 428 914 711 783 1092 228 345 1028 695 448 240 33 26 12 1006 1071 87 42 648 1109 1217 599 13 388 411 1301 358 188 686 100 295 846 973 527 353 398 968 889 605 1122 20 1203 235 501 206 839 815 811 1161 640 10 1052 1059 75 861 824 156 596 1331 662 461 1077 1075 612 1 601 392 728 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 88
]
wts 2: 394 1023 757 903 883 1022 742 770 74 533 97 313 1171 1239 529 159 405 90 787 719 877 925 738 171 1364 482 515 1147 218 689 993 522 1189 766 729 778 777 856 871 449 726 89 59 916 17 198 1161 512 381 284 1155 942 602 248 163 1317 467 1274 1040 315 492 1158 149 935 1223 574 1220 1304 560 1195 1125 1342 563 494 679 162 682 639 1363 634 487 957 1098 1335 206 45 657 1273 1227 1024 1061 1213 1157 1204 670 542 898 1017 398 1178 1252 603 396 1078 555 1113 1305 1053 885 1280 754 1184 1338 235 1160 98 1070 1367 936 538 121 361 1307 804 225 320 161 3 545 83 828 879 177 864 1182 258 1214 763 756 450 465 997 717 1334 114 1139 921 610 393 659 649 680 551 564 268 1333 668 53 117 596 1365 22 886 342 141 848 710 1172 1200 759 1130 969 853 232 1142 1250 944 400 1243 5 461 179 1359 1114 1241 1035 656 36 460 819 995 1373 82 1238 644 641 1191 1270 1185 752 422 221 952 1289 412 236 131 1286 113 1234 924 1350 439 372 637 476 1268 1356 101 1133 658 586 105 402 96 448 57 345 638 1004 614 1152 80 317 452 409 46 493 246 430 431 1176 401 612 118 544 615 1219 292 1089 199 137 994 1151 741 1019 58 694 1194 509 1109 850 627 1115 327 234 1066 128 1097 1228 174 852 999 1198 1340 1267 318 207 1337 1144 1249 178 1027 203 975 1310 576 150 718 847 434 1235 500 333 685 1336 651 802 1121 1369 1332 425 579 733 406 354 132 1012 19 980 901 238 192 1001 156 360 646 1216 104 895 424 1260 1222 643 792 1011 1118 151 348 442 1278 355 922 67 888 44 56 260 33 808 1233 960 69 706 963 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 89
]
wts 2: 834 1292 378 867 1233 1092 835 945 791 270 81 1365 820 217 115 692 1194 443 1053 614 490 949 1329 619 1348 363 1085 357 1164 1302 436 372 890 1208 188 1061 552 1084 599 935 852 644 955 606 960 80 20 86 1024 358 1211 655 555 918 333 838 454 1262 1112 88 470 744 161 404 519 331 293 1364 464 264 966 983 713 1147 623 498 841 396 831 199 278 338 242 325 371 797 612 83 593 703 116 728 844 615 426 170 487 1136 542 1259 246 749 627 1335 472 780 1266 868 1090 361 1108 447 477 1346 1260 507 1376 38 1349 381 857 165 93 921 932 900 1258 986 236 7 682 971 324 376 650 1310 249 1286 1300 484 501 431 434 803 516 213 1333 706 1175 1032 1184 111 77 157 359 196 62 1049 284 699 548 1150 766 387 981 144 489 1030 629 925 513 1094 813 943 1006 677 1355 1023 326 912 600 913 96 642 467 136 1110 1269 1038 15 97 224 767 201 54 822 1080 388 105 129 327 636 263 393 313 1137 1017 28 137 70 1285 802 595 348 1362 810 851 1308 1151 365 1129 1236 937 1103 141 1304 894 244 1380 745 897 58 757 1104 551 1187 963 778 397 220 1312 866 875 355 6 1322 1288 590 1343 554 186 641 1135 412 122 41 183 1190 207 889 362 729 664 1330 557 440 1347 1370 654 194 975 139 680 877 342 1283 833 1119 1307 1243 422 556 1281 1216 811 8 114 827 1133 1203 461 413 285 974 460 257 929 1273 1240 882 1022 804 24 711 211 1276 1140 657 726 884 130 646 462 1315 788 271 761 584 848 800 400 481 499 580 49 1341 968 37 1311 226 895 1179 1105 608 478 410 126 1192 78 961 1358 374 707 274 159 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 90
]
wts 2: 632 382 96 920 1166 552 1278 1086 1236 531 1368 765 98 395 213 880 383 1135 358 278 590 647 1251 326 511 653 127 741 275 666 849 400 873 564 214 809 954 300 459 298 562 776 1175 1063 899 807 70 600 649 1002 1078 1176 696 149 780 86 231 1243 581 1213 364 129 756 1360 875 368 458 949 334 389 1058 709 1147 592 1121 1257 140 854 530 1015 182 1211 733 1308 558 651 844 607 1110 576 153 37 968 337 428 314 572 1304 349 35 705 635 438 362 923 812 191 159 951 377 184 1082 222 198 1109 1167 345 538 1344 111 601 1046 8 209 697 305 1289 100 983 484 672 390 28 179 907 580 1208 470 343 566 495 748 420 1380 436 1111 1235 375 276 925 122 743 240 18 722 246 1196 643 80 487 614 1162 437 67 1088 22 145 412 817 449 933 1362 1225 10 226 960 277 974 1336 66 304 1051 813 1134 617 188 657 269 133 1201 1174 931 442 31 1072 1008 595 916 4 1165 425 61 927 965 136 1347 65 972 236 775 388 7 11 1059 1193 664 1245 740 700 468 243 233 943 636 908 1104 540 1070 867 418 755 766 475 407 1330 822 355 860 791 833 881 1279 1343 837 612 1238 1357 1138 869 1315 961 889 895 1189 1061 34 918 973 1031 1029 124 864 963 76 1262 261 628 454 1194 1282 1130 452 826 1375 52 1239 887 1187 1292 633 795 982 232 868 173 503 91 341 541 1140 19 1266 1093 570 456 427 690 285 1075 1249 821 917 217 806 509 108 1098 524 1133 158 911 283 59 335 884 1206 446 1128 1019 1060 465 81 1339 987 1076 177 1311 146 493 781 955 1302 905 737 839 1350 172 54 1152 550 763 112 203 1267 1103 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 91
]
wts 2: 561 1367 752 689 69 507 1091 1289 237 193 971 1325 523 878 73 388 909 1255 341 497 18 421 429 503 454 745 1245 85 1365 10 189 1339 333 522 727 377 303 452 768 1108 647 74 534 610 1041 624 53 442 276 1323 1361 1002 1096 1076 881 202 579 1301 1115 854 1116 671 615 1268 134 40 787 245 80 924 1303 735 422 1013 716 297 65 1045 308 697 638 1368 499 1311 532 546 153 783 795 439 1295 927 763 19 1025 136 742 1247 923 893 939 856 394 572 1100 994 79 843 127 1258 1221 1011 1212 298 996 236 362 1010 1240 148 4 850 278 888 345 520 662 1154 1053 455 54 811 1262 1128 718 1087 607 679 524 38 738 459 1355 1264 328 749 449 989 114 948 792 125 464 1278 605 630 273 945 92 1037 1138 780 1287 159 316 320 448 14 826 862 258 1176 1157 1074 334 573 959 621 617 637 872 640 410 481 892 537 1135 941 802 1300 1005 161 307 1035 251 485 484 1251 113 1259 629 274 673 5 912 221 632 272 352 874 896 444 145 270 478 1250 400 663 786 1337 880 919 701 706 1133 833 1254 147 177 717 1363 720 371 1243 210 847 1103 369 1316 1218 232 943 669 1364 208 1174 899 1348 890 988 158 724 626 31 623 1052 322 785 286 636 1307 684 106 1104 1012 1333 218 975 1134 1015 818 533 1080 353 280 383 332 1141 1331 1064 420 206 279 852 1111 1286 483 672 335 1088 898 920 1117 288 26 891 974 95 740 867 589 319 529 1214 160 149 22 509 1304 604 479 1038 750 618 585 163 285 1235 1329 746 918 453 1158 112 501 905 387 1266 556 627 46 209 1312 807 1275 1310 911 560 1165 187 586 566 498 661 1166 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 92
]
wts 2: 833 1175 957 813 295 138 479 690 1302 768 890 1116 1235 429 906 872 938 448 1367 1255 484 381 1007 1040 20 306 78 585 629 501 310 968 634 1228 91 808 541 41 260 314 926 799 1027 851 94 155 4 266 1206 764 14 44 865 1085 776 414 997 463 1132 431 1077 553 199 1187 936 230 313 670 675 942 300 1343 958 918 1123 1014 1046 852 1108 110 157 695 1118 720 928 966 976 1054 1262 1071 800 461 701 573 1336 436 1127 636 1177 1022 1333 1242 1377 1351 510 786 1264 1016 715 1134 1061 874 335 446 242 829 653 464 772 939 1091 575 1185 1324 146 375 563 571 1348 282 196 1080 1075 433 603 54 1261 840 13 688 1203 1328 322 1035 919 98 846 735 1 1259 929 184 471 1260 577 435 566 536 474 1258 1226 1247 1219 351 124 418 292 726 1254 590 655 1064 1168 58 714 31 197 960 574 486 1291 1318 1020 641 516 34 580 1102 370 1164 454 584 1153 291 48 1088 696 481 730 496 303 1004 119 1128 122 357 1155 233 192 404 332 115 1033 1340 798 728 533 273 1092 505 504 866 538 1069 511 1001 225 21 1003 211 326 148 305 669 732 854 1215 821 135 57 513 882 46 1139 259 139 1251 173 1378 89 1103 1315 1114 1062 1284 136 984 116 113 1356 493 270 1043 1361 455 362 952 1081 548 1186 861 734 75 247 208 792 648 1162 195 719 970 692 252 475 45 659 1217 1364 1136 63 830 395 1229 795 1347 1345 601 1056 47 384 239 1188 724 324 1100 1119 1048 637 143 356 145 187 515 1182 983 1112 1121 331 257 950 954 1277 96 1350 1131 1073 35 1256 741 22 82 1292 535 52 1325 820 175 1055 400 416 886 364 244 817 201 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 93
]
wts 2: 69 596 704 1278 795 696 17 1121 988 101 35 220 1074 637 498 1308 1003 99 28 1216 452 420 419 835 1360 1153 395 825 1262 1172 1028 177 1237 348 653 763 892 269 809 484 1133 551 870 1375 371 45 950 1025 1338 946 1377 760 1348 304 953 483 1160 323 736 1123 1334 1218 556 1359 1288 759 184 1252 48 603 429 643 951 1327 1017 345 262 542 1122 949 499 388 187 1254 489 854 718 536 254 202 508 354 191 357 2 124 1094 500 1248 881 1032 618 243 902 880 956 1090 1065 548 609 80 1208 201 1244 145 1062 189 758 126 661 1014 467 808 413 369 789 513 313 1229 1279 1066 640 449 103 125 912 885 850 1316 1144 938 1361 741 679 743 672 137 72 1080 379 756 163 1046 705 1173 807 921 1239 740 1302 1106 422 852 771 350 123 581 244 161 1177 1253 894 192 626 212 1138 259 707 188 1345 1306 26 915 152 1137 4 505 1228 567 659 945 666 1290 742 377 363 233 183 294 468 303 914 627 802 755 803 564 77 613 512 200 821 1011 79 1355 1251 42 1174 44 21 1365 973 879 1246 770 278 1114 767 665 1363 268 690 932 1269 1191 633 231 974 139 160 317 526 1180 1053 1211 732 1141 59 911 460 19 722 762 457 158 1323 985 562 960 706 1069 438 563 3 132 1038 511 7 221 964 249 735 1143 698 1 1119 1192 930 16 944 374 117 355 510 1131 174 250 587 107 994 1129 1277 886 384 408 344 529 1344 1132 1079 1155 636 1193 1076 1296 83 574 700 907 832 1026 24 648 238 923 593 272 1040 289 372 785 989 155 1332 552 746 517 1281 522 1059 691 365 144 897 954 958 1103 410 777 428 1030 543 248 784 651 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 94
]
wts 2: 948 834 458 1253 947 821 106 1257 203 423 970 30 318 919 33 679 769 51 317 148 1358 896 1099 1129 566 415 391 73 31 1085 50 635 1233 649 766 206 92 414 215 271 88 496 850 406 383 1004 953 1313 1171 49 1002 798 615 815 194 144 1135 517 243 763 221 714 257 133 1340 123 924 991 1076 235 593 702 1231 291 66 407 833 74 57 212 396 928 818 572 1252 55 89 1037 1041 1191 636 623 348 1175 930 1219 336 479 1017 1172 971 975 576 682 1107 93 178 564 1183 174 405 367 286 555 866 34 696 723 299 381 603 1230 737 705 339 741 710 934 491 905 217 864 289 674 1320 382 1256 579 1058 350 816 1139 304 1094 1213 1312 1374 1232 589 945 632 152 128 497 524 1148 451 151 1140 1097 1377 357 1160 1168 340 1038 401 326 979 146 1042 149 63 481 314 28 1311 529 1268 402 1359 661 1334 1066 399 910 786 1322 985 417 963 820 811 1344 904 1055 843 897 155 643 957 1159 942 1075 830 870 1339 526 225 1195 416 539 777 1031 1173 1071 1151 1179 293 908 588 692 1297 1188 275 454 37 751 883 960 978 290 355 1143 263 437 1153 1132 404 913 724 1170 1045 80 1371 281 893 655 509 612 327 425 316 840 380 65 1154 1119 1051 586 333 1274 1131 613 1184 98 335 1167 758 266 94 484 228 273 1329 878 199 424 62 1162 76 495 251 689 1029 1133 1379 557 86 888 1016 500 78 460 996 264 528 303 1056 422 432 1237 35 660 680 260 1323 181 172 1265 976 53 911 190 1008 261 175 677 1353 1269 68 288 1304 1367 1072 1303 1108 1295 302 1285 1196 676 58 434 36 347 120 337 599 157 1047 876 587 229 154 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 95
]
wts 2: 880 1292 750 589 744 105 656 578 282 517 984 445 264 124 221 843 1211 1001 41 1311 30 691 1038 762 203 349 237 351 29 155 353 674 387 509 947 1147 1316 172 259 1283 322 948 554 647 466 256 601 340 1015 1320 831 432 1039 1169 260 386 1372 705 1048 1272 1007 1082 28 712 1137 477 382 146 946 453 1108 234 832 430 1229 298 638 562 1134 459 824 823 329 1021 253 889 1037 315 1203 148 478 37 525 809 406 350 603 579 1309 140 951 936 1290 1223 516 71 433 922 982 1151 542 110 926 205 627 142 785 255 302 455 1269 1100 612 775 138 63 892 460 500 763 181 1114 918 389 673 1274 113 816 1124 1210 133 153 777 765 122 456 728 1028 454 1105 1228 633 244 896 1226 359 592 447 11 1218 1230 699 1065 334 1236 1241 354 1085 1339 669 1266 961 46 17 1183 704 645 504 14 703 568 243 337 1128 571 825 294 297 344 1174 499 632 680 690 271 1300 292 619 443 60 408 287 327 1298 561 120 1301 399 258 903 501 1136 91 1280 979 261 458 661 821 862 788 468 1299 1322 811 465 246 1200 678 790 473 937 519 860 376 508 1192 565 189 808 773 317 413 1282 726 167 436 20 1303 440 31 950 998 720 369 968 26 1044 141 856 772 938 909 706 106 361 1324 18 216 630 418 1084 587 1206 147 1184 1163 876 1103 183 464 1187 846 701 375 1062 423 470 325 996 526 634 677 52 448 503 671 57 964 55 529 346 798 1176 866 1025 1133 362 61 888 1173 463 793 900 1227 99 1340 488 1008 1356 397 1118 1139 707 893 1352 731 617 268 1121 1046 414 38 425 177 702 1123 173 688 1365 1257 435 1079 751 935 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 96
]
wts 2: 253 570 1365 1330 63 757 54 25 1033 791 1288 1062 188 192 248 256 1166 904 157 1336 1176 1380 1272 276 978 233 1045 592 1347 600 905 1190 13 432 73 588 496 823 644 1048 1179 241 349 1099 460 509 527 41 571 383 148 16 559 34 353 322 939 1197 880 438 557 1137 970 469 659 1210 243 286 1378 1107 1160 306 393 551 71 511 1064 277 1133 563 913 1046 728 705 362 352 537 180 465 682 947 926 1326 1274 347 1198 764 69 187 425 1313 414 160 960 408 209 1055 860 488 378 382 837 1352 1172 102 1096 1030 1302 74 1229 1154 1291 1315 769 39 111 910 43 833 924 1029 448 20 703 1004 6 840 834 1084 40 5 78 543 567 135 892 821 194 1324 117 676 1224 1200 816 158 854 307 575 1052 948 456 609 171 545 716 663 319 289 1202 185 586 1261 350 1367 761 1228 961 242 1108 1058 700 1063 14 371 435 329 1349 123 461 504 998 752 90 196 1292 1253 634 313 887 997 715 462 1255 330 646 1356 758 159 335 1092 1216 722 765 639 1368 312 1284 1279 974 356 1118 930 1002 573 1361 712 984 739 909 1377 239 381 730 1194 825 572 606 64 1234 711 638 178 391 1289 1312 283 1131 1334 105 890 189 562 674 1127 692 845 576 373 1375 376 398 649 1059 501 452 337 1026 938 515 1098 1245 1191 630 67 658 1379 270 1124 202 777 375 1206 1114 140 354 210 742 363 1256 29 1189 782 471 512 314 397 552 1322 900 1111 2 1116 493 651 85 311 637 450 1017 778 1085 344 915 1061 694 1304 22 1024 1066 1104 328 478 741 53 82 585 282 1311 120 475 220 137 77 442 529 1173 856 957 1186 616 744 553 96 221 808 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 97
]
wts 2: 1142 1121 1254 397 1188 452 1242 679 985 1255 691 498 212 429 918 599 1058 845 767 689 27 589 1024 4 747 249 1094 619 651 1328 841 338 28 285 986 733 265 1173 608 561 1044 157 864 839 610 274 549 1025 92 1036 1149 355 63 1167 25 550 433 914 1072 1292 297 832 1103 1083 969 876 1069 187 252 463 732 109 435 617 359 542 623 994 506 906 897 1138 1377 415 513 426 768 1342 1184 904 41 1357 1057 806 956 259 887 922 363 375 1289 217 1124 490 487 595 71 875 430 812 802 762 1309 1244 951 835 1374 648 1333 1372 658 1310 80 532 74 964 633 1091 106 911 939 160 1135 697 1199 1125 349 1235 870 1326 902 445 681 605 701 896 1001 508 1155 792 1147 741 552 1040 1095 696 214 731 1086 143 43 1312 461 188 1368 1003 362 905 329 769 615 1011 1145 531 1252 1178 1269 244 37 193 327 952 752 281 795 171 365 811 1034 88 183 1160 1027 1171 147 21 291 541 953 778 962 57 892 48 537 471 140 1190 663 1163 1214 148 432 1373 400 1122 1131 480 846 434 371 1229 1158 1268 208 85 1247 425 647 59 423 722 907 1051 108 391 394 161 234 1293 1046 1330 10 996 409 999 791 1340 1234 940 1295 834 955 404 885 851 596 943 1054 142 233 26 917 152 757 200 699 369 784 3 1089 293 631 760 1365 305 1185 1120 64 98 765 1248 591 947 705 1084 481 330 534 931 440 874 786 1267 1311 979 30 1139 524 230 873 266 352 337 1004 772 1313 1215 186 1222 1345 815 1302 408 1130 603 1329 1191 1206 1067 1319 587 1047 1338 971 789 926 1049 814 1343 545 488 436 1257 984 644 729 1026 414 620 473 1108 446 294 844 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 98
]
wts 2: 398 1322 1254 1007 1299 364 1127 251 675 29 1004 588 799 268 203 650 1244 703 496 693 1365 1356 343 137 1369 463 938 39 679 855 156 272 834 624 1212 186 264 1318 248 355 5 1232 691 388 1328 688 706 488 826 7 1205 1189 1023 876 701 206 421 618 867 544 971 397 298 704 340 221 459 417 922 763 557 277 306 730 1125 420 178 466 509 1221 344 1014 716 886 983 351 1290 1282 900 334 400 827 1006 1346 412 1354 518 1317 28 1359 73 844 1196 833 608 980 202 232 856 529 1159 1028 591 1048 1063 1107 319 480 979 505 610 1380 662 550 46 622 1367 967 309 690 1002 1021 621 36 946 512 957 1371 683 758 593 441 1138 1105 645 1151 754 70 575 198 1088 549 630 600 1173 68 332 824 375 276 236 279 1209 565 902 336 1083 1357 113 702 551 381 301 846 106 1016 1323 117 639 15 1353 934 94 959 737 1165 668 362 1075 1106 501 111 904 78 1247 601 696 278 418 19 564 284 1172 1009 1208 1167 192 194 392 129 727 670 841 1091 721 349 589 1277 711 124 1336 1201 386 181 250 1320 41 497 1297 260 1152 1188 910 719 1168 714 1096 391 1035 179 1366 1294 761 115 658 1148 138 682 1051 1210 567 976 1045 354 157 1022 1223 1340 1162 1133 671 1363 1316 346 1361 751 226 165 568 838 1248 287 991 502 1147 1230 953 735 1291 477 479 635 794 37 1121 556 1217 1280 331 1372 865 1242 104 907 1213 481 1049 862 1241 163 913 1272 460 644 684 83 1008 389 1243 1043 782 193 147 196 1011 562 582 672 495 31 8 370 963 116 1308 267 40 1375 172 603 1309 325 1124 211 79 313 739 811 1136 1224 1345 322 286 520 563 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 99
]
wts 2: 267 349 715 1220 235 902 286 1068 1095 1012 700 843 824 1058 1297 373 1101 199 594 1008 885 107 298 1050 536 392 762 811 1257 1334 1276 230 1356 1022 670 192 761 14 176 1325 948 655 1311 582 103 1187 306 602 957 979 739 487 532 943 184 629 949 852 723 1092 1198 742 2 1316 773 5 545 444 427 1055 278 234 30 1155 1169 194 479 866 270 938 538 628 1242 1003 732 272 684 473 1365 304 921 1051 1177 1291 456 769 964 667 29 918 575 1016 1064 571 491 454 8 815 409 295 1324 677 565 141 396 1348 1234 360 778 516 1205 560 653 1089 1005 990 905 961 828 138 13 1191 669 423 1131 1140 626 620 1314 809 724 825 1142 1113 634 1337 527 903 262 19 28 535 265 746 188 1164 512 570 1283 1265 988 912 797 719 1157 985 269 195 22 1245 310 764 86 1287 119 801 1342 477 150 568 70 873 861 631 301 163 864 159 531 1353 157 58 39 266 556 1078 772 1180 143 687 756 551 743 367 804 945 356 1236 1026 348 805 623 347 76 925 101 339 780 796 1240 685 630 330 1138 874 871 942 1282 282 738 240 635 1097 641 1065 1305 745 357 496 312 698 664 642 1354 248 55 153 1364 1200 589 366 812 1274 577 1248 1210 1090 624 128 1069 324 165 1093 1377 933 940 98 658 431 528 963 660 768 1339 291 417 1326 810 327 896 520 572 1144 659 1269 966 1223 639 1007 372 693 548 50 567 1015 281 951 627 227 688 944 793 104 956 1178 36 590 332 289 830 977 474 823 965 616 826 995 264 1076 1077 782 673 718 1281 471 379 1108 105 290 245 794 382 173 1206 1343 1070 613 601 862 472 346 1154 1116 1308 419 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 100
]
wts 2: 143 1227 167 1233 960 533 341 991 330 685 1282 528 988 1019 612 810 984 1024 1198 147 255 886 566 933 600 1264 505 939 1257 630 1181 837 1226 410 1218 477 761 1044 95 258 104 1343 520 23 300 1152 181 281 624 734 142 1137 1160 614 848 780 1194 66 1283 445 326 1083 1005 1324 242 1229 543 403 847 599 425 1374 213 841 803 418 1237 322 269 54 266 941 1345 906 77 486 24 495 784 282 76 1035 1048 706 1363 1330 930 783 411 560 1039 1038 1187 1246 13 563 1041 34 424 382 37 1057 1298 116 488 663 768 637 179 1178 244 64 982 968 669 1276 1380 1210 332 10 516 413 419 297 524 1235 916 1114 464 833 1034 1080 972 36 68 654 548 1373 745 1336 1138 172 1250 493 989 1262 763 1081 647 608 1094 293 863 964 814 870 1021 840 550 559 1074 1029 1061 290 364 947 764 914 1030 762 1286 1000 808 339 928 708 470 921 879 632 498 129 1126 945 133 1186 45 173 1211 334 1050 584 12 298 1037 273 642 131 446 1319 426 238 1129 359 1051 71 587 724 969 50 208 115 409 165 8 354 399 506 978 1075 301 1342 901 954 580 1265 1305 1172 652 1351 296 1296 1306 940 1066 432 1014 1366 421 975 385 225 207 4 661 388 736 1315 454 250 561 946 369 596 467 163 189 1073 312 1335 1054 11 1101 1169 871 826 141 998 1182 319 613 313 251 673 1253 285 687 392 335 391 1368 659 1362 357 656 985 757 1268 137 1176 128 158 1026 43 529 56 1318 202 1236 85 243 1049 602 168 1256 1189 651 291 393 259 804 132 492 1118 527 629 697 567 107 809 1117 26 422 171 337 540 1303 152 1177 752 1326 473 458 715 943 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 101
]
wts 2: 947 898 702 245 502 4 861 781 1268 931 1331 252 149 789 21 147 194 432 1031 180 658 697 389 412 198 1107 1132 501 100 531 552 665 1344 1356 237 1297 470 495 434 1074 1314 351 968 1169 782 775 248 343 126 1020 1368 714 349 213 251 402 698 723 111 406 780 54 860 556 1311 730 706 617 239 611 743 1278 963 509 16 1223 110 217 165 997 376 1294 192 88 214 170 954 1142 310 1002 320 1032 872 409 177 990 329 1119 124 901 407 384 1243 550 589 1176 270 1172 1332 49 220 764 687 796 1155 588 1318 1228 757 989 876 529 1337 895 1143 832 911 1253 966 1117 1304 508 137 178 91 1224 1345 230 979 1103 107 1225 725 908 497 1220 316 299 186 103 179 695 429 799 425 383 1267 514 317 275 754 1265 1354 33 842 387 340 843 260 255 15 816 373 368 1315 783 510 290 936 120 6 424 1334 582 1043 683 934 63 1151 1179 859 900 746 342 218 59 1131 131 676 938 1003 1236 810 641 926 52 1045 197 885 339 155 729 282 530 630 645 244 1277 615 87 1128 1218 1193 1171 1328 116 365 301 73 1184 277 76 536 89 709 850 761 1146 215 455 586 1183 419 967 559 749 247 1373 1276 394 1306 663 1013 728 572 673 86 511 713 598 879 504 249 45 341 940 1037 388 1329 1180 1274 393 392 1288 554 269 1327 828 146 1261 1122 1367 467 123 1017 845 382 427 140 794 1144 121 919 1162 1296 563 1255 869 583 915 618 413 166 57 513 874 681 923 372 229 791 526 1135 1264 276 231 1322 1279 1346 47 881 653 1250 971 610 925 880 488 408 330 1321 1054 616 1007 1076 331 686 763 652 1299 995 61 99 647 168 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 102
]
wts 2: 1268 96 65 1326 1173 586 799 1102 944 959 827 466 1033 374 126 1375 1255 330 1343 319 978 386 817 1356 766 774 279 794 1157 1032 939 39 893 807 460 11 720 1341 1017 821 371 155 1365 856 588 127 865 545 280 1004 19 850 590 541 1246 562 1074 1227 852 358 788 317 178 591 1164 658 928 1047 425 1088 1131 1284 1140 1333 407 307 879 648 1076 1073 191 749 55 193 136 999 286 1199 912 1275 329 1294 686 113 1026 876 898 281 1210 1257 21 796 1237 253 337 868 863 1003 721 1015 1228 284 647 754 920 396 878 395 616 515 273 563 1122 757 1259 33 805 480 732 853 69 895 172 398 1121 1096 530 1010 941 1338 1162 146 660 313 922 1139 24 632 1186 516 897 598 362 808 1118 105 1214 709 678 463 703 72 375 1120 1097 1354 68 680 216 347 47 4 975 778 900 486 1349 66 391 14 1110 528 548 976 222 551 180 1202 532 137 803 751 1198 565 655 1077 160 1056 736 1080 378 607 1335 335 785 986 200 153 320 206 744 690 1302 1243 669 846 824 568 86 1261 1037 419 601 283 905 1119 1264 546 837 144 43 734 587 1235 581 118 123 1159 1367 1152 1043 1327 367 687 1193 638 487 985 296 1305 225 758 933 1226 322 447 597 271 1066 1263 474 1307 103 1372 1206 243 946 420 991 1013 51 1209 1342 525 579 356 1377 1108 599 806 453 1176 1061 64 1082 797 415 767 1039 1123 716 201 573 1323 593 1068 148 70 631 570 847 483 397 942 272 1282 278 511 1244 38 859 672 950 1291 962 522 537 1359 750 1144 913 584 499 692 175 1317 715 388 323 1270 1224 25 1339 683 392 1334 1332 1304 529 468 185 1355 1306 997 626 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 103
]
wts 2: 1190 1078 690 235 49 1040 1032 304 167 438 1255 947 1279 1200 36 229 907 73 899 256 853 264 865 357 1068 1082 196 372 1018 626 1163 125 1319 227 314 290 1256 164 614 923 180 611 1321 1099 957 945 261 109 942 259 591 1356 1017 801 1056 982 656 27 1042 949 412 1196 481 651 433 451 430 19 1168 719 1259 1141 460 524 1306 210 675 509 655 188 86 1109 1235 662 631 111 1188 213 119 283 554 461 489 361 857 293 81 1368 1170 249 508 154 152 286 1211 225 722 629 332 403 1191 936 1058 1157 1276 968 443 21 1204 1346 1295 633 911 1131 1115 131 605 574 1225 398 1260 870 1239 1258 184 729 757 1172 176 1037 289 708 725 1228 843 45 28 535 1221 764 950 661 606 704 776 1212 1345 755 898 1135 1312 1119 474 1070 724 686 712 284 168 1158 1358 927 545 1236 824 1242 1050 1062 589 214 415 798 1153 727 749 352 1350 25 896 1114 1030 579 881 868 312 4 822 359 248 1098 1359 1329 582 120 778 687 1088 638 47 1317 387 423 440 381 275 307 12 400 536 769 539 234 1192 1314 1217 202 155 1224 958 343 845 567 471 121 1110 1171 1331 990 365 740 363 463 1282 817 884 1104 1257 825 683 934 337 369 1012 515 1174 547 388 814 18 502 1351 1178 716 1344 739 83 1326 859 1152 1334 1057 726 449 1349 409 1016 97 565 1122 559 792 1143 981 670 209 295 95 553 336 499 82 330 522 619 24 1112 65 707 1316 866 506 861 1244 348 281 754 439 1234 496 124 630 39 1287 1100 1108 1194 1354 829 1002 303 752 847 1251 1268 975 56 1227 869 837 385 970 819 1233 1101 1045 746 356 61 465 1139 1067 306 468 745 779 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 104
]
wts 2: 737 600 912 36 939 819 856 629 755 1004 1273 245 1092 139 1307 503 889 1094 249 947 887 1061 793 1077 125 917 886 82 15 181 265 787 317 656 439 626 48 514 494 54 713 861 120 1087 451 418 414 109 102 166 425 443 1 749 799 1352 1222 1367 1276 1243 509 607 238 1008 1361 1238 310 471 390 670 1064 1245 369 500 951 507 358 480 606 1044 335 834 5 217 401 1296 671 478 491 1132 214 596 909 356 436 233 1366 717 473 937 594 343 344 384 1188 838 1155 148 68 189 620 1009 692 924 1124 1113 853 707 566 922 1320 394 715 1028 1380 39 767 673 222 752 579 1252 576 1259 167 506 1172 492 1138 1129 1115 1007 539 800 1114 1127 118 1319 781 995 639 964 872 1344 896 16 1045 747 632 448 455 1100 807 865 677 254 287 138 1258 432 1209 130 504 916 108 590 1116 722 465 1162 950 966 813 1040 23 1125 208 184 454 203 601 533 905 1016 496 986 567 530 1066 366 70 557 406 152 168 1014 586 268 1269 614 1073 1341 776 326 1334 1346 286 266 1187 207 10 392 797 1270 850 241 180 920 495 1088 1174 559 738 122 934 375 371 276 825 104 127 423 929 866 543 1097 88 135 17 893 529 474 408 360 58 1368 555 997 1339 898 421 199 77 262 985 226 744 175 525 1302 978 399 1164 228 213 1308 106 316 1149 434 1027 829 786 840 664 1347 711 1093 1312 663 994 802 141 111 727 59 826 1082 441 542 433 1219 655 427 571 1123 844 424 1070 179 1020 814 1053 936 879 969 422 1247 1063 610 493 400 71 552 250 565 1205 1322 556 151 915 1210 435 334 258 919 518 403 336 1375 110 370 524 651 289 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 105
]
wts 2: 233 137 192 673 899 17 214 782 865 1096 199 1245 444 1088 1184 1087 102 1270 864 1198 404 1218 191 1278 543 1010 1342 882 1025 759 128 677 282 200 21 628 686 627 525 568 1137 50 274 39 918 168 371 1262 501 1158 1368 925 283 40 1172 1371 827 46 133 1305 1264 103 33 612 1326 1095 1230 1223 1006 602 268 1335 1125 248 802 1036 1359 15 504 201 359 1268 1142 90 363 305 486 676 287 903 1255 59 615 563 593 355 61 661 1015 647 405 1091 48 1249 438 767 434 417 225 1030 967 537 691 659 1169 1141 412 539 458 735 1324 1094 803 796 929 557 122 8 183 710 1378 502 549 1187 1046 186 949 6 554 423 1355 1104 1241 716 1376 545 1143 1336 835 367 327 662 1321 956 833 523 724 220 87 1038 415 1277 269 393 1377 2 428 322 866 603 538 1193 607 660 941 1314 992 47 719 273 112 846 1101 302 520 104 1332 142 1257 1139 41 332 718 697 424 49 1003 541 663 141 418 1133 1380 521 411 385 436 1238 107 42 244 1050 56 45 1194 368 147 787 1093 389 1059 813 265 793 358 213 1173 1121 53 300 1310 407 1029 570 26 974 732 394 219 1224 872 529 556 1250 490 727 227 195 736 361 810 801 346 822 461 1001 721 915 1057 953 693 527 878 120 1216 629 747 223 390 34 149 770 1082 234 74 927 113 613 589 576 132 880 1018 380 566 1267 997 251 126 790 290 1282 466 620 1293 667 702 258 333 572 1020 648 16 1115 512 1113 1023 85 1220 1183 973 1098 471 706 665 939 1357 806 442 852 961 232 1157 986 1118 238 1211 1017 875 591 668 177 353 156 994 25 254 1347 318 451 988 862 375 288 582 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 106
]
wts 2: 480 1166 1222 74 93 355 225 739 782 128 704 105 720 347 427 820 775 763 1187 1241 503 352 207 442 429 927 204 906 751 324 1225 909 868 85 806 930 1093 752 1158 968 1224 679 1075 1201 1137 834 379 246 348 844 224 145 381 307 986 656 967 1271 66 490 705 424 819 809 147 890 1017 292 633 552 586 1315 127 356 680 1026 699 33 841 827 384 869 993 255 201 1071 910 519 1141 330 409 1207 141 1164 430 1128 350 1083 380 467 1240 1190 435 152 112 725 997 1028 1145 1245 94 337 1014 376 797 1346 1314 446 49 1380 557 393 364 412 413 1330 1262 104 188 517 1054 976 956 695 1055 395 791 860 600 1097 548 195 84 612 565 1148 1185 558 1206 82 897 719 8 394 153 1323 715 65 748 369 12 169 807 662 137 509 1319 5 373 362 498 1155 1342 1195 182 1243 825 39 14 1108 252 992 268 374 284 102 661 151 506 1293 542 157 1130 229 285 561 539 117 98 34 29 1371 358 1374 875 1010 1251 837 1317 502 602 734 9 813 482 1268 1199 1081 948 1044 61 289 282 174 1273 80 1320 769 1136 476 1169 79 922 497 1354 887 290 758 578 1221 333 375 754 1069 1184 360 269 1123 740 1153 1357 925 331 545 420 149 673 203 177 1161 1159 1084 370 1334 944 251 716 238 873 893 697 1285 513 516 627 1086 894 230 630 1065 295 107 391 181 622 1147 222 694 1286 790 1080 194 114 1345 972 1244 753 773 390 106 1313 16 89 711 880 205 737 623 69 850 1304 1311 45 189 148 1013 279 1301 689 898 1352 400 1 466 244 1111 241 472 937 988 253 278 1361 660 486 1228 648 158 629 1163 1182 296 964 1359 361 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 107
]
wts 2: 1072 1213 248 881 289 1311 1105 1024 1252 556 1199 437 1299 305 1338 18 462 896 428 575 1287 869 203 1272 1094 1249 834 550 994 756 965 197 24 737 719 400 100 1058 1212 1181 1176 753 1161 883 578 214 1092 352 1025 193 443 831 156 563 901 824 621 1189 1376 177 1069 1204 943 916 464 558 676 1028 503 820 481 604 732 1256 808 912 119 346 636 929 1336 945 183 800 98 38 1282 1132 14 1221 81 499 225 892 340 1361 1208 961 341 1033 822 23 508 1116 109 219 1267 694 315 383 1153 1323 1093 596 690 1347 1378 871 362 890 1183 1122 438 1071 486 561 233 1239 1281 976 172 52 150 612 675 1087 1365 688 891 367 222 683 1354 853 782 917 258 1126 485 1165 361 745 63 325 1218 1109 21 774 1163 93 594 538 794 790 1328 493 2 865 711 876 242 979 1027 1362 267 405 403 1147 1029 254 977 143 924 496 425 298 123 730 15 698 161 1342 1113 1255 793 1076 45 773 312 213 620 175 1290 791 249 1268 1078 709 606 1257 141 858 1127 1322 970 1065 1196 985 136 372 1286 593 934 517 41 714 91 1330 1144 245 1079 387 286 31 1216 796 1125 1091 878 243 277 1038 591 1138 646 964 723 906 654 529 576 778 659 379 1096 237 1271 1320 268 954 1194 1310 1026 104 278 348 1250 1201 1129 786 1253 270 142 601 546 173 27 653 904 767 716 766 713 941 1107 527 148 760 178 1154 809 643 682 412 421 686 608 864 391 1124 952 374 195 1140 781 476 279 525 707 188 176 610 1018 283 1374 492 543 616 1262 1353 373 595 95 32 33 216 657 461 1172 685 189 186 255 1223 908 799 313 523 389 617 971 86 1343 238 145 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 108
]
wts 2: 739 1127 467 1153 1358 412 1072 444 687 164 729 1180 654 814 759 1359 843 457 1018 837 143 731 356 653 577 1208 1286 564 882 498 1002 67 765 105 364 547 472 713 363 1255 1337 1306 102 1217 962 335 850 1271 1150 1001 562 931 1179 92 165 1376 438 1379 1215 732 1026 436 1148 725 558 980 1166 80 519 1339 1031 234 126 368 702 1114 712 482 70 347 1103 749 246 43 801 868 763 815 489 1214 14 607 238 767 184 584 671 960 60 163 979 688 667 261 990 200 110 454 1369 738 903 74 231 85 1098 276 1237 19 1011 410 598 355 1100 982 1008 177 954 311 203 1071 336 793 1084 1090 515 1048 911 96 705 190 268 818 118 338 1372 857 538 686 682 1192 1164 87 961 485 281 647 998 540 1206 691 613 674 721 840 104 546 297 1311 135 913 283 309 770 1106 114 493 644 640 1344 53 1017 266 608 307 1183 54 918 199 386 6 140 324 1108 829 1375 202 881 170 771 239 23 51 500 570 476 1252 284 260 669 1346 331 928 925 285 337 267 8 799 1055 1033 389 1097 580 366 709 505 240 88 1089 1338 1277 36 864 461 999 1159 225 315 99 835 733 1175 1276 128 803 965 897 643 469 956 693 1308 219 290 1162 15 573 1231 124 191 1092 1040 351 893 939 1171 275 1240 579 717 764 1357 1288 437 1198 1141 448 488 823 665 305 131 511 616 1091 223 895 614 831 794 977 1117 316 544 888 510 1300 1107 421 303 213 632 487 692 38 581 944 689 1334 1063 619 320 773 1109 817 1032 193 374 65 29 106 927 601 1303 1003 383 428 830 863 113 1064 319 744 1322 838 141 1290 499 350 48 714 40 341 136 889 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 109
]
wts 2: 843 438 461 1303 575 960 518 1024 801 445 1294 815 1135 287 89 1236 485 881 829 1287 1195 508 595 787 139 284 1103 966 1002 1046 348 1001 971 931 482 621 558 555 426 488 1193 458 261 788 824 335 42 1151 358 118 860 390 413 709 307 612 27 785 672 690 244 55 663 679 423 857 733 812 896 870 645 1344 310 450 732 331 225 456 394 704 958 693 94 282 846 1184 820 1248 875 1035 658 1171 766 802 540 1274 460 248 1372 692 104 382 255 28 93 345 737 446 1249 1320 374 1182 650 1131 1073 743 994 1284 952 367 905 1086 744 1354 312 951 682 571 1162 1376 884 113 1275 372 533 806 1124 1217 469 321 888 538 626 568 428 481 152 325 66 502 224 654 774 429 475 1136 1371 552 247 1034 1152 1150 340 431 1120 1021 45 557 246 1098 1224 614 1199 392 1164 108 442 106 1027 1057 1129 669 867 300 833 143 401 1222 343 1062 203 1143 777 1145 897 769 387 64 828 430 871 352 8 570 1312 1332 1076 207 366 1355 656 398 717 38 1160 270 459 1374 866 542 840 773 985 980 192 942 73 350 618 906 1347 62 1291 90 175 921 987 972 855 856 1313 1037 129 500 659 179 664 1084 1304 72 869 221 1203 918 435 556 332 85 110 67 1 537 1269 10 293 304 71 745 297 1302 286 970 1154 229 65 940 705 601 1095 463 195 1074 959 531 1292 169 1118 1192 1119 134 597 5 303 904 915 223 1059 336 13 356 1228 1185 808 911 1019 484 1273 521 908 1004 716 722 630 625 135 188 1353 1111 63 762 378 1180 92 144 98 660 684 758 1267 306 819 32 988 1088 218 25 402 127 981 859 573 718 993 209 138 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 110
]
wts 2: 425 6 1325 1296 1125 759 1197 1134 799 634 891 85 324 121 178 274 1349 786 28 99 429 1283 1240 1227 523 40 222 1276 144 979 683 1260 876 715 696 54 846 372 356 902 502 771 1205 544 48 998 428 731 1233 675 832 776 110 833 1189 25 529 972 200 703 1288 1064 660 981 1139 449 1248 708 879 238 384 956 951 558 359 985 987 51 1291 1050 1215 1181 455 1256 213 233 39 322 946 926 815 899 685 162 713 1013 524 448 678 1179 597 594 608 467 1100 342 582 407 447 1180 1123 126 403 889 257 218 752 720 335 180 1112 1165 1185 707 3 651 851 194 1299 499 751 908 492 127 482 244 83 457 431 718 349 927 674 229 1371 31 1007 128 1329 154 88 896 109 437 607 1301 590 115 250 65 1099 1092 853 1162 1304 1328 788 177 566 141 854 1286 676 163 855 1342 89 880 283 184 235 282 146 845 737 867 725 112 91 638 293 1361 474 769 204 1330 1144 44 1255 1155 215 262 895 193 1067 135 462 773 173 286 190 1292 120 1080 740 869 756 47 1234 426 1345 311 224 789 364 610 923 744 1359 1320 188 1154 984 930 113 817 1132 928 371 334 159 976 97 296 230 73 1077 209 628 593 243 368 800 202 130 30 578 1012 60 622 619 839 807 816 1060 969 521 541 510 560 114 1199 62 453 256 400 500 900 1093 944 140 1004 911 995 1186 423 783 974 490 878 1245 513 485 362 111 253 1214 196 1046 70 498 1070 822 1344 56 961 33 616 304 625 814 55 1063 617 1294 1096 1210 1105 1076 1293 866 343 650 702 216 1127 18 263 736 405 461 965 874 66 819 746 1370 338 931 385 980 1333 496 464 473 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 111
]
wts 2: 1293 98 886 93 1352 211 497 349 315 45 743 944 767 63 1226 1277 1371 1306 641 1243 1262 474 955 1109 593 543 107 1183 999 116 1270 429 64 494 733 357 949 194 1073 748 755 86 374 49 1157 399 173 110 84 583 61 939 868 1187 561 516 590 502 213 455 214 750 475 687 658 304 1207 112 705 957 198 894 1044 1336 922 156 25 350 1350 577 1132 852 129 836 1170 463 1230 24 423 982 72 1164 1239 717 8 764 414 1097 1287 588 869 34 898 1190 628 652 629 285 1156 845 1295 1078 801 998 835 834 1321 563 68 1105 892 60 1047 473 584 1215 167 168 1083 238 837 1346 320 1005 1020 122 492 704 65 615 533 744 256 344 773 80 369 769 921 305 1290 564 1349 523 941 514 1235 855 150 1343 918 1123 1285 504 597 260 287 217 967 517 556 352 510 311 1191 232 1213 1326 876 1334 108 1335 7 537 1380 929 631 1126 1189 956 248 1244 724 900 549 201 997 805 883 101 1007 1091 893 32 370 253 2 1130 219 927 15 372 327 361 973 1069 823 655 83 800 56 519 633 681 653 274 96 345 404 308 264 221 190 302 860 1212 891 793 1019 792 610 347 1141 291 1101 1236 9 157 92 867 783 645 226 1358 175 428 1159 239 460 71 613 728 237 79 482 472 700 861 1240 246 1367 387 567 33 839 338 1276 642 1108 666 599 461 245 1148 779 412 799 389 1004 1184 208 646 587 160 401 1300 231 318 1359 119 795 1254 843 105 1331 726 1299 43 676 863 440 1221 1309 23 817 1269 667 1000 212 188 1058 662 1374 975 831 376 323 1216 895 453 1356 1378 1263 51 262 708 1009 571 622 1271 371 758 1340 1142 27 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 112
]
wts 2: 776 83 1235 590 522 886 1161 1119 1300 928 694 931 1307 927 102 1151 882 482 843 171 1338 1003 513 263 933 427 24 1253 19 177 597 614 576 773 895 1051 386 226 266 3 1296 1227 1252 1026 116 468 1103 819 500 174 740 1019 430 53 821 1260 1193 712 1157 1062 172 833 41 617 355 606 917 1204 299 149 780 573 687 546 1183 72 379 788 454 179 121 1136 164 983 565 1077 741 1313 119 436 1239 1191 1295 660 853 619 162 1273 440 525 1251 676 1104 403 794 356 547 284 1030 244 940 959 1196 1039 1248 910 1302 648 722 322 1044 287 5 435 542 992 323 210 1057 996 1290 826 166 50 1209 665 845 1353 894 479 1099 1000 478 1115 1067 1171 738 720 559 1284 943 1141 1303 1298 588 625 352 194 77 1274 1304 192 650 610 793 344 753 304 423 390 1261 1027 984 1360 1152 810 732 953 1352 514 888 1256 44 150 502 359 114 1229 1041 1046 134 1348 211 255 1053 1195 387 357 129 480 912 1095 80 333 575 596 830 58 346 898 696 512 469 12 730 986 1098 271 48 856 538 726 695 802 865 283 338 1372 645 1268 117 724 1376 400 404 1145 1178 659 158 1344 185 1230 728 393 36 1168 768 1291 55 897 358 990 1123 1013 874 198 634 783 548 1160 1264 900 470 222 1247 1173 45 120 1367 1266 765 689 615 46 674 661 904 1202 395 723 485 762 876 49 503 1346 1326 467 32 850 123 30 577 1084 245 1315 926 842 602 1288 1225 572 458 644 1192 714 554 1299 1197 1339 169 208 756 508 1362 1105 649 1102 1016 1083 432 509 828 373 136 29 229 751 360 1074 1035 183 1007 414 858 202 847 739 600 409 1112 1121 1131 205 519 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 113
]
wts 2: 416 739 479 790 87 964 828 1248 752 1 1331 1343 329 82 850 498 915 89 728 340 1146 616 938 932 1022 886 121 1037 139 28 536 682 693 1298 445 1029 1041 704 30 408 1212 595 495 40 1049 741 866 748 496 559 1229 228 1088 999 599 1378 1297 369 289 970 42 1370 149 1208 956 665 560 555 985 74 733 1078 447 725 1365 550 399 180 478 583 1080 244 131 1322 917 1017 2 1201 269 487 699 523 1153 326 990 119 909 5 1285 321 1344 50 862 1052 422 631 107 1054 1009 337 632 1265 1093 444 118 421 1181 857 633 1110 615 348 1306 844 618 635 16 1155 508 309 314 952 160 305 1038 750 520 1209 398 6 805 19 1233 1119 320 614 953 1309 86 1329 440 1169 609 911 450 53 125 654 365 906 57 948 67 820 715 214 983 554 384 375 1066 112 779 634 476 648 361 865 1079 466 387 723 68 1111 1149 797 488 397 842 1292 1138 13 502 61 1269 1115 153 1242 891 1237 1380 322 706 684 235 1176 1250 1293 868 166 183 993 899 592 575 1314 230 809 923 606 1177 1240 128 1065 324 1175 731 1109 1112 249 729 767 1199 900 355 574 168 36 943 719 84 467 231 578 652 630 208 1238 668 717 517 913 702 683 428 238 1193 744 1101 1284 1005 784 636 577 827 1167 372 1369 898 474 773 826 867 824 838 1099 401 266 1326 277 509 434 1006 83 1160 637 353 1289 185 930 649 327 339 234 161 525 187 1087 1040 1202 845 1164 655 437 556 1226 1046 52 301 882 1191 778 253 710 1151 918 1357 345 1185 1135 261 283 79 392 1350 1090 104 364 1145 146 607 423 116 975 1308 732 613 169 181 939 250 141 332 295 1352 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 114
]
wts 2: 673 876 607 978 820 130 165 645 524 1265 552 271 234 799 1221 625 247 838 677 855 696 182 1111 1033 1282 309 150 1145 523 1247 129 707 501 921 795 330 24 674 266 373 944 684 176 454 116 1341 595 632 295 1207 518 255 115 1129 808 446 386 480 576 726 183 513 192 350 1305 1138 19 1280 504 1366 411 1223 582 705 277 612 101 77 764 675 89 606 1264 711 1193 1278 878 1352 1320 18 575 479 982 1250 863 676 784 1063 1297 804 892 174 349 1015 1094 652 928 758 97 866 100 325 974 837 291 453 744 314 585 736 642 864 364 567 1189 48 761 1000 538 194 1123 920 265 843 240 1147 536 430 1182 423 971 229 724 572 690 17 640 1256 329 998 700 172 65 163 301 885 355 1098 603 30 554 565 1030 858 46 1347 629 683 807 296 1127 414 992 283 922 378 1259 596 583 805 1176 599 67 862 146 1035 1012 434 915 362 1060 1354 936 1002 1058 783 562 223 589 602 785 322 829 1016 826 1378 1096 965 908 382 1306 1026 1238 468 682 664 840 765 112 1039 1261 895 955 828 661 1163 511 1024 1308 806 284 923 628 960 630 365 1055 1023 563 79 417 1183 1349 1257 155 593 1161 735 157 1086 940 1137 793 539 747 659 941 1332 634 12 794 231 57 1018 235 545 493 953 1241 861 868 1100 264 489 670 463 631 249 1291 202 509 755 1272 1233 929 302 832 668 460 233 1254 410 316 1107 484 1340 184 467 58 1101 1335 519 1339 702 999 173 228 1187 1310 203 1095 557 1134 207 360 462 622 1170 1166 943 1005 989 280 1270 654 1178 1029 1025 1049 723 948 1180 650 8 52 591 1083 1162 579 181 402 429 1358 276 1139 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 115
]
wts 2: 359 1214 236 347 893 196 1199 58 804 516 1150 950 741 292 1178 653 18 263 190 1053 474 386 1231 159 243 1188 613 1101 448 823 903 846 1246 989 721 78 151 1031 1139 1257 797 812 133 494 1316 231 661 785 341 806 1126 697 752 1092 1135 518 1208 514 502 1080 515 1233 901 131 551 908 900 1376 1304 579 671 656 1044 432 1113 477 497 648 1298 82 638 1314 442 1295 1330 490 303 863 1180 301 278 1165 192 157 1136 158 162 1195 1361 393 1159 1369 128 555 238 979 387 906 496 652 1083 1067 342 180 984 368 434 211 450 774 861 143 462 693 235 777 1103 422 175 1228 687 596 834 990 140 1332 149 1203 2 530 681 686 41 358 1274 307 361 525 1026 1297 247 1186 427 995 99 711 478 1258 932 1349 398 1157 762 455 683 969 319 416 763 335 100 818 174 1251 1168 332 433 937 75 441 366 372 1072 870 585 258 375 1324 106 1164 1021 469 431 114 781 495 392 660 829 1300 324 768 87 43 917 186 509 618 1366 34 308 655 848 882 95 1377 264 126 1202 207 91 417 889 1130 150 280 481 942 999 927 1152 1071 252 391 793 1232 69 592 873 725 1273 646 1213 1042 467 563 682 1061 1019 1284 641 1128 521 233 284 275 890 463 958 876 216 512 664 246 1268 362 770 339 1027 188 1006 528 957 1336 285 52 71 1093 472 96 486 136 113 623 1204 918 1129 1077 25 993 672 1248 63 792 1252 1068 750 695 411 945 1033 383 148 765 384 572 317 125 1037 922 707 120 767 121 578 331 1329 1070 705 1328 118 1174 465 880 1191 229 962 960 179 26 1308 879 1240 223 1075 197 511 493 821 116 250 734 1290 1086 946 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 116
]
wts 2: 225 1167 996 752 64 922 913 675 601 1179 230 1162 1295 31 643 1199 1263 836 425 101 399 1108 61 215 1035 986 471 100 892 524 623 186 25 335 988 493 699 36 411 933 721 740 1253 1341 1071 456 718 820 1021 862 720 1029 775 531 156 478 276 299 1183 1172 1309 992 1266 536 627 879 208 317 260 1292 874 902 1255 185 1291 970 1015 1332 811 219 14 1094 723 898 503 443 286 665 346 85 1060 1193 1238 766 1098 448 183 234 835 187 342 150 374 1120 176 635 316 733 656 949 857 917 915 428 1274 1025 114 1140 118 277 87 1053 532 1376 1379 1236 343 265 981 1361 579 488 927 925 941 1357 697 190 207 58 729 464 739 75 90 410 42 1221 349 1340 523 632 1064 904 152 1050 284 5 1109 1135 1348 1186 838 538 828 563 1012 856 920 944 214 911 1254 799 1190 1204 29 943 789 726 1211 104 1073 823 394 681 320 253 6 528 1239 354 717 18 1074 1257 497 1273 1010 1369 51 1345 1242 148 211 154 1264 1026 243 1037 694 1250 833 631 1011 252 1224 942 869 760 613 560 72 572 880 574 774 1161 121 703 1365 1326 1182 1305 651 1240 1142 705 571 1020 469 1164 107 806 590 363 1072 92 10 26 1218 1081 513 500 577 420 30 445 487 159 502 1333 595 1100 262 1192 1091 886 460 589 1101 44 816 495 236 1346 827 542 227 168 899 935 169 792 1176 1262 812 750 669 177 1013 359 220 549 773 761 293 1132 1004 1154 206 673 102 228 1180 952 1260 630 194 1373 423 798 375 738 441 976 698 1067 608 969 1314 1145 778 37 162 1099 512 1261 421 768 963 1358 611 1181 819 616 1364 765 461 271 564 191 74 967 1070 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 117
]
wts 2: 1018 176 555 198 1309 890 462 455 111 991 1316 132 511 715 559 147 82 386 40 1269 745 168 319 1347 1353 1077 211 223 1194 709 850 62 257 1229 303 769 1108 453 1122 959 826 1362 1045 1147 871 119 744 463 592 1096 473 694 1308 807 134 361 651 495 557 968 1283 962 657 357 909 433 1234 398 917 219 750 1179 1105 896 810 1069 137 251 944 496 963 606 1340 1144 569 1342 702 120 47 1360 526 1178 667 681 565 1019 87 815 492 1367 904 728 412 523 293 656 434 880 156 377 1052 1116 157 612 1078 1126 289 300 1183 888 1338 561 336 388 59 66 876 1021 563 179 1040 1134 868 587 36 457 167 1009 980 363 449 739 940 443 977 337 789 1076 1007 866 183 456 385 72 636 57 764 590 332 1341 117 698 335 427 148 945 366 1263 1167 617 892 1354 83 601 243 527 333 1154 981 45 998 1317 747 1023 517 1287 288 503 367 943 245 1346 395 94 415 884 960 1139 840 105 586 654 530 1090 1145 781 889 1172 489 486 841 1003 792 501 369 996 1138 484 599 754 1193 15 185 798 16 930 295 1104 268 231 1121 413 131 445 578 821 727 730 765 209 1152 870 1032 261 299 128 244 1349 64 988 263 81 404 482 740 1068 1285 825 37 436 1363 760 575 1043 1186 1323 830 1196 867 1235 184 272 885 787 528 227 714 707 1369 446 95 291 266 355 1034 411 488 509 260 341 519 7 1299 545 468 847 1210 1135 477 1318 270 1156 1195 683 554 1005 1275 521 345 802 625 31 52 224 1310 824 1232 471 618 661 1300 995 196 274 124 1035 325 546 729 843 831 1160 1171 966 678 624 541 1119 839 576 317 1225 1053 403 175 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 118
]
wts 2: 756 168 457 573 1112 249 207 1007 223 18 171 817 557 280 632 191 313 861 350 732 490 1109 1208 237 964 106 755 781 32 684 348 10 625 850 1069 678 110 1118 227 523 174 1012 1359 518 504 1283 649 453 1368 445 146 284 965 498 729 726 1088 1170 1277 571 194 782 301 932 75 633 91 229 381 795 711 1105 1081 1124 484 839 125 330 262 1341 1324 655 221 1336 944 549 793 147 614 150 683 510 414 585 780 283 1229 1262 206 232 844 455 1234 892 1076 311 435 260 74 957 1302 1067 1181 436 1288 1272 36 92 1255 1298 306 121 17 1019 709 1100 581 65 1315 672 212 1267 843 822 1279 64 1025 719 157 1312 88 715 796 960 38 491 1251 874 1086 916 1009 1242 456 1160 1281 104 914 767 971 30 203 257 24 1371 1296 1042 1187 358 1347 95 1231 688 760 480 1314 216 293 261 734 737 524 320 1087 1024 1084 446 251 1058 137 165 977 567 352 1146 1241 589 849 1156 322 1137 391 969 548 238 531 570 553 883 1268 967 620 66 630 1144 1361 1343 924 840 69 276 954 494 1095 586 838 660 910 739 1114 771 593 935 775 1159 578 214 449 247 277 48 154 1050 551 653 930 1188 546 379 607 1070 1104 1196 99 1066 929 675 1233 636 1193 479 1301 1000 1318 645 503 791 953 728 1162 1175 118 792 26 332 1046 134 1300 1289 1014 687 408 49 650 1351 1216 360 527 841 14 489 778 1107 984 369 178 234 1245 1171 1238 768 986 487 1319 1199 1049 213 340 252 312 829 259 303 359 606 1078 1122 600 493 987 1306 377 63 1038 1348 1204 1096 948 70 374 305 677 898 671 858 901 29 1222 995 752 703 550 309 62 1346 766 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 119
]
wts 2: 1153 1108 412 243 633 507 579 1247 465 1111 978 12 622 704 581 609 468 844 78 42 43 296 1102 240 816 1205 1149 105 725 403 65 402 331 286 11 1199 1107 1152 171 1226 669 66 815 739 1353 910 84 244 950 1343 87 277 587 170 557 1331 469 535 767 129 118 629 1349 698 191 76 577 1170 834 612 745 249 858 1187 1110 33 168 313 1328 213 690 882 687 1350 119 712 791 214 551 572 266 398 896 966 777 523 97 1084 662 1354 190 638 15 829 231 554 130 1113 443 383 689 141 158 666 429 30 1239 1221 193 511 252 574 1252 28 1010 222 801 873 913 1067 729 695 796 1316 1240 756 1141 152 325 67 471 1241 96 906 1094 372 134 338 804 364 93 94 643 160 944 353 301 482 907 920 456 148 126 102 605 526 458 584 1371 1073 1318 276 969 645 718 559 180 1214 401 410 846 1248 229 892 435 167 1293 563 1215 1058 237 104 1212 708 880 365 639 785 1103 550 1273 38 379 1074 1230 114 1137 173 1062 1366 1188 711 278 1031 1106 775 1356 449 363 1184 149 391 518 556 34 144 825 1368 1169 1089 1191 162 603 548 782 630 1292 407 187 1278 298 515 1234 135 448 418 150 953 520 738 766 336 302 303 396 352 56 145 25 262 1063 200 416 309 472 24 819 238 624 560 655 758 235 198 189 946 1017 644 445 923 1183 883 797 164 571 283 659 1340 297 866 6 350 540 414 480 234 962 1127 980 1339 681 45 361 996 802 1165 992 1362 123 519 1136 132 1236 576 375 1012 357 420 879 747 388 4 142 742 504 887 536 872 205 1246 70 304 1075 431 1043 861 1200 394 512 877 293 927 147 451 499 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 120
]
wts 2: 107 678 1116 312 1131 637 845 832 571 1124 822 200 412 226 308 774 842 89 1279 811 612 1278 349 959 1244 1260 904 751 1346 1145 532 1280 1325 1212 1288 390 953 363 1155 1295 470 1172 714 1217 1258 646 1345 305 1160 1 1114 680 435 115 57 856 26 165 924 889 9 440 899 419 477 847 473 247 1302 937 1372 515 1029 995 1355 905 112 489 1266 796 688 954 874 1171 429 1138 1039 1317 970 1130 1127 524 658 649 183 760 281 968 936 357 553 766 246 472 482 1079 1239 1198 153 672 837 1054 388 270 230 747 1170 876 218 1365 51 1204 46 800 404 1282 992 919 651 314 1031 493 98 584 1297 282 885 55 495 319 1117 76 210 1336 172 392 602 552 1040 215 61 661 906 1085 461 168 104 347 1065 863 670 1182 43 280 91 933 333 557 789 920 510 743 336 925 330 542 1149 1144 244 1168 547 1246 719 426 1189 1008 892 1107 374 433 997 1087 180 451 999 1222 288 464 182 514 1359 67 1175 417 131 238 1271 660 1199 1187 341 1113 491 190 744 384 686 859 350 95 530 449 1028 772 1094 624 10 1364 666 773 523 358 1180 389 1191 991 780 1063 20 325 223 72 23 1351 713 415 124 31 529 1041 792 146 629 1201 872 1232 943 462 334 595 1011 209 302 891 601 310 679 15 1125 1338 407 659 1015 916 110 1098 596 1262 879 436 1318 372 151 1088 643 1380 331 144 418 1016 934 829 402 1354 518 703 18 1156 1228 1081 1026 704 323 667 317 295 565 1236 697 1311 487 600 459 615 676 620 140 1274 1154 1186 1132 638 395 1045 292 720 981 445 960 983 681 492 339 1147 463 37 1115 993 1350 484 814 193 898 1192 718 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 121
]
wts 2: 156 27 378 952 101 92 495 1018 214 256 827 637 735 1090 1182 216 240 953 606 150 140 367 935 299 1188 533 924 944 338 290 918 449 1024 1004 934 191 691 228 574 1323 397 1069 152 208 111 905 1130 185 57 861 897 288 612 1265 492 746 389 291 737 1347 1229 821 336 539 437 1315 1099 226 1301 800 3 1058 875 190 1172 164 260 450 1358 982 393 874 221 674 306 859 764 1306 473 857 313 1113 19 745 812 297 1087 694 1098 1043 810 839 91 498 509 883 289 1040 508 1051 99 269 133 759 1232 1341 590 434 178 1175 728 414 807 1193 771 1261 282 902 958 58 1044 1050 48 1219 1166 1094 426 443 1102 6 1135 877 199 1161 21 1014 603 968 1185 73 183 614 599 370 1209 125 1147 1165 352 264 1327 1049 1338 485 650 212 755 123 420 1305 177 630 723 651 911 542 259 223 1025 142 364 784 646 518 1348 622 922 423 928 896 719 315 684 1267 1196 1349 1216 1173 1367 663 245 1101 1037 354 8 652 40 846 376 1109 497 37 638 1077 165 271 544 453 1177 499 1053 915 322 844 926 11 709 836 1345 565 733 739 1000 1366 173 720 587 182 1207 1186 1160 474 860 1005 1093 253 34 717 1110 626 1304 167 744 469 368 277 805 1215 204 356 249 1351 365 813 957 385 621 569 1179 180 677 842 347 873 331 770 972 1211 584 1259 676 117 808 105 791 1137 718 87 1067 941 392 819 41 54 992 564 854 373 444 776 503 618 513 193 701 85 687 74 831 270 254 1199 525 1317 490 369 809 591 345 1167 145 580 866 1249 203 64 1271 1203 1017 341 532 912 882 522 789 144 328 371 562 556 1062 1003 1120 1202 188 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 122
]
wts 2: 471 441 406 1297 5 79 74 1253 664 901 372 300 183 1057 1168 642 21 1041 704 373 686 436 137 338 1039 267 791 1375 628 870 699 716 1175 769 236 843 509 909 788 1140 1298 169 65 1148 264 1007 1333 999 217 778 847 1192 321 1308 649 1124 553 1035 868 555 1350 974 719 350 627 1220 1280 989 145 1155 358 1312 873 8 33 921 583 777 1132 600 397 1011 370 670 729 1130 1279 584 310 1073 1177 606 1266 980 252 292 515 1054 962 53 687 1025 73 918 1119 331 943 898 988 1250 1217 126 906 506 973 280 1093 98 1262 713 298 148 451 1305 832 723 1023 518 204 859 576 85 19 917 882 1240 967 507 992 958 1059 233 800 559 168 325 433 1317 303 381 1114 531 203 820 225 1101 404 1377 633 237 141 402 1213 669 850 1189 31 72 1327 319 568 949 537 841 772 119 960 134 590 1214 786 334 87 742 251 734 666 1106 84 844 635 1008 1191 456 872 693 1293 720 176 674 1171 283 13 869 301 1027 170 1153 369 259 348 414 177 146 230 216 1378 375 125 1141 831 956 378 1237 595 1162 123 722 746 287 493 1169 485 422 100 1184 221 621 575 599 268 1246 944 356 705 45 266 157 959 11 138 1331 641 1138 543 813 528 683 403 654 1339 629 678 431 1321 297 307 947 840 1281 1083 1164 1235 594 941 767 589 964 567 1139 1014 108 28 323 680 344 1229 900 1376 184 905 582 464 400 90 32 830 1256 578 122 1110 667 188 876 327 826 159 1337 104 1241 902 304 1324 514 1329 313 132 392 23 1069 440 979 411 854 75 388 457 1006 1367 808 550 232 284 815 659 889 179 1197 142 1036 1040 601 925 892 1049 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 123
]
wts 2: 357 104 763 1275 1014 1000 534 258 673 563 1158 1321 198 1164 153 1086 1371 959 1092 904 178 676 1001 891 747 559 1080 690 1110 1096 1137 1116 1334 417 23 806 235 829 1232 803 479 149 241 87 722 627 154 285 897 368 140 1059 1088 1335 442 500 1240 121 662 776 1213 719 737 385 738 1348 536 921 344 871 525 65 1304 56 461 876 947 466 1083 364 158 107 989 1170 269 1328 698 302 376 617 307 1223 682 319 850 531 265 713 1130 984 1033 926 401 995 653 1023 1365 67 129 287 437 1373 1356 481 962 1103 1302 824 1136 820 979 47 720 38 872 75 92 587 1301 170 612 248 79 471 100 641 1074 2 327 842 313 1020 255 315 1174 533 168 391 187 1295 304 730 1168 1360 454 470 1346 128 1353 1171 1203 991 647 270 1185 1212 1153 1345 1041 201 592 1058 770 1343 360 711 35 485 702 1066 165 1379 843 1258 1173 1338 1198 1246 142 632 148 19 1 986 734 1031 1187 1106 1140 405 1095 264 452 1234 1193 1199 568 163 231 105 1036 1331 11 515 1214 446 230 762 835 961 1151 369 351 418 367 861 276 966 664 395 328 480 86 1085 1245 475 597 969 343 1188 909 1145 502 924 1307 833 1114 1372 1027 1178 363 1298 1370 483 402 513 1200 1253 879 259 1261 739 146 30 1291 839 1165 1368 469 933 604 179 745 1024 403 575 321 1296 865 844 110 846 76 51 292 517 493 599 457 990 1254 749 854 591 1068 938 884 216 619 784 1029 43 286 271 1127 54 953 1237 83 354 1190 1124 1319 273 312 1176 970 489 920 62 1255 1070 937 36 1215 1211 487 964 463 125 922 229 1167 1157 1351 1281 40 1122 1327 622 407 729 957 951 424 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 124
]
wts 2: 182 820 134 49 337 29 1184 1016 1127 21 395 1084 938 675 1240 1333 1092 1032 629 996 518 634 1031 624 1332 654 443 1114 310 140 1123 1303 951 565 1201 1069 348 843 1241 711 420 1190 129 376 1266 903 231 1314 490 697 404 744 719 1165 747 904 861 1148 1334 514 672 471 185 601 596 677 692 584 818 1265 795 1200 638 224 100 62 487 113 1229 392 168 574 955 1203 165 603 1075 706 176 1341 183 558 431 38 1375 1015 302 425 491 206 341 668 444 1324 825 1283 330 370 992 1327 778 739 467 886 1051 362 526 1227 1155 505 101 1071 622 786 335 973 1125 607 201 642 798 46 339 830 413 316 1120 857 550 234 170 774 298 1337 950 840 1062 592 1145 983 20 616 1300 831 209 1301 520 262 687 312 235 874 1181 332 83 552 191 363 118 1222 230 55 946 1134 105 281 807 271 1256 408 154 447 253 72 804 794 901 188 458 516 42 701 1319 1177 721 742 1146 949 674 73 131 1238 1100 403 591 694 1236 799 1126 368 770 876 58 647 435 805 1268 88 287 51 772 384 593 976 223 1019 1294 523 960 998 735 1151 529 1378 777 437 678 576 1368 385 1296 700 961 1067 149 68 937 573 650 756 333 480 1249 715 1237 977 12 137 217 528 213 959 1131 78 361 338 252 1107 606 119 297 430 1313 1220 1269 353 985 662 211 66 355 913 865 1053 890 942 762 197 1277 1111 916 219 389 724 195 806 693 432 511 760 572 1215 1253 465 765 929 1221 482 175 1027 583 1257 1007 81 103 1064 65 653 971 375 304 336 935 1355 1276 571 863 80 275 1208 952 846 414 350 489 429 507 1188 878 143 238 644 222 815 826 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 125
]
wts 2: 107 76 523 1250 1229 264 26 211 950 689 347 1212 1214 957 588 704 274 1290 381 849 1371 903 130 29 233 1173 718 1188 221 533 442 1340 1119 958 844 914 1231 1113 1306 863 475 1149 781 828 1379 1154 1239 923 776 128 1192 1377 852 1334 1234 583 720 324 1116 1219 702 464 1312 980 104 627 290 93 792 1042 98 699 739 184 877 654 124 638 134 1248 679 512 139 405 1370 466 596 342 1108 270 1300 1369 697 722 248 1376 1203 567 281 635 1025 9 1291 1200 1225 531 845 82 176 1289 1070 1101 982 526 101 240 701 710 1307 1115 492 117 967 1303 110 511 457 1257 1105 827 422 516 1208 56 1264 353 515 978 669 782 1253 1057 13 443 388 473 642 1155 1329 37 490 287 384 751 1140 589 155 1120 695 1 1143 40 35 1026 690 871 164 122 1151 984 278 884 357 1011 212 60 600 1311 760 429 460 1014 645 284 1079 87 910 1310 715 1077 1165 619 927 22 1276 926 1215 497 713 869 609 564 109 633 193 756 1282 1045 575 747 292 417 1292 1002 314 946 296 959 928 1246 766 360 1088 817 648 355 61 941 818 773 807 864 236 415 94 1226 1315 708 570 1263 1117 217 408 427 1302 551 1087 265 58 898 838 1080 1058 158 439 1249 1073 989 677 1364 410 890 356 1147 210 224 974 316 67 293 75 43 223 571 119 461 411 186 769 317 831 991 64 1169 345 951 520 498 728 4 821 1130 936 986 136 229 833 1367 975 778 1138 228 147 394 1028 1160 789 1213 554 1069 943 777 658 644 641 891 636 1355 885 858 45 242 369 219 1243 783 987 352 105 765 268 1190 810 31 206 1001 263 787 1076 981 1211 74 380 162 673 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 126
]
wts 2: 1185 794 882 479 817 525 1257 1371 133 1165 851 962 152 812 551 331 618 183 1139 161 291 27 145 1319 193 487 1078 415 713 326 1274 114 1204 628 80 1327 787 1135 267 282 1374 1062 1108 1276 990 219 796 426 636 1071 83 1305 218 904 82 632 909 257 1143 622 1250 1339 839 285 695 676 43 896 1356 424 1170 527 485 1133 1025 1075 729 7 1127 1145 709 1237 237 1079 1148 59 123 1046 158 225 850 1083 853 822 542 105 957 28 324 325 380 1341 979 827 826 998 910 883 1073 878 381 110 86 318 874 295 1021 1244 720 715 347 33 842 683 1098 1097 53 784 422 843 1089 547 854 1277 1182 51 364 1172 1163 1176 459 888 545 789 1191 923 627 1284 1134 940 62 1267 600 743 274 494 1109 855 1377 436 1193 1153 1288 1036 893 1275 230 1181 633 1353 1379 1311 356 948 496 567 1352 1074 232 689 959 647 435 446 29 350 840 891 191 377 950 70 247 907 873 667 128 1326 1378 1303 1169 816 1023 12 184 677 1231 675 473 19 338 1343 818 1044 348 1359 832 963 417 858 465 211 707 1009 1207 143 1273 187 972 1262 1219 243 655 1349 441 117 1234 1041 807 1364 30 45 730 759 402 1242 712 1003 565 509 353 895 823 681 970 1208 866 566 221 578 694 261 852 13 5 725 1285 1280 1342 846 615 658 1067 584 360 614 392 652 1037 810 185 1333 234 1206 1314 1282 1229 46 519 293 303 228 1214 273 660 597 312 1030 397 298 321 776 1102 666 64 169 516 315 1124 262 351 1100 283 442 1103 1024 118 757 944 440 911 1179 500 132 1048 147 455 464 1376 946 758 428 1177 1027 885 505 741 66 489 431 934 835 594 245 2 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 127
]
wts 2: 417 219 1036 742 151 85 489 880 724 908 549 681 610 690 952 498 222 146 1111 590 949 1156 1256 588 47 159 108 130 461 1170 1103 1131 156 189 15 180 1360 131 643 328 524 922 652 858 1238 1281 439 1207 431 950 1330 1337 531 371 115 202 936 4 1029 1142 1089 401 141 263 1115 39 1297 412 808 602 344 997 1334 656 964 996 1106 79 1234 476 500 469 728 416 269 1112 1309 776 673 1176 1045 676 930 60 306 274 1161 51 743 827 1044 627 973 480 574 49 140 861 434 567 546 1035 132 1333 1031 557 664 560 563 948 351 740 496 941 409 1017 62 285 775 1308 885 842 475 277 856 454 509 758 1087 767 1246 807 103 259 716 1168 154 134 35 1146 1200 37 1118 777 519 551 353 1278 658 1313 648 375 105 1002 830 1015 30 1183 424 124 593 1078 513 1055 532 985 209 356 1353 1338 1366 1026 165 852 54 694 570 18 946 927 462 1239 345 95 923 348 754 988 81 857 404 386 582 937 364 725 849 443 1052 321 944 329 1003 1316 1331 1364 1090 837 1285 508 200 886 891 1240 362 1252 745 70 147 86 703 770 1243 701 479 851 838 1095 1047 1062 406 894 818 96 619 298 793 205 795 797 93 887 426 645 680 1296 1059 794 483 97 422 892 292 68 357 788 34 1098 555 1321 735 415 874 737 1169 280 149 283 951 187 5 1040 458 433 223 398 330 397 493 547 1354 75 275 1284 1282 231 802 17 1307 173 706 1276 102 304 655 816 392 1350 150 253 1172 236 904 107 1058 657 352 575 573 749 372 960 866 1113 597 1206 607 1037 525 1341 1225 687 1228 377 594 585 92 432 1373 518 114 1274 273 1344 360 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 128
]
wts 2: 161 125 1008 387 1258 131 1159 417 363 499 790 509 430 85 1190 331 105 901 20 1344 1280 474 879 1320 899 1308 663 1098 1135 693 981 1326 520 239 94 182 380 377 1025 1323 177 887 784 483 633 393 421 635 96 1206 516 371 872 967 530 1378 224 941 282 933 780 404 1102 1042 935 1120 581 271 995 801 1350 1195 803 151 1106 1037 51 928 838 17 1364 531 268 1128 942 539 294 990 656 731 199 158 691 80 777 52 286 643 493 1302 1109 1023 591 250 444 763 829 398 1368 664 89 677 1263 8 374 946 891 351 361 1048 1065 243 757 276 842 251 113 302 1242 1182 568 432 590 152 911 124 220 884 999 1044 379 352 104 382 1168 1096 615 63 965 1064 707 1179 977 924 1367 95 1211 1309 812 1372 396 181 822 561 755 983 739 772 235 1299 435 918 291 565 992 345 203 906 227 1224 858 969 1330 1301 1165 416 631 495 800 883 163 170 1345 19 948 765 704 862 684 1287 821 11 1013 71 881 270 709 1270 109 914 500 120 1188 735 547 722 566 861 549 48 1174 216 1376 339 785 645 1178 1316 583 917 1121 1361 1039 422 830 698 78 1081 761 75 264 400 1318 734 1133 49 552 1049 140 116 1125 1238 457 819 217 502 1324 21 1029 764 200 1082 1 1304 805 827 141 491 160 1276 290 225 947 463 580 903 118 449 92 700 683 867 274 668 275 644 60 1113 307 321 1331 1115 335 22 874 1026 1071 802 606 913 1298 464 608 594 313 1307 864 1290 368 505 1073 1050 817 86 1016 671 58 667 673 696 43 391 1108 820 836 433 1171 59 61 81 987 989 1288 1093 600 1271 550 712 713 1319 875 1285 840 287 166 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 129
]
wts 2: 405 756 974 894 1009 662 454 422 24 1190 611 75 889 66 1082 938 411 1340 460 714 1265 730 111 136 288 42 1361 893 628 933 282 1055 364 1109 937 968 523 1142 255 1211 832 683 1011 888 902 262 711 655 373 631 472 1349 1174 654 688 54 707 199 808 517 500 1000 497 1369 879 734 1224 1170 1051 1057 678 1252 863 640 466 969 697 154 153 431 211 6 898 747 713 1191 1013 577 574 793 945 992 621 31 287 814 1323 1202 1365 1007 1020 738 878 348 929 193 378 470 874 442 38 509 819 1088 1251 867 13 277 1297 58 658 567 176 1228 41 1089 847 119 1063 1075 1247 281 1345 390 374 391 1062 1080 508 34 127 294 200 1230 1097 1069 994 408 62 1014 1168 620 682 1161 426 978 161 741 79 608 74 573 482 569 244 638 1260 1194 887 1259 1370 626 499 1198 1367 1216 954 696 137 118 478 272 645 1333 376 791 1130 448 715 657 198 296 610 1217 316 1275 548 739 156 917 388 649 184 197 861 1231 395 921 134 1010 1135 1262 35 727 1076 187 1201 502 530 418 519 1344 221 493 368 690 55 881 812 464 826 403 840 50 1092 701 501 363 1116 383 1052 250 457 585 761 353 1218 1019 319 1290 239 871 850 922 1110 1326 131 225 306 895 1096 1334 437 809 663 996 1327 441 975 575 781 1023 168 1104 853 911 125 667 380 823 1314 864 959 788 63 789 749 556 57 1362 627 280 149 856 988 150 956 619 571 1196 782 218 1160 737 1300 1187 1284 212 566 541 370 371 327 174 439 177 905 410 159 1153 854 401 677 1301 8 1046 1103 496 453 1320 679 757 419 299 1029 387 1154 721 1058 670 240 1214 704 382 643 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 130
]
wts 2: 205 1242 1281 12 595 854 311 199 940 391 43 1190 1224 1095 1225 1075 1209 819 860 849 298 259 927 171 1052 1035 842 1093 1245 1143 265 10 165 278 770 589 1336 261 156 1310 1291 145 1029 63 1298 106 985 603 242 696 1126 214 853 588 630 755 1206 727 1131 1237 846 886 40 1217 1122 90 895 132 1081 475 1364 908 732 266 1097 824 922 495 936 161 31 775 728 286 287 398 1009 452 949 455 305 44 374 566 348 679 781 245 471 1153 885 148 1346 141 38 825 757 558 351 863 663 791 410 1216 226 934 279 1114 292 644 649 163 723 167 1215 62 868 1220 850 200 974 684 997 1343 688 546 36 382 5 136 796 725 355 653 155 917 1247 234 812 357 1278 169 454 627 1222 201 1164 845 237 467 231 1368 48 405 1112 1152 6 708 540 1312 1284 815 786 844 493 1192 1373 1201 1299 334 267 721 110 367 432 413 82 556 473 610 669 814 1334 1069 1068 1256 78 874 1342 553 628 74 270 184 425 239 920 830 1241 1329 139 948 301 1003 622 1001 873 1285 992 859 1273 918 1179 458 323 1259 575 651 894 206 681 370 939 212 1155 941 41 587 13 795 871 162 879 975 776 958 1015 1188 1053 302 1352 443 376 107 359 660 378 539 1092 1008 634 47 898 817 968 957 276 698 965 1359 1120 762 268 561 1049 670 135 533 1050 70 717 336 1133 385 213 437 172 680 117 427 576 613 502 810 1300 527 602 658 142 563 1054 777 798 1283 176 1110 418 1065 1325 538 1047 673 282 433 1318 1350 840 1116 272 972 174 147 979 7 362 1005 813 977 672 369 444 129 81 1037 1293 956 709 500 491 804 996 736 96 995 1056 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 131
]
wts 2: 515 943 1050 553 44 227 503 240 1278 613 50 307 510 910 885 1080 1292 167 193 1239 1298 534 894 1228 1375 308 1090 705 405 322 1327 1094 141 533 608 855 35 684 317 1323 941 1296 215 692 1153 771 38 265 636 1016 779 1030 1219 113 606 1109 1258 79 1364 1108 1167 159 93 4 456 838 109 479 440 1129 594 23 1086 727 806 630 985 1321 919 672 1132 967 1161 1372 896 42 531 421 563 383 106 60 1223 1089 701 245 280 220 436 7 893 339 1307 19 790 912 747 1015 397 313 1311 341 166 81 732 998 940 865 521 419 863 661 544 996 776 1105 1061 886 702 315 1151 333 49 697 458 474 916 539 1366 1238 554 733 496 914 1045 1083 376 224 778 95 411 650 739 1206 623 669 1277 1380 1319 1204 882 909 889 635 1025 709 375 1249 1193 349 1028 845 853 354 627 391 1186 36 928 422 1208 668 3 818 466 520 899 1001 1318 1252 1172 253 1118 513 745 632 432 54 867 532 570 272 573 394 651 999 720 120 91 1115 514 477 94 311 798 1213 1350 846 552 347 1141 580 719 111 1328 559 542 1189 386 1211 285 835 839 1199 1305 324 338 1149 1175 244 1353 444 1344 1106 848 754 1111 1072 854 786 545 209 887 10 881 228 687 1194 1145 1177 75 758 938 110 423 961 173 269 678 22 343 48 782 1260 575 216 717 71 372 337 1034 232 76 501 891 1120 114 775 170 90 746 1006 473 334 1176 243 92 1286 171 107 431 1303 294 796 83 45 374 852 495 197 1373 55 742 1333 567 161 437 236 529 897 1338 1217 993 551 66 628 844 1103 731 454 1355 526 1313 647 662 934 461 1093 1283 448 944 744 1131 540 203 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 132
]
wts 2: 479 865 715 518 172 594 480 789 192 361 1049 550 484 1240 590 1284 431 112 328 1011 511 840 673 75 465 273 307 531 670 129 1303 98 10 1264 717 311 671 1018 133 1080 205 839 1185 763 667 58 1042 451 864 857 1243 468 1289 1019 1358 14 467 909 66 499 5 1059 258 1069 1158 945 1131 903 632 339 1076 936 579 85 1346 418 634 472 1209 69 24 677 559 25 1283 161 1078 1025 36 385 114 984 301 625 915 686 81 1293 755 991 1150 928 1039 1239 309 262 1113 485 440 1294 713 466 607 126 272 274 363 407 919 319 1041 178 657 1216 256 1183 448 1109 397 621 980 1252 871 681 1032 1089 211 1162 537 443 658 968 97 379 561 366 728 1320 596 65 1120 1050 26 986 1106 707 1020 41 1330 712 969 932 150 268 9 635 267 878 50 1156 843 423 1190 525 544 600 570 185 325 745 684 1351 855 413 806 1057 253 1123 987 489 1193 194 7 1126 882 577 747 646 212 312 1374 384 283 1206 351 1198 1245 916 617 803 1272 224 1070 921 1335 475 348 534 961 795 134 1345 337 1168 868 3 13 371 88 924 179 767 496 55 946 80 994 238 760 963 421 338 1347 447 653 672 527 202 503 1149 816 367 858 427 636 1348 1064 873 812 898 180 1161 244 436 633 679 1318 1371 1337 18 490 535 1173 605 326 1108 956 117 438 350 1100 1072 1087 143 188 252 1166 1112 1288 1004 798 345 376 773 259 619 780 78 247 598 398 137 1111 1331 1099 419 250 420 1254 1055 1165 1332 564 94 56 230 1062 246 777 576 1236 897 517 28 935 1013 1225 1363 201 626 705 1268 751 966 233 226 1028 1365 1255 601 437 786 340 940 332 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 133
]
wts 2: 1025 306 740 496 461 466 821 468 234 1141 859 1116 1209 354 1062 267 1333 265 885 492 1329 161 639 854 1051 849 77 770 673 1335 800 408 154 421 303 1199 1222 1289 1364 350 1258 1016 620 431 1102 654 437 409 999 643 1095 336 1295 741 837 678 132 584 328 757 541 567 1156 434 866 831 506 961 1075 272 1361 1157 1109 1 907 664 1253 1055 402 797 398 419 317 1342 1202 7 292 174 262 846 89 1280 850 982 497 172 387 661 1259 534 104 125 203 1328 253 231 900 339 873 938 522 751 236 1340 182 762 324 50 1310 163 315 1316 1358 222 54 532 1367 796 1327 489 51 1139 512 602 847 1167 574 360 29 735 944 1322 1030 1285 1066 955 1250 177 1189 784 924 266 302 483 504 475 429 37 491 1303 1047 1098 216 499 791 940 621 535 135 215 494 549 148 338 1201 1219 1013 744 1086 166 1121 1313 1179 619 1018 1225 656 416 1351 736 595 1256 379 1172 1094 589 583 941 1203 1021 291 833 1080 109 714 997 157 1048 1194 1314 469 768 794 283 1112 848 552 75 645 224 227 701 101 319 36 1045 641 114 202 1355 587 1276 1110 838 1268 640 554 217 733 1318 670 737 1042 883 953 399 1032 9 1271 1257 1014 16 565 1284 159 716 754 73 916 1067 647 807 669 918 811 1265 1248 68 169 1267 580 1249 1115 1352 61 746 107 813 362 899 149 1281 146 1218 353 1305 612 141 786 1306 1229 1031 1343 162 890 725 1150 233 123 1035 1247 609 85 968 112 1100 679 470 723 1300 1348 487 129 447 316 970 56 106 382 1270 1118 829 420 370 1231 1368 74 1087 1339 874 436 610 1207 633 450 694 485 514 702 715 1177 285 677 524 1057 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 134
]
wts 2: 579 527 876 288 804 423 1149 1333 818 977 557 1224 812 829 743 673 569 593 1180 70 597 460 1078 728 955 352 280 82 302 833 766 1102 921 1092 1106 548 1305 96 963 247 152 682 428 763 851 1046 18 1313 1188 141 618 1089 419 966 371 92 739 1196 1231 1122 1255 944 859 143 365 862 1118 401 807 940 797 701 835 320 715 634 87 672 201 902 960 381 1293 311 1209 536 1336 572 857 1187 5 803 1221 1064 864 272 1363 271 483 1059 329 622 614 133 154 2 1199 688 390 49 1281 583 1258 756 843 290 380 158 787 1044 657 517 842 1216 1191 900 1334 1319 722 571 144 1115 93 1220 1096 1028 490 224 754 1011 841 1008 481 159 895 163 800 1361 870 410 379 1285 1052 256 510 229 455 731 890 330 315 727 1259 937 1340 194 377 88 480 231 426 1125 462 274 603 296 339 576 585 665 1373 948 444 248 1299 473 1083 1107 1170 44 938 929 885 173 369 238 874 24 343 469 578 1142 926 304 516 641 142 1314 581 1100 933 187 863 530 1074 570 848 607 935 1344 815 1090 478 1035 117 971 357 954 1004 100 31 217 776 1350 52 632 183 616 1174 735 445 532 1328 1013 370 1226 627 338 1156 337 497 59 86 227 1061 15 1362 853 264 973 737 1157 553 340 1056 298 936 1284 753 750 318 1020 1292 1143 747 884 1303 680 1023 1335 156 837 414 219 104 64 1189 1198 193 113 1358 605 511 437 212 1084 918 512 203 493 233 1111 989 8 724 436 416 985 1346 7 1235 347 450 1026 69 1332 540 411 1260 1150 595 25 768 872 850 950 957 773 769 964 1038 1162 1128 713 813 1058 620 305 1054 708 223 755 62 1029 291 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 135
]
wts 2: 1326 900 1067 676 754 46 117 564 415 1255 1171 543 1314 752 364 782 28 326 503 1169 44 305 1219 837 22 486 661 1007 601 613 1234 307 1040 573 1059 1206 499 291 1228 155 623 64 924 1229 1035 915 626 460 999 207 183 1270 1353 520 219 271 151 333 950 442 202 1000 127 447 215 340 625 788 257 1247 26 1074 1364 1337 1090 1253 599 636 745 546 750 947 861 641 532 541 1193 1013 1218 813 879 1280 1016 206 85 359 376 7 1168 1363 1358 199 1237 954 1317 874 408 137 209 786 855 852 1061 313 443 594 864 452 1121 109 619 446 353 1101 678 1023 1200 906 1166 628 493 1241 828 747 87 201 593 179 1051 116 820 791 616 492 1340 1352 166 604 979 656 1345 469 309 1034 596 1042 1062 328 1263 274 1175 150 501 1232 1238 282 1309 1019 1259 375 312 1297 169 685 472 590 976 338 432 1194 1071 210 296 657 709 1239 1213 30 510 644 284 115 698 1093 410 420 451 518 1001 1178 1017 737 216 910 139 585 1139 235 122 369 902 1076 768 445 1135 398 951 638 883 1111 71 162 152 721 73 1244 310 706 448 1281 1250 961 1379 121 273 717 1304 466 1125 1235 1126 1049 113 853 124 229 700 154 1181 1114 1185 715 1130 1221 652 37 597 1308 1133 314 724 569 40 854 519 479 81 1099 764 366 1129 1098 269 343 671 637 989 1107 55 485 1146 102 1288 1305 997 1160 847 533 54 1047 591 414 643 575 1307 1120 57 777 908 812 1162 118 373 1154 395 740 24 1094 1269 489 184 800 647 1274 1033 666 242 1195 1084 463 529 389 803 667 200 1230 4 1331 1057 760 1298 553 572 877 272 336 925 112 940 767 217 263 880 1088 650 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 136
]
wts 2: 1282 859 653 530 549 240 1162 1317 717 5 759 1013 975 1063 1355 251 1026 339 186 704 294 290 42 758 379 874 839 479 834 744 801 34 190 322 258 497 767 619 153 926 140 734 142 1164 595 1379 1033 918 1157 1232 1243 973 1065 263 1245 286 411 248 192 377 524 676 297 99 814 761 1146 124 1293 1020 194 923 886 545 252 1100 749 471 803 1201 1309 1110 847 391 739 1236 895 365 436 1288 239 452 1084 1259 85 180 533 700 1078 1045 1181 987 974 641 737 20 1295 433 1 329 684 1166 103 53 620 1160 599 1046 852 710 93 581 50 29 528 1125 946 390 1357 201 1053 1133 171 1124 205 943 849 131 617 611 843 815 577 1075 915 67 773 776 1054 990 1182 10 306 44 1229 664 1023 638 236 1304 1313 1029 444 1127 1353 139 1120 1372 163 1093 459 658 1059 628 997 1072 304 172 398 1052 443 925 1216 1310 565 668 948 844 553 752 49 841 451 1161 810 1280 1149 1254 1003 554 1064 446 468 800 848 572 1261 406 1366 942 97 116 1073 519 277 912 1276 1109 1264 183 467 501 81 17 950 79 152 982 1140 635 1251 1198 532 605 1081 106 891 500 582 117 885 422 769 309 1119 493 753 706 784 1024 625 221 580 331 1220 1036 1009 1017 421 182 1223 1307 594 56 447 919 1197 645 102 394 534 708 1098 899 1294 395 876 1252 861 1344 762 1012 971 1265 879 1188 1060 945 1044 862 234 399 1330 2 1212 66 214 517 197 1263 1034 310 318 529 121 720 604 1022 113 111 682 230 639 179 220 924 383 107 1283 1070 851 888 661 296 389 1218 567 460 1108 981 224 774 216 531 95 385 181 890 880 713 914 323 347 1329 1367 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 137
]
wts 2: 424 407 261 441 994 856 774 1170 181 87 57 1053 685 322 89 210 120 647 545 1126 194 676 956 1083 413 477 1125 1019 320 600 106 845 697 1308 1377 1319 1193 395 252 21 779 1235 84 122 411 643 275 615 760 908 1050 1348 1306 434 669 1078 325 927 335 167 163 249 1151 688 13 551 260 215 268 1184 743 1288 757 1294 656 382 230 783 1357 207 1057 1369 983 1029 979 1301 1063 259 1185 416 352 1209 293 1010 833 965 689 1171 806 208 622 221 589 358 606 191 481 1136 245 755 1182 390 650 1347 1162 438 43 1025 473 846 1372 1220 626 900 1222 801 1176 776 515 1080 701 344 595 608 649 100 206 762 1367 1352 970 1360 911 62 1281 881 1300 1168 769 78 311 1305 518 74 682 49 717 336 1142 1342 894 875 246 18 1314 838 442 81 918 581 810 1048 418 592 402 519 341 484 160 105 115 745 716 128 1376 444 403 1279 859 303 1272 1343 1107 225 1283 380 1267 240 1263 458 857 452 976 836 235 694 312 68 932 943 1106 703 398 333 355 753 346 1149 37 793 530 522 1148 50 280 375 1378 666 214 218 1351 1317 1012 1068 944 1274 724 640 171 993 256 11 1359 938 33 1038 542 964 345 709 977 1122 582 189 714 222 1014 99 721 386 1187 56 525 985 384 576 599 1250 1353 299 712 284 1094 129 554 1015 967 921 1087 1086 216 162 636 933 1013 305 141 310 368 1123 830 16 808 513 792 186 158 946 770 901 617 1315 113 1324 36 788 718 61 1292 1350 40 690 440 196 1203 327 1181 152 1154 652 878 973 86 1098 283 880 258 1027 904 265 165 1011 170 1233 840 710 831 35 723 1273 1247 272 1138 1060 863 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 138
]
wts 2: 28 563 561 1173 314 754 633 1160 258 469 749 1327 1151 812 968 1281 679 92 887 1226 1340 62 463 400 331 942 903 902 435 4 488 353 770 148 494 50 1015 264 372 1024 65 958 34 617 1137 840 137 1046 813 1153 929 427 1352 1159 618 439 434 1121 1312 228 215 436 491 441 1274 1013 1214 1257 568 948 897 462 301 646 471 1146 52 490 152 1136 124 964 266 687 622 334 1229 596 386 513 909 348 456 757 1076 527 296 894 291 1249 629 326 1365 1336 732 224 1074 1306 640 1244 1380 54 1165 163 6 1071 117 1150 1256 244 551 496 70 294 1308 660 19 940 917 793 936 802 816 885 664 99 1199 395 623 1018 621 713 69 1225 950 1001 985 78 240 351 521 468 200 375 819 867 931 696 906 205 593 230 1169 847 131 41 655 321 66 193 407 164 1079 82 1344 483 642 350 48 643 787 1119 941 921 738 712 943 403 694 8 750 1371 1279 654 493 1094 774 689 161 506 1322 970 247 1052 695 327 1355 579 81 1183 919 785 920 1185 1248 922 982 808 949 98 1093 123 1197 315 836 955 537 1191 1189 281 504 587 218 113 1350 95 1251 1268 418 445 709 118 378 1043 97 481 85 1083 112 986 806 662 871 23 337 13 204 300 1369 938 730 1063 459 720 94 595 1343 1221 700 318 1358 408 518 831 1203 388 880 125 540 828 449 1367 87 862 858 718 1010 846 1374 1282 284 262 678 1095 1100 565 381 998 145 1007 1023 653 1118 900 182 639 1375 923 1283 212 1247 1056 758 46 1127 1205 934 699 1359 1217 580 611 918 957 1195 1163 896 739 553 1276 1065 1278 285 1078 1293 798 175 1170 1353 599 1000 1218 322 764 419 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 139
]
wts 2: 678 1097 1319 1213 889 907 1294 1008 1305 727 243 102 695 1226 522 875 71 516 883 691 601 497 330 1252 263 800 610 627 1121 311 1029 125 526 213 665 1145 438 1163 1139 1290 621 321 1229 225 581 370 1343 100 484 1273 595 237 1065 64 205 39 879 1322 938 122 1345 1199 900 550 421 937 784 409 1038 72 60 1060 1265 1259 286 61 1154 1208 357 1247 1126 984 723 946 84 1151 1206 672 99 141 388 920 264 368 717 201 699 1111 1263 124 1135 1344 891 1183 1162 296 1370 1045 317 1318 49 346 931 1242 1303 870 567 293 607 774 444 863 56 328 975 773 89 981 1047 1281 14 1014 1030 1320 1160 623 893 537 1040 499 1327 304 908 969 560 1340 1125 1152 239 616 1328 696 943 1346 1080 288 530 997 96 487 927 1118 324 569 688 841 238 380 120 422 714 999 540 1010 629 1108 403 603 963 738 184 1174 588 917 895 29 940 383 1237 682 506 1028 1043 1148 281 583 846 227 192 1321 314 1034 269 656 733 545 1058 752 761 1275 1238 531 1270 890 1090 1332 399 1155 267 541 892 992 216 1004 716 860 842 816 132 1299 1324 5 1137 1371 573 197 1185 1325 570 768 34 1187 127 391 948 561 1251 222 1053 1012 1037 725 1146 52 1278 115 1377 377 4 775 447 769 1000 1115 692 1024 315 985 979 1175 1279 594 529 47 113 868 1147 57 974 989 348 464 1309 772 207 295 255 553 1198 439 1186 188 874 1284 786 1218 1136 453 291 88 1195 279 170 363 475 718 923 1132 1166 1076 287 430 690 43 748 285 673 1157 856 169 781 455 1128 229 467 709 831 956 1314 547 776 1093 592 386 1005 1081 885 23 24 712 181 203 640 242 292 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 140
]
wts 2: 1046 838 722 1065 731 905 57 432 388 426 1222 1268 602 1376 793 1269 573 786 69 1124 1345 1129 283 1316 890 359 995 745 52 456 159 987 340 820 442 1042 920 718 14 636 1256 184 657 1336 83 120 771 356 523 451 208 1033 1198 1188 240 254 580 1072 128 389 526 1194 1019 88 245 1200 1333 294 180 978 416 1091 1022 926 1031 446 1155 663 455 757 1373 1158 140 729 621 567 46 258 139 367 562 480 1355 823 886 157 185 648 1363 1175 1167 1246 647 350 134 352 826 892 182 998 1215 536 169 1006 590 381 880 211 1294 150 640 1263 424 1338 488 751 723 1121 944 1156 688 1125 358 1213 32 133 597 651 328 700 569 91 1041 588 452 318 1347 817 1351 288 5 888 658 1308 785 194 1103 322 859 577 542 495 630 427 518 399 1353 66 95 1281 770 206 1131 610 277 964 1331 604 1092 691 1220 860 654 885 583 1018 942 864 441 1298 434 601 397 566 1186 750 762 398 510 1172 84 1302 697 1243 305 415 882 701 639 333 506 239 1245 782 808 394 47 64 574 163 564 759 181 571 553 6 633 815 429 1340 286 1069 255 822 122 396 1003 486 1126 744 311 126 1314 1055 186 339 1149 1352 27 330 366 242 82 141 1304 1183 319 607 766 928 316 927 67 767 1154 624 63 1250 541 383 303 421 17 791 55 1300 825 202 193 680 1132 908 1104 821 1182 702 310 1189 897 1107 410 474 36 107 313 628 957 753 549 114 1328 1242 59 1350 824 125 80 1199 331 857 376 994 307 725 546 111 1157 135 841 1161 692 160 60 862 1066 58 1322 752 1230 304 53 996 276 257 412 1252 100 560 1119 949 492 132 309 341 690 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 141
]
wts 2: 233 101 350 1287 368 861 1044 126 1276 258 501 701 1057 89 1009 1369 801 971 530 1214 487 475 374 1283 804 889 173 1303 1136 545 189 1331 1147 353 96 86 1004 327 969 473 445 370 546 1034 140 1118 934 920 583 1232 1289 159 192 529 1022 753 300 752 1146 1161 1248 214 673 236 912 746 1286 1050 544 1253 448 652 634 325 460 770 294 1099 1269 510 616 780 113 1199 562 377 278 1139 248 52 308 794 416 956 480 1378 122 996 1174 1319 1143 630 1154 476 632 363 124 600 478 1325 535 97 1159 1059 963 1085 894 298 1107 798 555 1160 474 779 745 650 513 135 847 818 1031 766 656 1242 203 781 1210 785 1275 321 1005 807 1341 110 240 799 204 816 68 805 872 186 1008 508 114 30 1293 1179 1350 439 601 983 494 628 447 400 1171 567 930 1173 1260 329 1380 968 1115 919 264 1229 330 417 668 576 1365 560 302 618 201 1245 740 237 20 211 490 871 570 699 843 537 674 257 1316 1317 1000 1236 927 470 834 280 823 1297 354 741 341 655 156 454 835 5 432 862 175 1093 738 962 623 631 405 265 678 594 457 908 1071 1291 102 322 906 1039 421 1261 406 1298 1238 72 1318 914 1023 362 496 311 312 143 732 819 841 1018 991 149 34 396 569 139 954 875 762 1076 985 1257 850 318 1126 499 1361 483 1249 1222 1191 401 686 44 974 960 800 381 306 215 822 71 130 40 1305 933 748 922 1025 829 428 598 165 1036 859 385 157 121 516 591 1193 1128 1184 857 25 1131 221 915 775 158 937 657 759 1138 1180 948 469 878 315 649 1343 635 79 1243 1188 961 1062 1026 898 1123 1049 966 711 239 1177 1379 1092 943 877 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 142
]
wts 2: 917 1348 1246 835 1052 274 1229 311 676 613 84 564 614 355 137 48 825 28 1294 427 381 193 1022 760 330 654 328 1290 1252 1023 395 1100 288 926 81 440 422 449 824 1121 932 524 1066 514 862 208 1240 493 491 1087 423 7 144 532 337 730 1000 987 444 258 439 1258 812 205 237 990 24 638 399 1156 1136 115 403 731 771 931 421 1120 552 1233 1005 796 489 1299 630 544 339 672 946 185 346 717 175 530 1332 1144 572 533 1001 778 978 867 1273 729 1060 557 95 384 166 342 543 913 586 815 813 1038 947 550 893 819 563 361 643 382 87 279 88 919 704 644 1072 728 138 966 1076 1221 338 257 868 267 263 415 424 767 1279 581 531 1337 467 1070 259 1089 1355 770 659 916 1030 1068 884 1210 216 1105 538 1057 1019 126 1061 753 639 275 102 576 768 1138 844 908 934 1181 226 202 1017 1154 407 9 1263 1119 1073 1262 834 1079 822 285 74 1077 1191 938 1179 264 238 1034 823 786 450 973 1126 1082 426 335 972 1321 606 242 732 233 935 858 1371 389 1265 250 1026 1124 525 602 591 299 1192 225 1090 213 457 106 1067 603 358 498 918 1248 374 228 1271 176 465 521 136 1039 1184 479 847 291 130 627 1312 608 418 147 437 470 1276 1193 433 1338 1122 252 232 528 29 879 55 350 114 686 179 584 665 323 1311 1307 980 777 456 359 697 1183 124 568 1222 957 286 597 1083 1212 1086 8 248 1118 1107 1130 587 79 122 410 1367 975 1101 866 933 503 882 486 883 21 163 45 1071 397 519 1142 1099 1295 556 297 302 1152 699 1278 1242 1298 741 417 438 737 694 885 748 1296 873 708 111 527 244 134 751 547 1249 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 143
]
wts 2: 1206 597 127 339 559 622 1174 790 1014 214 680 538 764 1201 1368 809 347 962 871 1019 1188 340 1150 1266 409 1141 116 1295 1182 591 708 1068 903 297 76 105 1343 771 938 505 763 1079 1194 634 621 1310 496 186 603 1345 370 1207 1196 399 963 1046 765 122 678 309 685 115 654 273 1366 194 1023 1314 209 599 735 936 1192 508 260 1133 1264 907 1131 503 1156 1308 1007 351 199 776 1315 506 833 205 544 976 978 1010 564 973 549 430 415 1185 192 652 50 1319 305 686 553 705 90 374 411 1137 80 166 998 1036 928 641 937 571 671 244 1017 649 355 782 1084 966 570 630 1177 1113 814 1047 401 159 866 180 406 1146 1376 23 781 990 1243 547 1300 718 725 925 1268 607 916 983 1082 1001 1200 870 348 130 1380 45 113 740 338 6 730 877 1299 609 568 632 1282 1277 840 167 892 301 299 912 890 775 1378 535 579 616 637 1096 744 1064 1347 78 119 575 726 1126 659 988 995 1267 62 332 1234 1169 1024 733 46 245 1057 885 810 504 455 195 673 345 851 908 1149 395 228 818 41 1044 329 44 520 778 918 668 1258 475 1270 52 628 369 695 850 1111 198 1127 466 497 734 232 882 676 328 109 86 219 510 268 240 1242 323 443 1290 1121 99 714 643 739 896 530 639 1114 1294 987 365 514 31 140 1186 1231 720 636 959 816 522 1072 1073 359 421 1045 573 974 1334 442 1251 742 452 687 662 465 468 1272 325 1066 766 699 111 459 306 203 138 364 784 1202 831 852 1281 196 670 820 85 11 483 800 155 982 193 1327 1129 407 129 433 319 1176 1178 1154 844 1119 1052 881 567 554 1301 1320 151 980 1025 149 1355 383 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 144
]
wts 2: 1230 1263 845 1071 1312 250 130 50 485 549 93 123 57 453 95 871 310 196 795 173 430 741 1168 750 862 1040 1195 1269 1078 720 392 1367 687 569 703 257 801 1234 156 226 64 889 422 1222 879 404 754 1333 641 1173 333 883 235 704 172 348 541 180 823 522 76 659 1092 1122 409 349 857 1342 1131 1358 632 688 1196 799 1260 623 1070 719 516 200 1046 566 590 1211 1058 3 471 444 717 963 839 1048 586 784 353 169 1292 1086 1128 933 396 1060 1213 356 718 670 1117 41 231 553 780 583 309 1019 1150 1035 457 1033 207 706 567 185 679 661 1238 1061 248 853 753 1144 705 152 39 232 848 745 901 278 870 1227 952 1109 464 772 1034 203 925 380 971 63 334 562 762 437 118 56 1076 1301 806 385 491 708 364 872 662 1343 656 261 559 956 383 46 1204 860 311 294 140 1315 499 660 838 1368 982 954 1139 176 415 417 480 657 1186 888 891 1 1309 564 622 82 1257 603 759 1043 510 658 427 269 1335 768 1378 36 727 87 1295 832 497 99 1336 378 811 143 423 387 1217 1143 979 1178 1286 787 1221 488 276 1164 458 374 629 1299 587 302 850 13 1153 242 440 647 1310 1237 1314 940 390 389 605 1001 171 932 686 834 1373 28 425 881 918 1205 1004 904 1189 528 362 669 222 579 796 115 501 43 197 893 487 1115 915 732 341 1052 655 108 153 1241 1017 1327 1242 84 478 360 565 1318 420 707 937 410 473 1270 1280 738 923 951 328 985 1042 237 939 1126 892 631 204 880 519 812 864 1080 34 141 255 1079 436 602 300 942 597 414 227 967 694 924 778 162 132 570 1254 1162 518 993 782 1053 484 1009 855 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 145
]
wts 2: 901 435 633 557 1011 147 912 526 524 271 1326 968 409 1263 585 364 840 619 793 1002 83 635 1121 913 1053 390 839 109 1379 618 1175 676 1009 783 471 640 1090 304 924 546 310 773 989 1081 1225 1110 733 1239 238 878 885 183 1018 1146 961 226 91 309 756 1064 1377 487 296 196 744 864 103 4 1323 130 521 291 1025 525 1209 158 1246 933 550 866 1292 350 1137 877 511 135 1298 1307 960 326 1156 457 1214 689 81 1139 579 187 426 1076 1010 1160 809 1238 1115 998 1033 563 1029 1116 934 1130 93 574 857 758 679 824 754 596 680 567 327 1374 880 695 1124 907 385 1254 60 743 1134 522 1290 623 1070 1354 236 634 769 1343 161 799 1123 429 197 222 170 849 1041 33 854 186 262 104 403 319 56 73 287 485 555 1344 952 1338 348 663 1339 810 35 610 11 808 1274 275 723 709 1067 776 1087 1205 554 867 986 394 371 494 590 328 1251 114 67 110 437 739 164 105 932 256 1190 1310 1073 1219 1362 795 944 774 132 903 1217 569 1000 980 239 636 706 21 641 237 440 650 751 1193 892 918 1301 1280 671 532 1103 837 201 305 45 528 1032 629 496 571 124 630 1264 939 157 63 1278 1038 347 675 1286 285 230 1136 1082 235 787 120 1132 72 117 703 566 662 949 386 898 463 830 131 55 846 1268 1340 1372 775 12 1345 416 203 26 638 62 732 544 473 510 710 687 1329 715 942 1151 719 255 984 51 163 905 1015 391 477 1039 175 930 1097 59 128 702 1371 28 938 608 860 1120 1373 865 398 1315 517 691 396 1316 969 553 424 785 654 1361 1357 1080 353 342 655 134 1117 821 185 973 208 119 1237 1267 1161 101 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 146
]
wts 2: 615 1240 467 1213 1076 1337 770 1231 942 459 558 987 264 319 1331 490 248 1061 621 218 57 234 177 202 661 376 1161 334 920 768 958 1283 422 463 929 1085 475 951 671 665 534 1074 324 675 1187 1004 650 194 1238 1192 947 1141 1308 112 1055 1038 1333 1323 677 87 302 262 182 527 1194 1121 1252 398 1320 75 876 963 267 493 1322 554 811 390 481 369 225 758 689 989 1347 588 1136 183 13 70 705 1119 1325 34 27 1228 764 1118 1251 648 54 899 1077 244 1142 647 1166 160 821 224 709 1008 928 1005 270 630 300 1080 1131 208 745 1202 1125 296 1353 514 1106 1256 22 19 301 335 24 1034 1107 136 586 370 1247 796 866 1219 353 688 1243 529 483 881 140 703 853 865 1253 712 825 639 435 316 1084 1027 1115 656 153 277 783 672 879 495 14 954 1348 1090 1178 247 187 707 564 309 1197 1246 206 1222 132 1105 682 84 219 763 452 402 781 795 585 704 1003 820 456 447 528 1244 1126 156 212 1140 1089 997 428 693 69 423 134 337 596 360 1345 437 601 753 420 1302 1068 1267 1050 122 1098 174 186 232 782 1241 10 152 960 1184 878 259 831 1036 1316 322 254 346 44 485 430 1143 29 748 207 1051 118 104 329 785 1296 340 535 274 578 843 757 913 604 1335 1110 812 217 400 1204 1350 681 739 855 79 981 1369 1183 1254 1015 457 189 421 2 451 9 266 1158 1191 409 591 644 62 797 544 1341 736 941 606 706 1232 1010 940 1280 520 583 1129 744 1150 1297 846 40 937 1321 523 405 597 1087 711 373 833 581 159 285 784 1070 359 515 20 977 1093 1099 955 1108 921 255 365 1301 378 710 619 664 342 165 161 391 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 147
]
wts 2: 1081 378 558 385 1204 1209 1028 722 1358 758 1249 956 837 415 396 1173 521 139 973 1105 564 887 700 1285 1055 716 347 1288 483 399 1198 606 358 1325 738 128 859 360 586 978 490 375 501 1227 658 197 452 502 560 661 690 509 1009 649 376 774 675 1375 304 474 1253 1031 737 1343 1232 1183 413 957 962 561 201 257 45 1110 702 765 624 248 1065 494 970 1331 381 746 88 939 271 776 25 869 1033 524 1007 654 992 994 926 175 671 903 1321 943 527 749 462 535 292 1021 164 854 703 518 778 423 1044 471 261 679 377 909 655 417 258 16 1193 866 173 742 506 255 23 405 155 446 1167 1267 896 788 116 493 860 819 1054 849 657 1333 528 1096 929 473 812 1261 761 824 1063 1368 906 1041 495 108 419 553 497 1365 167 650 287 124 263 1328 1291 163 298 1283 592 1211 1091 954 920 875 338 74 355 1326 585 1310 958 325 951 828 395 89 852 979 684 422 1092 1150 1178 1357 1212 1058 919 1162 982 53 544 1068 1260 576 198 1165 136 918 1045 1179 1217 1015 4 963 540 554 794 1019 834 1140 741 13 870 26 1302 996 950 1252 486 833 629 1 1014 353 913 187 905 1374 864 792 767 488 1030 305 1329 598 638 161 211 392 357 1137 1106 431 1061 444 1012 1175 302 645 1364 1053 797 719 330 390 635 952 729 1188 22 409 1290 609 157 459 1189 209 374 118 359 1300 1236 1315 1000 434 1156 597 715 1119 31 1219 704 1131 342 851 220 1185 845 475 548 427 605 821 18 343 1207 253 408 1363 1203 724 1163 348 874 1017 822 1250 1152 537 1263 145 508 1043 782 464 600 129 599 832 664 222 256 1338 389 345 185 904 925 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 148
]
wts 2: 1161 774 1362 238 782 795 150 171 440 539 78 953 758 25 1106 176 1125 512 1129 736 805 63 466 272 349 648 1289 597 540 391 348 803 275 1267 223 772 612 1221 1100 1260 600 246 1004 1201 201 784 1376 377 333 371 1190 811 832 863 1204 1275 18 457 249 122 142 414 312 451 3 59 632 851 778 276 518 446 91 881 378 40 1230 497 702 252 814 1051 1136 470 293 1374 44 363 259 1157 871 1156 735 151 39 242 1067 1073 194 263 1158 908 121 1022 554 723 659 820 920 232 1249 557 209 844 1006 339 1310 1238 268 16 384 856 413 1299 1012 321 1071 146 1101 228 653 452 203 305 64 1177 660 906 797 484 789 1243 1276 29 1168 606 1290 285 1090 1066 808 1319 826 806 258 883 1039 932 1122 572 835 946 566 877 934 448 297 477 165 1239 98 237 1175 936 515 417 729 1144 159 220 309 85 430 1011 180 1140 847 278 1237 1361 646 1183 133 41 1212 262 389 1126 137 186 328 270 450 245 108 169 962 416 1052 718 652 73 1369 473 319 947 530 19 47 1277 1091 671 1017 1056 250 1035 255 658 100 157 628 1115 731 1094 716 631 408 181 1016 969 636 1160 843 525 385 1256 247 112 1213 534 655 673 777 764 1245 110 141 1318 897 958 703 895 30 984 1172 1169 485 733 126 99 1284 296 698 469 786 1155 940 404 619 972 933 313 1088 971 886 869 900 1252 721 392 449 860 1373 1359 624 1053 824 788 1251 103 713 980 807 107 43 661 837 251 424 114 542 785 633 836 945 692 493 541 22 514 190 1209 707 991 590 406 910 1241 72 265 1054 1340 433 505 35 734 138 208 834 609 651 1152 711 1265 300 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 149
]
wts 2: 671 494 606 785 987 128 693 986 563 912 834 1276 1103 940 925 656 498 80 716 273 537 996 988 1270 523 597 152 971 913 138 1202 118 336 654 709 425 1263 518 294 864 650 1212 977 519 445 1311 299 562 1188 189 1205 1082 486 178 443 205 1364 929 888 727 1275 201 647 515 740 244 260 1248 550 928 1102 227 545 861 605 978 725 838 683 771 685 972 313 167 629 1220 38 289 852 823 149 821 580 651 1172 788 1130 914 1000 367 1333 882 982 635 1055 780 470 1242 1224 599 1219 144 839 29 257 136 658 1369 277 339 444 131 904 347 983 1237 102 1118 453 418 1277 328 208 164 448 455 684 141 185 759 576 492 744 753 426 844 270 143 1166 1221 1297 1247 1116 932 87 285 1192 980 990 954 489 879 1154 767 644 778 992 774 918 845 231 866 610 811 1158 652 387 793 511 378 655 1366 525 813 60 1042 1173 1187 826 293 1226 83 1178 66 24 1358 1139 1106 919 587 235 1069 829 291 1310 874 1080 376 1349 382 1266 746 794 154 419 1059 680 1169 959 473 799 751 1337 1040 792 540 1098 248 1368 1304 974 1122 12 357 1117 100 1039 1091 705 910 527 1201 46 900 449 1179 323 1061 632 1244 736 964 660 158 1215 713 1024 215 1260 234 836 947 57 1305 8 109 508 936 373 1278 1020 389 529 677 91 1099 1176 995 1053 855 202 77 175 380 810 1343 258 345 1361 210 1152 359 316 45 417 88 1160 944 969 1083 1279 1255 559 549 1171 676 817 460 887 33 806 2 442 787 993 1138 304 875 501 927 1379 1104 1175 618 731 70 1300 130 349 841 504 755 43 1359 491 804 830 292 430 223 574 991 288 495 1256 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 150
]
wts 2: 713 1348 1323 941 1173 1250 881 751 892 676 1347 92 771 222 1089 804 81 80 845 425 1134 264 67 967 673 800 715 705 351 957 1220 559 720 1314 380 930 1374 82 260 376 306 962 833 523 740 637 595 996 1097 1321 76 230 59 879 204 600 716 466 265 505 1344 615 496 439 653 551 62 759 1111 479 950 1243 489 1147 1161 1074 119 53 1219 877 442 939 862 30 127 407 1248 1182 1057 193 1021 445 572 276 1037 811 141 550 1329 93 415 364 97 858 352 606 1151 578 1015 46 1361 1013 1064 823 788 102 1352 148 990 692 1054 907 906 319 182 749 604 2 1354 212 968 1158 902 1307 298 524 378 936 1071 1075 1088 918 233 170 558 451 878 336 684 347 188 1142 560 1346 849 521 349 1195 54 1067 922 419 344 245 1132 1269 648 156 21 898 1206 1322 1029 1287 323 1104 1285 577 291 599 1282 292 428 552 304 1128 409 745 1099 8 866 467 213 1035 155 427 683 1 951 1032 1030 1112 735 438 631 605 839 348 1311 121 1011 278 916 886 777 985 563 461 885 1148 642 224 1157 137 717 183 810 1302 1188 74 223 887 333 639 413 590 1001 1105 509 1210 736 932 1066 158 826 763 1078 1357 1240 837 627 488 1309 370 1045 818 146 339 448 493 345 194 1247 474 1059 960 539 702 1026 107 821 430 341 113 748 134 1353 368 1129 1098 822 244 649 1150 522 1225 1255 1241 535 1085 698 1201 945 1365 205 566 693 464 263 47 228 463 129 436 614 1179 229 817 1137 986 1370 152 1203 953 45 719 189 1362 792 262 20 701 171 903 752 1343 764 1183 581 458 640 431 1171 981 952 115 13 144 1350 293 1214 1107 374 495 712 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 151
]
wts 2: 769 886 451 453 417 360 1054 1358 505 1156 995 982 1160 671 1063 4 414 1333 440 133 205 327 916 903 311 8 1047 1319 1204 200 948 871 622 590 817 908 267 35 222 1230 537 834 1086 1210 95 902 337 107 1137 1244 13 1279 1193 376 564 439 230 1197 521 333 557 1218 1329 365 492 272 898 692 954 854 290 672 405 86 193 1166 1053 92 813 1322 541 346 296 1368 258 319 897 818 1367 1228 216 397 310 1192 848 268 958 19 574 976 1237 674 181 244 1211 722 1129 543 303 638 304 1136 74 934 1097 633 420 497 1050 479 760 347 63 235 1245 939 1180 348 1199 1026 220 1034 778 75 136 1327 609 345 814 1219 1175 1311 294 97 658 554 957 559 237 1108 730 279 755 661 419 947 1173 832 221 972 1170 598 468 729 698 1024 940 859 353 482 1314 794 979 2 1055 160 456 1060 665 1115 611 209 141 124 428 291 179 895 640 1127 236 1049 80 1217 822 5 1148 833 804 518 858 614 539 1090 188 720 615 1083 215 1303 113 1308 575 1214 815 1232 110 1172 761 659 340 673 705 547 214 150 508 1057 714 1349 157 1084 763 368 231 151 562 474 1209 1073 806 131 731 1171 798 943 99 989 919 395 1027 700 1252 651 435 838 1338 1018 716 703 588 828 29 1022 135 28 42 153 342 457 1208 749 874 950 987 447 843 12 366 1290 39 450 164 382 1351 724 229 809 352 315 606 498 697 438 117 668 343 826 533 211 639 953 694 610 1203 1058 111 885 202 512 298 998 251 148 169 560 862 47 846 1231 873 87 1040 662 1085 41 713 101 869 626 14 634 861 1363 132 1092 643 1247 644 519 410 906 64 383 1038 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 152
]
wts 2: 1029 750 729 1218 775 116 539 574 82 800 545 388 367 336 1139 876 1031 56 278 650 59 1237 853 703 955 1005 884 398 1109 1339 508 501 671 1175 495 1282 691 175 478 1329 219 522 68 286 1173 343 1289 1273 784 290 672 493 645 711 561 439 1070 47 189 523 768 473 1144 1366 1334 327 710 151 595 232 1313 1263 486 686 114 1112 549 837 117 797 458 1118 449 144 88 744 1340 61 854 963 208 274 1071 136 788 1147 902 404 308 569 337 1371 603 1162 46 1037 937 1126 761 228 1171 328 533 999 431 353 107 180 153 974 264 460 176 1268 661 769 448 1322 1310 49 1364 272 893 1295 567 437 280 487 738 217 429 18 1027 660 760 12 476 709 1337 1094 310 1243 186 759 101 856 789 1059 1202 224 551 765 1272 826 611 811 344 794 532 14 1000 305 846 273 682 911 1024 1200 1240 152 52 1041 292 121 526 513 677 104 1095 970 193 1132 10 1110 722 373 899 80 544 419 938 631 1080 405 259 396 243 674 716 758 472 15 936 1212 868 987 480 715 772 324 332 182 455 647 417 466 1082 932 825 1128 872 935 948 399 453 1343 444 582 225 1015 320 9 1133 820 992 644 203 860 361 91 1238 73 839 97 139 1270 298 238 1229 652 1319 1204 62 782 1048 1379 72 148 411 1141 1318 163 527 570 1012 226 874 1123 969 1280 54 809 733 345 580 725 1092 836 640 1208 1336 474 187 115 1360 830 1177 679 390 649 326 1176 1159 146 1068 456 212 1288 1314 619 99 181 1231 793 169 1345 156 528 465 360 871 32 8 883 1197 967 1358 656 164 958 653 786 315 1083 950 1290 1350 889 1359 767 901 605 1026 363 735 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 153
]
wts 2: 23 49 299 1135 379 655 357 583 549 391 494 857 1344 1211 77 136 1024 691 587 1179 1025 677 61 505 1157 1330 417 973 638 1046 1045 1264 493 369 965 448 1131 1017 315 988 822 670 1265 1173 736 210 586 767 303 1350 184 362 1369 1226 159 595 231 234 891 594 1185 463 508 1181 13 771 788 1267 1291 22 664 1091 643 947 747 1158 461 148 1000 447 1348 815 1357 985 640 1054 1163 1270 353 1042 738 100 1156 156 927 709 882 130 1326 111 500 54 796 376 514 629 977 1259 528 625 26 1290 149 1219 1130 1082 1067 51 568 987 934 88 456 429 772 356 91 393 133 1177 1370 846 4 589 993 1320 259 337 1035 435 7 607 844 336 856 349 1115 331 458 236 132 590 480 64 519 1305 1073 1168 766 1105 1176 584 613 421 279 492 1214 778 555 591 1075 323 167 908 821 912 676 355 780 1020 253 309 398 383 744 527 230 146 592 702 949 848 1362 992 173 718 201 1123 1347 239 57 72 213 1299 1030 1310 1193 1188 241 903 1293 742 784 1002 46 565 1101 347 547 713 408 840 294 865 237 1170 98 38 83 285 377 1069 1279 1213 1152 1209 1251 824 486 186 1285 941 1102 522 1144 364 645 938 572 774 782 1222 475 190 1116 143 334 43 850 834 1356 1275 1061 577 653 602 830 127 109 1183 1004 787 449 350 246 1023 126 1333 339 219 455 1286 12 1195 720 195 1092 193 411 81 803 611 1297 395 489 812 1051 578 420 1056 6 976 926 826 120 1186 1154 660 263 366 762 1374 157 783 952 745 381 1077 1371 962 690 1104 346 1313 298 627 969 1126 1191 972 361 226 1363 758 258 1153 935 1146 175 652 963 307 412 967 516 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 154
]
wts 2: 176 586 1327 1154 929 1088 475 391 649 482 1066 535 191 451 204 1213 269 24 1195 1119 400 979 236 196 891 36 169 317 759 1155 1250 1073 1304 171 1191 797 644 1156 1204 165 1056 1142 893 1057 809 524 190 1001 1227 1086 588 700 284 830 614 1217 1312 538 871 912 461 1265 722 1376 1148 117 47 55 758 752 401 346 578 878 832 639 262 1268 1012 1053 756 213 1027 459 1235 71 1059 918 502 259 1178 242 876 194 18 185 593 89 1345 1373 1210 209 872 590 641 698 652 512 6 1147 778 396 817 840 492 568 1002 895 1377 382 265 324 611 1253 1232 1257 1368 58 983 224 34 989 1180 665 1307 316 385 533 932 222 203 445 1150 268 677 1145 610 1163 1279 1288 534 1202 127 907 757 332 463 1070 440 1370 291 1328 897 118 1306 1338 1131 959 660 1008 717 884 976 571 587 1132 574 457 1329 1275 1168 217 562 852 606 528 697 1018 422 680 888 424 253 195 559 483 51 910 1153 97 357 315 1174 295 909 794 296 1091 924 488 206 91 788 235 421 341 45 95 312 122 402 776 212 1243 733 650 707 537 43 244 577 935 1020 827 1236 541 320 919 1296 458 96 468 152 772 1211 990 727 279 926 1305 868 1081 1365 1126 455 432 148 634 905 656 844 908 747 731 339 168 182 336 1146 851 1054 372 1311 846 1214 1224 1298 1124 768 1375 234 670 1004 714 857 1183 940 864 172 181 273 1098 25 442 569 276 481 949 493 519 1029 1133 746 755 1048 1045 433 749 1269 1206 1144 31 867 799 1222 489 600 635 1291 1006 411 1231 161 703 712 431 299 187 478 305 437 1157 986 725 1295 1152 208 1094 803 107 228 620 343 247 136 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 155
]
wts 2: 742 1259 368 37 393 431 64 399 755 144 1084 731 419 958 89 1065 1291 335 684 1358 320 576 6 380 269 607 301 714 426 872 1344 1070 654 609 1144 246 349 1229 972 1050 598 668 689 525 197 1238 788 5 1300 215 657 772 502 852 374 79 492 1088 1309 1203 1336 1231 455 1280 515 209 1111 20 108 1327 1202 862 951 633 452 693 248 432 778 1328 1332 182 1359 593 375 1288 2 1115 929 595 470 1279 636 1368 1130 1258 915 367 615 514 189 740 1171 1125 1162 1093 1137 446 1249 1272 69 1331 105 658 801 757 927 544 991 916 1295 913 1038 1105 938 1370 344 978 837 711 373 700 338 721 1196 160 141 1293 245 76 1236 1189 869 1172 635 1210 1060 894 850 87 511 1289 917 178 1243 1041 109 1166 1001 465 519 1045 47 192 14 163 111 647 321 562 67 3 1117 30 889 469 762 1020 1035 289 359 71 655 1248 637 1281 317 563 1375 149 858 392 1068 1226 638 1246 322 222 1296 650 195 1253 547 653 567 1126 1124 810 925 1337 493 208 756 751 210 361 143 258 1064 629 624 156 65 92 664 874 768 1200 468 1046 370 918 186 1302 1190 1138 1096 596 1348 490 728 937 179 826 669 1164 61 743 117 987 1353 853 1085 883 1275 857 868 311 816 66 1094 780 352 616 1139 1241 97 29 1290 1019 602 310 888 1011 1340 662 169 691 942 1371 621 240 391 646 1058 959 138 1118 645 975 785 610 1191 744 477 482 57 282 448 125 533 766 1154 1188 1 132 400 239 906 312 854 337 1123 159 398 390 787 231 1356 970 670 126 25 437 535 947 844 500 1128 441 723 1219 1160 387 272 345 803 217 539 924 948 41 285 350 656 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 156
]
wts 2: 595 304 573 377 552 772 6 160 112 1359 873 254 1038 1365 34 1203 698 18 529 895 926 135 104 89 223 1245 752 531 474 355 213 270 391 1185 868 820 178 118 1161 361 1277 199 1364 1071 562 1275 811 70 220 27 445 878 107 457 663 1325 338 753 872 368 239 318 196 1195 1179 13 32 417 666 593 40 1047 1046 1265 1062 1181 1013 442 738 433 1110 1155 582 299 857 202 633 1333 542 533 217 91 835 1154 1056 514 1125 478 458 539 1208 560 962 119 319 541 1000 1171 369 24 1269 567 203 957 346 516 379 287 920 639 703 258 561 726 29 829 660 743 563 999 909 803 320 22 827 1358 933 116 323 946 604 760 1004 691 1206 690 640 839 817 219 783 1252 84 600 826 283 152 713 866 93 1354 1041 169 1074 773 716 67 1043 1285 173 977 967 224 522 550 700 235 1135 727 392 1295 891 1126 331 709 1319 109 69 1054 1219 336 85 1061 1238 770 129 628 278 1189 707 905 945 68 301 81 9 314 801 460 1045 833 200 614 125 25 526 66 122 625 1097 519 795 1309 626 927 601 193 42 1357 75 186 425 948 1165 264 725 161 407 1337 400 188 384 675 688 785 701 120 495 1131 543 780 61 775 1006 917 594 919 912 1226 671 931 916 303 389 1371 147 724 845 1152 131 159 1019 194 462 859 271 790 144 664 1346 674 64 937 956 284 1230 1082 904 995 961 858 766 192 427 1288 146 631 1287 1111 632 1196 266 1259 649 10 234 1345 656 1029 1369 255 481 1113 1160 429 39 1020 1094 97 965 488 1242 737 1132 1177 1072 45 1246 136 354 784 879 1107 1352 1267 1040 1146 1141 1344 80 446 1217 503 92 326 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 157
]
wts 2: 479 1231 459 691 304 698 257 689 52 340 339 471 1212 551 1151 333 576 89 442 455 361 60 605 512 725 722 580 824 552 537 952 1361 1205 697 1029 578 468 254 506 124 791 519 671 625 585 1136 1237 1037 870 712 640 1222 501 461 924 1321 611 926 157 487 994 229 110 863 1032 581 521 1028 981 993 655 748 779 428 463 357 644 1084 688 263 1211 616 928 443 218 434 703 996 140 856 416 311 835 285 69 759 798 329 999 413 48 780 879 871 1338 262 1305 1215 1141 243 1366 728 255 216 1319 980 1067 1049 643 295 637 1000 139 518 608 1027 1016 100 435 236 634 8 465 1185 592 810 914 829 1285 34 1315 90 968 826 1351 133 1129 905 200 1325 129 685 666 277 22 1362 547 175 1195 358 850 156 32 806 453 485 500 656 1304 256 1208 356 903 916 6 821 1155 210 586 294 686 793 484 232 426 887 113 328 721 1263 1118 699 1358 1072 723 1207 843 161 1143 145 1148 860 868 383 305 193 854 545 131 177 1001 842 988 420 958 283 221 770 799 1235 579 77 125 1323 445 1246 1327 1278 116 1264 162 612 121 184 1128 138 1218 1282 1227 1062 705 126 149 776 1165 950 670 92 247 596 390 467 593 429 892 79 1090 771 583 1119 141 833 498 713 684 790 976 556 1026 970 204 632 1313 1380 1365 1091 889 1243 1370 792 857 520 880 587 1080 351 934 568 147 918 954 1270 674 1190 845 1314 549 3 45 93 407 388 946 1127 972 209 67 834 33 241 400 291 664 1076 1253 573 369 1045 245 1271 749 873 755 284 1106 83 447 1341 510 1132 1168 530 378 543 682 1098 1003 275 819 1130 631 558 217 74 144 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 158
]
wts 2: 218 425 168 93 1019 547 1156 1172 308 86 1313 988 1075 696 833 760 1145 480 1089 1190 577 1374 882 1085 213 1257 288 621 126 42 1081 339 1095 523 541 566 821 15 493 1093 1083 819 312 1187 36 438 465 1090 1149 430 881 1325 459 609 120 397 1200 208 154 863 296 50 266 1208 404 1295 738 767 494 912 278 435 699 1181 1164 343 320 437 364 870 16 134 353 68 479 923 657 491 1292 1332 378 1006 641 952 237 89 1261 359 536 788 267 51 1101 1087 916 193 442 264 652 1107 1 655 162 142 1060 938 612 1135 1020 389 1377 743 500 666 337 1084 1360 1094 1321 384 633 467 374 124 304 1131 684 240 1289 87 953 1050 345 548 487 768 96 1222 1305 990 469 14 1231 74 856 1337 1294 1334 778 155 711 1138 874 300 390 667 909 1100 250 1117 1380 1260 825 1025 987 2 993 521 400 277 209 111 1268 714 1154 57 792 1092 638 1240 151 1254 1139 565 902 451 1219 843 937 554 615 954 4 260 171 951 753 1379 1355 665 145 626 1359 329 965 1267 1130 1252 49 39 1166 968 811 545 731 1265 969 681 1312 592 1343 306 1329 192 478 363 742 871 1105 898 726 935 1296 1246 440 167 140 531 526 181 613 1339 1328 930 1369 662 114 591 1196 857 1037 441 354 975 999 619 608 1336 47 103 231 463 692 199 201 28 865 464 1215 1071 471 78 616 1188 248 1287 828 931 725 695 920 749 1137 94 586 517 973 503 123 488 1273 585 40 729 974 1322 1176 686 986 439 658 272 461 1216 524 1044 994 357 501 1091 945 220 926 85 1152 1023 765 391 836 421 748 1351 877 207 1007 864 1344 947 283 896 481 172 1045 1153 413 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 159
]
wts 2: 735 1093 415 534 386 470 136 491 1374 1047 848 524 733 590 129 917 1355 1283 144 375 79 786 94 1335 1321 690 541 1119 293 548 763 938 80 713 1276 793 341 1278 16 310 1001 1221 729 1003 739 1184 251 140 666 892 189 913 516 623 1193 73 648 660 910 582 1106 1036 1146 174 38 935 57 1102 1186 930 977 259 1368 781 247 472 586 1203 1107 266 168 72 262 817 431 10 287 350 1128 323 448 419 1055 69 318 1006 1356 1249 932 1126 544 840 465 983 949 1352 1155 1247 304 888 37 60 41 1281 692 851 1072 827 699 348 196 322 146 70 646 481 738 736 809 1068 236 1150 492 612 1293 342 1117 411 978 1114 573 767 1098 493 435 842 1154 788 476 581 143 1225 976 972 319 1195 421 755 1100 1124 294 549 1160 1213 833 770 192 1336 567 1148 740 93 225 1304 663 982 1012 404 28 1162 672 74 1101 1209 981 1108 719 838 748 647 215 128 576 1333 812 138 743 1122 1027 245 228 412 963 1085 324 899 947 270 1232 829 625 379 988 1338 1123 1300 1051 897 784 368 608 592 777 195 1342 130 353 504 1227 234 1250 1038 1033 1302 185 495 1290 560 377 502 338 1255 1078 1023 906 173 1042 922 1372 187 1348 477 21 423 594 1262 142 1236 1264 1187 513 1223 12 939 923 968 111 90 894 36 7 380 566 1138 538 46 1287 147 991 1065 722 1316 409 887 723 317 1328 503 473 296 1070 141 1211 451 1362 1 75 966 408 741 372 1057 1202 343 858 286 1037 216 1196 258 727 1224 627 326 347 31 23 693 306 164 433 943 1044 519 701 1272 271 1226 417 531 562 717 1054 1137 1056 959 220 337 87 1129 726 369 610 546 924 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 160
]
wts 2: 948 1299 1053 608 259 242 553 963 524 185 1229 1366 881 1254 798 651 298 714 204 124 1330 612 445 671 733 1020 899 543 466 239 885 868 701 985 1367 441 137 122 919 599 519 388 431 462 80 822 728 1305 1374 1075 456 513 195 718 222 56 180 926 84 461 21 200 1323 1286 754 1243 561 984 130 153 71 31 970 206 258 705 1076 738 1325 789 839 455 280 815 302 1083 559 1158 212 292 45 1215 402 229 366 1048 339 44 314 138 1074 1369 1344 633 435 1089 1304 1276 1091 1199 205 62 782 105 1240 1174 867 351 294 537 730 741 711 1088 288 724 312 560 1252 272 408 420 1069 444 951 37 625 93 953 622 896 1015 933 536 747 630 973 925 1291 848 1111 676 360 843 979 707 1208 284 1357 3 544 1009 426 518 293 304 679 418 1023 321 470 197 635 920 162 758 785 82 1168 427 1142 155 270 593 1360 1154 986 1184 570 1376 1223 496 616 494 198 946 88 642 12 1140 271 1148 279 1342 1247 535 806 227 473 33 485 1162 1225 621 1311 1040 316 546 1153 583 1008 966 48 27 135 41 678 234 487 1301 1042 993 952 1373 1206 103 967 1034 886 576 1084 563 353 295 495 610 244 766 956 491 924 1169 694 934 552 1055 515 400 1340 604 1313 523 96 385 603 174 184 1264 1036 248 849 540 998 34 453 939 854 613 976 246 60 362 864 264 844 74 451 1060 1283 432 595 1379 1195 601 958 1249 327 1047 141 228 944 1167 693 910 908 1144 809 1182 110 457 743 367 722 662 1214 247 419 417 471 1077 832 1345 1307 968 401 1024 528 943 8 338 706 64 1297 1033 816 525 564 1329 387 202 1238 1327 991 439 1284 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 161
]
wts 2: 810 1336 946 57 129 670 1180 728 416 687 75 563 845 174 656 644 1052 429 873 1174 280 84 1295 137 1047 139 237 612 10 316 909 462 1072 1092 1377 614 741 559 171 1177 285 678 486 1000 138 314 1076 769 427 324 152 1353 1098 982 707 252 1216 1003 842 361 864 126 105 251 1058 759 792 738 82 128 417 929 622 812 1038 660 677 1308 298 537 489 65 560 21 328 997 54 68 1107 22 258 1324 428 990 39 311 837 907 1201 684 610 957 740 1238 1319 1057 824 327 1314 639 674 1094 598 917 1292 633 396 611 1221 800 150 299 222 182 971 1170 1279 41 653 590 526 732 1289 809 866 828 666 125 688 230 528 1348 473 1018 1199 93 326 1129 394 763 236 1305 1340 992 777 167 283 42 566 882 776 799 1191 756 735 1245 336 1209 1251 460 190 11 711 85 829 778 860 965 1118 1162 1351 1219 527 996 1248 620 641 826 706 355 198 1187 650 186 160 206 1189 1270 144 698 7 210 1157 485 1274 188 896 398 265 228 977 700 1164 289 329 260 1137 1331 14 811 655 514 63 681 533 597 44 524 919 255 35 119 132 950 521 83 445 1280 654 1346 1051 1008 273 305 13 197 163 1323 836 87 180 113 586 541 784 1108 959 1317 352 165 531 424 1250 184 19 984 768 823 874 935 108 1161 857 405 468 651 925 1352 1028 885 1217 168 101 467 673 321 464 1042 100 287 802 530 580 714 1125 116 1316 906 1154 1347 318 1073 1318 918 911 133 176 1117 1106 175 1025 242 74 1133 582 668 904 1007 1173 1327 1233 1104 659 1268 615 816 877 102 960 517 1142 224 884 145 634 404 956 801 301 551 924 457 67 1097 1009 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 162
]
wts 2: 1295 260 635 1173 1034 121 1361 842 1274 835 719 804 637 767 882 939 696 1326 431 1341 1033 878 1108 1280 320 640 312 713 671 182 537 262 327 226 375 734 574 1074 227 417 337 698 71 890 731 683 421 672 186 201 178 726 1058 48 665 1056 1205 145 549 321 591 1010 1006 554 1155 834 445 1135 3 430 803 908 1188 209 210 177 429 1332 295 510 740 989 668 1146 206 791 172 795 113 1073 330 1307 1127 1026 66 396 955 953 564 1112 40 50 659 631 810 485 691 511 240 727 59 285 354 1272 715 252 308 72 1263 828 676 97 1145 360 1045 1212 351 102 771 311 144 643 967 769 156 1360 427 968 784 840 1359 937 456 1128 6 124 998 646 806 741 235 1186 1363 689 1261 192 889 1270 1016 555 708 557 550 901 750 587 1038 422 100 1158 12 1185 1144 845 975 483 347 73 869 884 638 1380 377 1183 271 305 709 247 393 1368 1051 469 959 185 865 64 770 656 88 985 19 60 956 792 778 1294 1353 609 1243 1214 395 1333 690 1231 319 357 1364 28 780 423 1319 632 1169 43 995 1068 458 733 965 789 875 1250 1107 1015 1268 932 506 1249 1054 450 928 1064 753 1081 1114 1266 146 1207 872 577 949 867 1052 199 757 1225 616 255 1090 642 122 751 1193 89 964 798 988 1248 1298 317 46 666 1229 138 970 291 508 406 283 478 1174 984 1002 1102 267 481 522 981 17 552 487 1309 466 1285 57 160 1104 390 605 16 519 1304 590 725 465 91 304 1066 1 493 211 225 251 1184 74 541 1244 1230 1093 1166 21 1070 846 1258 1322 809 1118 150 101 1092 110 1252 1123 1236 168 1163 1219 1140 523 905 530 556 1080 786 1036 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 163
]
wts 2: 462 19 828 1118 607 759 467 1363 757 402 812 193 774 1164 43 282 1103 1130 574 1115 717 60 727 101 488 923 515 1165 1119 1011 115 1302 8 300 354 1231 636 1376 1237 974 230 535 794 34 133 240 308 1134 156 1025 553 865 1240 970 257 737 686 700 104 170 787 1071 1056 35 592 202 690 988 830 480 232 1272 849 268 725 841 76 118 815 328 404 999 1318 734 754 2 1105 330 128 621 1303 289 281 126 912 1107 234 1109 953 262 1345 531 1258 12 443 3 847 22 773 1356 1203 924 583 1019 186 442 77 1 685 541 235 452 423 177 821 889 918 669 292 653 246 1357 1215 1242 625 857 864 790 879 996 146 1003 434 151 1156 494 807 1329 373 44 579 219 795 1223 683 159 1342 379 190 410 898 905 372 1341 939 400 1052 1108 575 29 744 998 469 267 371 1222 1076 892 129 431 1378 763 1117 7 1276 348 368 1143 741 783 827 1245 67 23 1290 1372 785 838 942 107 629 1106 945 498 1058 959 54 440 698 745 662 26 435 712 862 510 117 195 972 544 1009 516 1060 1227 1120 881 432 1271 613 536 856 668 203 1114 106 1168 178 1028 869 1308 1323 82 1073 829 1195 1005 352 1127 1238 1229 478 1148 248 16 595 496 817 413 882 820 793 369 1170 261 93 748 493 1173 873 1310 1091 471 729 634 937 344 610 1151 123 853 1313 967 285 635 602 1299 109 1216 973 943 730 716 511 555 405 845 212 1182 364 997 149 476 270 751 1152 1288 256 333 1126 540 1079 1343 57 224 247 175 165 1304 114 548 991 598 249 1311 444 612 880 355 388 414 1033 468 475 655 971 1244 243 1297 499 201 287 116 585 214 20 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 164
]
wts 2: 1005 640 947 1 600 1235 428 29 1372 917 76 1125 351 866 1367 1056 747 397 631 577 635 271 781 1190 616 35 562 1174 201 937 1137 1057 23 167 179 181 787 1064 1185 564 419 585 678 332 950 902 150 156 762 807 149 960 1123 968 579 976 1087 180 220 352 346 580 405 30 6 567 919 770 1330 290 980 263 909 892 365 1045 875 1138 230 597 586 794 1020 595 918 883 1145 327 599 469 123 1306 192 484 356 126 1131 1034 1228 1249 682 432 1021 233 1260 826 1299 209 195 463 324 1121 1340 656 885 1362 85 1208 1358 1083 424 1265 739 442 395 82 1159 1279 1183 360 969 619 1376 1049 89 554 1157 529 111 140 1234 634 632 1348 508 1206 1221 995 1204 291 837 719 1141 1331 1216 627 1310 1086 1360 1251 1151 694 957 1011 164 1237 388 110 669 1345 1337 310 530 935 414 1160 341 445 1308 607 57 696 644 685 441 329 788 54 436 881 516 337 61 1084 1090 488 133 102 745 28 760 1189 828 561 688 273 922 1291 368 780 1239 1173 1168 435 611 302 853 817 348 1036 706 506 809 72 1188 884 1042 380 317 1203 115 1373 420 1286 1010 1050 458 68 1273 1257 765 42 1047 422 52 823 1068 191 974 162 606 702 849 37 1008 985 450 556 96 9 1364 1132 618 221 224 1003 840 647 1329 945 1054 177 153 185 105 190 10 1344 454 726 568 714 406 318 587 2 992 113 528 1304 886 1062 367 1149 704 720 751 1213 539 1309 649 1293 954 509 953 1316 956 481 1163 1307 1263 429 698 1289 964 768 1243 576 1209 1335 1270 797 1379 276 250 850 667 479 991 663 308 1051 229 1332 1044 381 417 275 1181 560 1098 847 1202 1322 541 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 165
]
wts 2: 1052 997 389 366 679 1366 175 1005 910 983 270 315 539 112 427 1100 1160 1253 865 719 263 505 967 207 709 124 326 1120 636 22 596 710 451 1032 898 137 905 1067 314 776 788 1137 830 927 528 1246 706 332 369 159 440 418 1305 700 825 450 318 584 855 376 1199 421 1003 1339 220 803 1214 431 379 459 1020 622 588 397 800 718 1089 822 536 1274 970 1252 544 368 399 2 19 470 1279 554 125 415 1322 1247 806 377 295 674 408 1002 165 69 446 553 1025 899 167 1208 699 1015 945 600 720 1300 950 74 1258 662 1298 845 31 1069 787 514 1347 433 652 265 32 889 917 1303 568 764 1152 205 145 650 802 737 1056 1255 126 563 1286 284 635 877 844 307 241 863 345 122 330 1268 1331 1225 758 372 209 37 245 465 1143 490 1044 501 161 1178 1004 92 507 1316 812 317 543 200 907 297 1188 1155 1179 742 603 223 521 626 848 229 310 156 688 1348 729 405 986 1311 685 976 876 1193 1127 1148 676 511 821 178 1290 1108 201 114 195 850 611 796 33 1372 1157 1001 469 1121 210 972 621 420 591 864 571 388 1096 1203 960 407 957 902 27 268 595 1028 482 694 138 400 396 1289 351 549 75 173 429 1232 618 1192 585 839 707 1326 1094 1315 1267 827 262 267 941 394 672 879 242 783 714 1115 762 1248 922 530 498 12 221 24 313 575 1375 361 43 931 422 1320 527 894 146 392 386 243 715 732 919 1182 457 642 335 1010 306 54 1299 545 1142 1224 538 814 142 774 356 1275 339 791 1346 529 658 170 824 319 664 219 1356 191 1138 939 467 550 1135 1222 311 727 900 1021 624 239 639 375 1373 214 1265 1156 897 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 166
]
wts 2: 1070 463 449 1091 558 898 1280 327 856 88 1227 160 905 923 993 1284 748 1249 796 1 723 617 481 606 307 537 285 1366 1023 353 587 1282 228 1079 329 648 1082 777 1117 1318 928 1012 68 1041 477 1061 929 473 325 413 288 889 406 1359 1322 1379 749 237 575 485 875 764 162 25 739 1134 169 92 871 498 694 711 1016 427 206 1327 1112 349 1118 384 361 741 127 1357 629 1013 405 333 910 882 81 521 831 491 858 251 1065 700 936 187 401 1086 10 636 886 914 745 1043 1219 1277 1138 2 533 356 1140 1247 1218 212 230 32 203 1300 1198 710 1176 1205 725 900 925 118 823 650 421 159 397 652 338 1151 247 1184 130 766 231 493 147 1335 939 183 784 1351 239 222 1295 534 324 63 752 713 883 696 113 1221 1132 207 86 31 150 1017 1152 252 1194 462 3 826 1119 1279 1000 643 347 1046 1307 1066 1274 1047 1078 507 1252 18 66 186 1186 1188 1178 115 640 983 1180 316 1157 968 270 262 906 1250 695 501 773 283 1020 1371 1037 701 680 400 513 1170 1193 1259 168 431 472 574 1088 1057 1076 236 690 579 194 1196 1063 561 256 1128 1232 812 737 814 317 419 827 490 402 90 53 497 417 381 265 865 1241 1064 1348 1292 1267 678 414 1092 104 972 531 511 393 915 387 221 14 438 420 110 140 354 801 328 1339 893 79 1343 607 1175 1174 698 70 562 987 1008 310 581 1049 343 303 84 1028 367 930 815 1365 1358 819 155 512 108 233 647 991 1316 1139 386 1014 487 743 415 843 142 437 1090 1161 706 312 738 483 717 755 1311 624 541 506 1215 200 1018 1234 1093 1262 684 595 298 704 342 133 1033 797 836 618 971 1216 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 167
]
wts 2: 110 228 265 1284 91 960 79 122 1147 856 575 62 661 1379 479 348 383 227 640 489 648 545 969 797 1337 652 1188 929 105 919 1050 152 750 1136 370 946 296 472 20 864 1338 1021 533 768 1255 624 308 569 740 344 1007 681 291 503 409 516 387 37 380 429 177 820 391 179 1131 1231 363 229 941 500 53 1105 566 922 1288 401 704 1358 439 561 796 381 920 770 949 890 1144 45 985 1003 438 295 501 1202 1038 895 564 767 385 384 281 71 1237 1316 1042 10 577 1169 1320 931 579 858 650 646 11 448 408 706 263 927 1183 1077 377 1204 417 851 962 1232 27 465 447 630 321 718 998 241 708 1219 1085 991 47 1327 444 84 1075 676 1329 831 1081 1096 1298 765 1049 410 1180 766 220 799 1272 51 235 107 1128 24 1130 353 1270 521 231 1302 1124 752 924 1261 1217 836 1163 1355 181 541 684 1029 312 67 1359 1322 328 894 258 352 28 307 585 725 1294 847 167 1249 663 403 907 337 594 400 440 262 1281 1317 778 98 859 466 238 717 285 1312 1344 1212 1080 852 515 1120 322 351 1055 242 614 506 727 1046 1102 1198 6 495 1297 288 150 974 93 172 956 297 1167 596 86 95 928 209 397 651 1068 733 665 368 1356 424 382 1206 700 870 26 1193 1083 965 347 128 865 551 586 1106 667 934 587 1340 1023 1189 1112 693 1111 338 570 73 635 1168 89 473 421 999 481 1293 645 1310 182 1230 547 1033 418 911 104 4 656 815 474 94 848 34 699 527 942 657 5 1339 117 44 362 953 1059 183 1201 556 1256 449 576 119 582 584 839 365 279 160 1073 61 896 1271 1378 854 875 189 769 313 578 1273 1063 1351 1148 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 168
]
wts 2: 467 149 387 875 642 187 700 549 695 1102 1256 320 363 914 1226 756 560 50 715 381 88 690 176 1067 141 1237 361 1279 847 1327 819 828 290 300 981 548 896 384 1352 185 178 123 968 533 1251 993 331 102 736 266 43 438 1193 887 181 615 70 372 1270 1361 56 336 248 1086 1203 71 106 490 938 964 440 1063 1316 242 206 1344 44 538 523 708 270 603 322 605 1077 807 636 1053 562 38 1304 614 900 254 465 966 686 1118 1179 379 1227 513 419 794 493 289 1214 897 118 143 755 983 492 797 346 1017 942 1036 569 104 687 1357 1175 221 1183 495 963 442 863 25 409 491 769 249 898 459 277 953 455 622 1306 1191 876 281 255 399 1228 1091 1149 217 573 928 662 902 299 1104 268 1301 669 1126 1097 550 131 1260 480 1137 771 258 932 1094 1172 30 45 199 1376 786 646 822 791 1064 1272 340 979 431 578 1030 1132 609 830 1324 162 474 745 843 421 1050 1308 1375 671 1135 1085 1117 904 623 353 226 420 519 33 275 618 820 525 638 1330 576 202 129 1115 171 675 369 677 688 644 159 82 238 1345 1286 1278 1221 613 1280 325 1248 220 1098 1082 263 1043 1220 1113 944 861 433 1080 329 870 913 760 514 448 648 1207 73 182 710 577 74 94 250 184 282 1125 948 885 358 1105 120 87 883 360 1351 612 147 1008 701 527 892 1181 500 682 683 315 654 297 647 439 310 1165 971 516 489 136 1287 579 722 1042 60 1342 1356 1014 1162 306 873 637 460 629 624 327 1108 139 349 610 659 528 203 279 590 117 435 1285 245 1313 64 9 1185 32 992 209 546 427 1065 2 1230 994 137 920 477 812 109 965 790 798 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 169
]
wts 2: 1370 1245 260 381 1163 47 391 1211 271 799 1343 1376 488 303 901 1377 957 834 46 636 559 112 1341 118 1295 1298 1365 75 553 721 547 1366 821 269 238 214 750 1175 113 665 244 68 45 457 429 466 475 900 217 879 592 446 571 1036 496 48 531 321 1294 17 959 1177 251 362 1236 1190 804 1070 935 133 136 419 608 981 864 1277 997 19 800 796 440 580 439 199 1375 32 692 480 915 1025 131 916 556 383 64 810 230 876 651 1092 1312 517 5 722 426 1052 11 1079 86 827 598 1287 57 791 1049 792 596 172 501 291 1317 1261 752 1215 510 152 734 1217 326 1342 35 1207 566 802 749 717 1123 365 1084 980 629 707 1380 389 1037 797 73 146 1301 1120 261 1133 730 601 1082 971 96 14 714 1023 259 1098 296 1164 1074 1274 748 999 760 233 36 1197 977 447 477 1252 121 282 837 647 609 1198 56 1118 719 1153 798 3 169 442 25 788 378 354 245 1138 385 335 694 356 682 764 1300 51 458 710 795 741 937 597 491 1107 870 1371 1279 158 1259 675 537 277 249 264 246 1027 962 176 1024 405 82 179 1319 1271 1296 1352 1029 145 222 497 761 370 1044 181 1226 215 87 634 1249 159 1026 567 1230 1302 461 558 577 102 384 126 186 414 594 825 329 552 526 718 572 256 1068 562 62 574 182 163 528 626 125 1368 223 1126 294 1321 1239 350 398 866 595 770 921 459 1195 954 972 1055 963 515 839 868 1066 170 280 424 777 1038 773 893 701 1136 274 27 941 1337 53 1265 1263 114 550 483 931 806 754 886 860 410 855 151 986 80 1112 771 418 522 104 1160 772 678 1189 149 367 763 993 990 814 640 781 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 170
]
wts 2: 1379 1309 956 493 689 1066 1118 1013 796 213 58 746 1168 324 90 805 257 741 643 388 427 809 505 1250 281 215 1011 1129 771 855 266 630 896 574 592 186 1318 339 823 831 1141 1097 702 342 18 939 759 484 1174 542 1249 810 884 795 901 267 1324 891 1114 628 1362 1028 791 1306 594 948 1057 614 251 426 922 1158 623 99 989 1036 4 291 694 980 235 250 790 451 1067 38 144 778 844 168 223 863 258 300 920 129 1143 794 1264 915 767 197 210 1084 1163 21 1260 979 1117 926 1088 1035 668 185 1062 1230 51 453 827 1345 417 483 543 1085 673 412 469 490 959 822 642 862 1061 613 405 652 243 1008 988 880 1064 888 524 1044 603 1323 27 512 1198 1105 1077 688 758 222 370 1227 1320 1192 349 74 1177 1199 825 1042 1336 847 1170 727 1119 1329 1145 709 565 1130 846 900 1017 537 1200 1161 1367 1236 1326 486 1193 789 1221 60 1131 194 812 507 783 428 587 916 1121 1046 1327 231 488 732 925 782 31 787 70 873 240 1156 1233 444 154 242 94 1334 290 531 1302 19 562 1010 1039 132 957 923 29 851 735 1257 1360 885 595 1294 1115 37 66 310 1284 777 631 452 431 1060 955 297 1342 566 1311 500 909 97 1278 317 1341 962 204 311 1333 950 1104 65 355 83 1152 547 715 1107 1157 799 1094 1111 1071 722 788 629 561 986 975 383 550 792 136 395 1368 344 861 126 306 749 106 157 1263 695 262 475 389 907 247 572 1034 1000 1337 967 1219 397 119 234 921 298 618 585 274 710 964 522 766 151 553 315 1328 814 265 1005 1183 1103 193 430 224 584 206 61 468 289 1041 1189 81 509 272 1356 1214 730 504 1255 55 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 171
]
wts 2: 1192 672 833 635 1249 968 1321 369 67 641 144 1144 1295 958 1056 872 991 58 997 724 674 633 1302 367 545 374 1169 664 543 304 791 805 270 785 1166 512 249 278 218 1029 414 901 808 650 180 137 599 1317 357 922 525 1102 187 1194 611 363 516 716 509 1161 315 567 771 1201 895 938 920 645 1214 211 145 43 12 1127 1165 614 737 1039 759 1322 444 487 623 492 1255 76 36 577 1048 710 717 1291 630 1280 522 53 282 592 649 1288 1361 1188 394 1272 388 410 279 230 1129 175 740 321 962 547 403 1183 132 677 1047 1309 1293 751 275 787 934 1307 121 1126 933 207 359 1014 204 148 986 1250 344 194 313 217 71 793 866 455 151 822 112 748 780 1084 548 1068 560 540 431 842 606 51 607 1222 800 733 27 930 1358 1103 402 620 219 1365 255 32 1371 134 460 1065 1178 754 47 26 1026 1289 274 1123 609 265 322 1073 222 421 1001 283 398 905 1334 1038 1281 1174 208 28 1312 960 796 156 932 657 891 500 89 766 1234 1339 370 384 827 686 454 769 377 150 764 154 568 69 1011 885 111 515 186 974 72 1083 1246 1294 1075 485 985 236 1134 618 1235 1005 835 966 1296 902 292 666 646 949 108 25 465 1267 138 684 713 508 694 582 1380 41 911 440 745 708 68 436 669 963 1316 725 1370 851 912 257 1340 159 82 310 452 979 1096 776 792 762 269 115 1335 81 591 1347 558 941 1167 343 853 1137 956 1121 871 865 1237 75 176 396 741 1009 31 346 103 391 126 779 1080 325 1078 92 478 1239 749 1219 419 1021 727 417 96 372 573 1098 1207 1059 141 395 155 401 227 640 996 1077 671 1329 407 1303 434 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 172
]
wts 2: 655 770 1337 413 235 1057 1246 710 867 120 735 581 846 296 188 420 919 491 990 213 764 643 924 475 160 551 1189 1022 364 126 367 24 1158 1360 402 329 592 922 1258 315 1325 86 755 1171 163 852 553 100 265 856 840 901 1297 202 195 380 654 250 1191 404 1314 201 728 761 127 514 1097 480 150 159 708 358 999 394 898 613 426 624 319 36 82 812 484 463 939 1088 280 1315 808 1103 820 349 639 804 448 353 959 506 490 53 638 1063 1310 1066 48 1108 918 725 555 1017 9 131 68 245 1296 1234 951 309 865 944 1244 44 809 1199 1010 1016 1147 851 138 790 684 966 57 34 1169 419 1321 80 464 1378 5 691 13 569 1257 1346 62 546 608 55 771 1373 200 79 798 110 140 842 1371 1111 314 933 892 850 1155 855 1241 1278 727 66 623 238 499 1230 175 1089 1188 447 340 1317 1181 59 196 1142 1012 866 69 562 1087 168 359 632 824 1248 176 136 396 692 1003 96 571 251 1124 457 471 557 286 1256 967 1164 2 375 1084 141 158 768 995 661 458 130 460 1106 1236 38 517 1032 1175 688 1144 7 996 1228 1054 884 509 913 1095 90 1259 377 597 1223 532 49 810 720 412 1302 1367 229 192 737 806 834 3 550 1225 341 859 1307 989 1204 1172 914 504 524 765 953 162 1380 601 1033 539 741 256 101 1369 422 1043 1005 148 1238 662 406 360 1143 897 988 392 239 76 242 818 453 182 541 1015 255 1187 1031 649 39 1290 899 1330 84 982 1014 528 872 713 669 93 1269 535 1024 671 1185 631 1319 199 300 228 1195 347 719 795 604 395 325 1170 508 1221 1229 928 676 1153 170 205 599 181 1011 843 1019 682 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 173
]
wts 2: 759 210 1132 1023 1356 612 569 942 297 666 1244 1292 427 1085 1142 1127 214 929 31 442 539 508 1321 198 371 748 1333 806 104 1224 717 379 609 49 1208 545 1160 466 957 76 973 446 530 120 487 713 658 557 1282 202 64 998 868 1371 502 686 567 645 1204 1217 606 879 1301 898 756 234 1313 976 894 1003 596 228 1295 1026 1375 1093 420 757 716 1347 329 849 1238 698 1165 497 454 1297 57 616 1167 247 495 1358 1088 197 834 526 33 165 343 1155 1318 807 886 1110 917 822 720 301 257 1372 288 1353 1133 94 474 688 283 1147 781 412 624 1180 136 1060 1047 1343 200 189 217 216 404 889 144 243 71 797 712 870 604 1327 1145 836 690 652 438 331 1255 1055 515 1108 471 34 1113 941 1013 812 1083 1063 2 613 1319 320 1258 835 175 1193 691 294 1304 794 778 588 746 21 570 1138 1263 1112 956 26 128 639 356 944 1273 521 772 195 154 885 1250 1065 573 966 1310 1009 819 493 313 296 457 572 1276 565 416 266 68 1095 983 130 795 656 307 142 700 1289 1249 360 1140 1044 857 1014 230 65 842 513 632 913 115 127 1264 642 1336 121 48 628 97 1200 5 1299 1306 1052 1022 1072 891 428 386 390 426 143 536 651 608 1248 274 380 174 133 62 533 249 832 1357 118 140 1360 614 291 169 1315 170 67 990 319 90 671 375 187 422 156 760 312 586 201 491 1215 1005 551 1229 695 560 735 116 662 265 443 451 286 989 839 1172 726 58 619 676 1271 503 745 23 597 1334 775 959 654 670 967 1320 1206 24 724 754 899 814 1279 895 830 440 660 8 245 1001 46 1178 1123 499 655 650 631 538 463 450 107 1230 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 174
]
wts 2: 672 5 454 1253 260 771 1155 793 320 16 245 505 173 1372 673 1077 30 655 430 1339 1008 570 794 77 834 344 109 228 783 36 211 62 138 338 458 719 535 188 323 1084 964 643 1311 1237 1172 1166 478 520 203 747 1176 272 623 209 1333 616 1170 885 593 71 165 939 1151 1067 331 480 289 688 587 1272 588 814 1082 736 227 948 287 1251 1124 1207 1343 388 1240 807 638 1216 1312 698 1346 1257 183 889 453 1182 1267 1204 686 65 971 662 339 248 951 187 475 1022 1190 49 1092 947 1059 487 306 467 914 1314 1276 175 511 208 401 996 41 763 345 998 1048 984 1349 382 578 1362 283 1284 596 981 1271 869 1094 291 863 1135 953 923 539 11 1078 286 369 1221 333 314 15 134 674 1189 1219 789 19 969 665 70 111 579 701 1263 543 1205 488 670 1379 444 101 83 844 890 1371 828 225 1308 726 337 28 1301 1187 645 1024 625 268 906 634 572 119 756 346 711 1005 259 766 1378 428 909 778 581 968 410 615 1174 1177 944 142 432 764 1323 271 1042 120 925 1201 1320 303 171 689 1285 855 246 464 806 288 474 1023 1319 1270 1091 389 249 1245 375 55 1295 362 217 992 1055 1340 1293 692 465 945 639 376 565 298 1108 1058 1264 1065 406 784 1288 949 1088 666 415 1139 791 1211 1158 589 186 1281 1111 760 436 687 725 742 804 952 390 312 112 124 156 210 901 1209 1203 1173 158 1090 39 50 934 773 729 457 1099 963 353 594 90 1238 513 612 1365 600 21 1232 755 848 218 18 1332 340 236 1127 566 420 796 970 705 278 1305 371 1049 178 1286 563 608 184 285 318 653 1197 941 1072 137 744 402 91 649 499 223 1054 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 175
]
wts 2: 875 830 1146 197 129 1256 78 484 1238 46 1104 215 403 899 1152 806 883 999 1299 508 337 1032 1074 1043 112 599 1133 1311 1286 711 1329 636 581 803 907 749 1142 226 1307 47 1013 1213 446 459 207 858 1174 309 391 1165 383 436 306 1252 676 633 276 106 277 444 40 1352 291 354 712 1275 942 533 831 67 657 408 1320 817 406 30 1076 434 425 1111 1016 1065 792 170 860 1356 205 1221 743 710 133 199 975 672 1034 1321 733 1270 1284 1083 472 123 642 632 1038 1126 375 1115 294 490 1021 970 1139 1199 413 962 267 776 1239 906 998 737 72 1336 95 706 1113 927 1164 740 353 62 659 582 343 1278 784 1338 748 1154 760 732 781 1114 1304 12 1305 949 1248 1060 853 15 1140 1281 848 1129 573 1233 777 115 1222 534 537 423 648 649 236 847 796 23 447 370 535 1079 611 1370 1357 71 1120 662 210 854 1366 407 1055 915 55 275 1265 412 269 902 162 771 1181 273 646 311 172 1116 32 545 1380 1276 939 1255 1211 859 1230 144 1285 185 719 513 651 37 976 1360 195 1026 371 1170 298 223 1333 547 356 397 820 730 189 1045 1348 551 255 1063 1177 358 1081 362 937 295 506 960 647 635 96 997 750 829 102 1182 1009 957 941 489 1110 235 25 951 953 1001 1292 628 16 238 214 357 701 603 14 990 156 679 946 92 926 1205 86 1160 1014 572 881 90 341 1109 300 143 1289 64 1312 54 1000 452 1228 1331 1149 429 564 435 1157 1294 1316 483 1335 482 1216 1091 751 901 1301 485 589 1347 265 1020 938 328 585 980 863 1262 685 212 944 699 571 1310 1051 322 1144 393 764 303 411 600 178 797 36 224 1330 52 925 971 302 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 176
]
wts 2: 695 1370 814 1202 442 8 1149 736 447 953 392 1059 360 373 849 201 1213 819 939 1303 169 1026 34 84 968 781 26 1201 315 600 970 253 991 162 349 459 667 72 1231 974 511 932 300 938 1146 989 202 54 763 721 152 578 319 758 994 294 822 178 1132 987 3 687 1074 1271 1001 1198 1197 812 2 1128 876 1006 490 1335 138 515 1307 643 1237 698 267 284 1279 969 757 1082 585 850 280 1022 139 259 443 604 408 865 496 140 862 1351 537 838 853 844 1161 141 866 1310 155 213 791 111 1147 1243 290 374 811 1094 272 893 780 577 1306 665 1225 1328 805 1125 221 403 606 80 940 992 1317 935 15 980 527 649 835 1015 166 126 1130 249 305 1032 668 512 376 425 1241 1263 1214 631 363 368 1267 236 957 851 232 745 894 91 1342 222 659 324 518 824 400 314 759 1009 1299 818 861 240 346 1300 1371 488 1194 741 883 719 566 1193 1203 701 1127 1064 837 389 859 882 998 134 619 1298 559 1365 97 279 961 1363 1277 14 913 210 1261 343 248 186 1044 1219 1156 1092 979 200 986 997 671 440 212 1331 1179 1102 1284 504 630 608 664 666 887 184 1324 1292 561 1110 183 564 525 505 119 884 1287 1366 747 78 1037 433 544 680 1035 456 603 347 1167 489 1316 1321 129 93 1104 712 636 739 1315 1005 416 276 1012 825 1052 395 325 182 1174 17 1313 778 318 1143 71 702 767 177 323 563 73 1089 743 541 130 448 1322 1249 637 438 226 833 916 450 375 381 1088 1297 732 158 1145 951 65 594 478 1138 313 306 317 326 678 554 532 1152 706 860 180 756 709 131 257 466 1326 1244 207 1229 963 845 612 13 194 223 1036 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 177
]
wts 2: 242 1371 1107 590 1157 422 1161 104 894 333 1034 1045 990 932 1220 260 1312 1280 942 738 625 644 1253 448 373 1175 721 329 874 1193 304 549 557 67 629 895 123 1309 301 339 214 950 706 923 334 407 994 913 161 85 259 77 527 299 1071 844 383 928 1303 1250 831 26 1186 97 419 558 453 943 889 191 279 667 969 676 208 488 937 1084 905 423 814 1365 82 1152 666 178 94 384 1275 401 1234 648 964 134 1151 1017 591 1236 1103 637 792 647 16 865 1308 827 11 1121 825 609 1013 70 680 936 473 129 924 930 1052 610 1296 294 1130 999 247 973 25 1099 287 866 376 305 545 43 1143 1281 919 1251 851 809 306 717 340 584 320 1345 747 677 694 1299 217 743 867 1347 1115 701 518 617 614 573 1336 73 4 137 46 764 141 262 745 884 1022 1358 190 714 1097 1332 634 849 754 1354 398 561 397 501 790 17 791 727 638 195 1087 1216 526 246 185 759 834 312 1102 1356 728 1153 492 228 1361 992 1173 991 664 640 615 269 1286 585 318 798 695 372 815 891 487 352 959 567 1053 359 44 779 1302 1257 1364 639 736 911 113 1265 1240 877 482 760 1263 1268 31 1179 348 823 101 1 957 1278 681 199 336 1288 1050 633 530 212 1368 687 166 172 1033 534 970 938 213 106 926 462 371 912 996 241 879 774 445 1120 49 386 920 88 537 145 479 1329 503 221 215 1062 768 881 480 917 75 1210 870 746 1166 39 945 290 821 68 357 872 808 528 1030 1205 925 546 1355 869 599 223 689 1230 941 393 828 607 400 784 1055 346 802 985 40 1360 426 147 560 277 1083 673 682 465 173 529 176 219 510 408 783 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 178
]
wts 2: 156 362 347 1130 321 283 499 254 1244 1018 45 1250 1091 645 565 552 412 1155 93 312 696 1096 585 1139 982 28 361 795 855 119 73 1256 77 1103 647 89 1353 76 810 752 229 967 1140 742 767 373 776 1114 1345 977 1307 1366 407 1224 507 1270 307 641 859 387 1236 963 864 1373 611 13 1190 276 768 623 264 110 1064 1216 905 100 244 469 653 784 197 47 143 852 291 436 217 1339 49 807 1219 182 891 881 672 21 605 177 715 1088 1380 972 42 854 794 1101 600 1267 1027 1228 1204 1309 713 19 150 1248 947 63 376 290 728 118 342 1174 1152 220 1350 603 599 269 1295 700 899 127 97 925 788 721 1351 441 1065 941 23 587 355 132 431 1242 853 1125 580 1131 592 1378 870 898 147 1118 22 923 842 1306 1044 960 329 454 30 993 1135 710 1206 1301 862 286 1245 255 1095 164 1072 909 888 418 171 809 1084 903 1169 1344 638 846 1348 1328 1226 80 9 185 451 1063 740 829 540 1113 394 466 1299 1260 1017 282 227 1053 1276 1045 1157 506 735 529 501 432 1355 162 122 81 1156 845 702 35 130 1003 1337 589 824 155 253 209 1274 417 34 1237 1181 91 1023 211 980 990 198 908 1081 348 26 669 1108 1262 473 8 335 635 79 65 1013 831 1240 959 652 43 294 949 265 461 205 867 271 199 1282 882 262 922 40 901 1187 511 50 708 971 1009 261 699 737 1040 1110 210 39 249 798 273 1222 931 1369 736 1178 1085 936 684 242 487 397 415 986 272 359 1319 165 545 117 1059 1171 5 1241 96 243 744 315 730 1049 659 687 1264 284 1229 1285 682 159 756 833 998 429 1310 958 624 934 1000 1208 894 250 754 1161 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 179
]
wts 2: 32 66 773 187 273 951 1327 944 313 1316 1258 471 992 1038 48 1226 795 1346 806 1076 967 486 3 401 719 228 158 499 1357 443 528 535 440 1341 827 676 876 356 1282 632 1002 1329 794 984 1144 1231 1054 361 254 297 1320 1306 1139 489 695 83 157 1206 642 1334 92 169 324 892 1254 585 2 620 1332 125 616 801 45 1112 322 1150 948 667 46 1129 544 416 641 1130 741 106 1012 1339 205 852 1051 1191 27 709 683 920 916 953 1175 932 29 147 140 233 132 501 730 725 269 1182 96 389 276 779 371 728 612 1058 1232 838 703 34 925 859 1247 643 578 364 206 834 262 1350 28 1272 1070 934 726 524 649 301 103 1165 1198 1082 403 989 910 1078 883 785 35 1365 1007 1302 1356 745 588 670 236 602 908 308 833 969 1275 299 433 765 915 652 628 819 1230 886 777 1319 1238 473 1188 343 71 329 1376 1072 31 387 732 1046 970 398 539 638 713 1149 756 931 1213 38 341 781 735 711 1313 721 40 1280 851 1310 893 1273 350 1243 212 875 991 363 454 90 1043 1199 1266 605 202 762 988 1057 185 604 1079 571 446 422 1196 835 110 619 419 1287 912 461 82 956 52 630 268 277 375 19 1366 789 902 927 222 526 1189 693 235 871 72 342 238 716 938 314 1061 905 124 738 1088 868 1361 275 217 822 986 573 467 911 518 316 1146 1379 390 168 532 1269 1210 284 662 626 345 1065 790 1138 404 149 1171 542 478 199 748 550 853 287 759 172 879 37 1354 1140 10 731 170 123 144 1110 862 173 502 577 1097 1156 490 922 949 906 601 515 774 395 581 943 12 809 431 985 1212 421 189 259 924 5 978 973 61 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 180
]
wts 2: 874 147 1357 1373 514 260 333 1329 22 646 1186 271 1059 716 930 131 446 678 486 1025 255 1232 729 1039 90 38 1371 112 887 868 508 589 62 331 1351 290 242 1184 156 1206 550 258 586 625 228 859 60 1251 1201 992 1159 1024 840 694 530 1113 728 583 500 1324 199 186 853 744 507 843 688 182 1265 310 1270 275 816 561 741 856 1298 490 485 82 960 1363 29 416 1067 1014 284 629 1132 412 97 343 391 1096 633 83 623 719 123 799 771 642 397 626 102 968 1183 225 52 406 76 469 128 358 56 1092 913 745 1138 808 491 748 977 1376 786 540 1295 205 585 191 1315 809 676 704 1029 1050 117 600 557 1284 479 299 784 105 307 693 1126 13 733 978 1271 1213 1244 1278 896 241 934 523 57 1009 532 9 1368 256 705 807 944 987 1090 85 598 732 776 781 179 643 1247 53 830 1017 459 979 850 272 306 1016 295 355 1236 7 252 489 1148 544 136 360 517 382 835 451 1335 1037 92 1288 1071 1303 497 1046 654 276 883 72 555 33 475 955 219 578 1157 739 51 690 985 785 467 861 149 36 362 193 560 909 891 1038 751 606 1065 875 201 368 11 401 764 399 374 796 139 1066 1169 8 63 1011 970 640 1349 997 262 1128 121 920 404 939 435 296 685 1287 742 1214 468 1222 268 811 1273 709 1062 1225 773 390 473 450 381 1338 837 1352 44 852 144 849 116 940 899 1162 904 1155 779 239 1306 1061 363 409 1028 322 213 1137 45 847 687 525 161 1008 108 445 661 93 1119 910 1063 154 783 264 1130 575 526 798 357 615 592 376 340 78 734 235 220 1304 14 124 1108 466 636 49 1010 1326 43 1308 1374 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 181
]
wts 2: 1043 1230 404 1224 1367 356 563 858 219 160 37 730 511 1212 153 935 419 179 351 11 712 1326 1104 84 957 580 155 1047 257 770 1247 629 764 543 134 912 1275 1199 695 939 759 658 453 492 499 1124 734 905 206 527 1252 270 313 462 1070 1249 487 495 221 32 1068 67 817 391 116 536 1241 245 861 465 371 235 127 907 92 479 1141 667 827 361 1322 807 14 353 1271 1351 718 43 1051 700 1238 853 510 5 742 983 497 4 1236 336 1120 473 50 726 513 650 10 555 338 154 1359 329 531 97 447 1260 25 1180 976 490 500 947 678 798 126 1240 1268 1216 1307 553 130 202 177 307 948 1296 1223 109 832 399 215 509 224 581 31 1081 850 501 23 611 522 717 1373 926 285 489 1030 1264 528 884 1277 1131 104 485 767 312 1233 603 204 537 532 1127 34 1375 1143 550 192 564 675 341 1283 1194 995 512 635 60 1323 1263 125 1138 1140 841 524 107 415 1360 614 322 1185 340 135 784 627 1075 1364 1195 295 646 444 782 347 1380 1217 737 217 207 977 866 19 975 979 704 1278 1116 720 1001 1357 752 771 1158 671 304 424 848 546 222 159 919 1341 1331 144 727 610 1133 15 923 486 200 33 108 1315 1312 1083 750 289 991 663 757 1245 933 1272 1169 1210 766 69 673 213 300 1050 1318 1155 377 255 984 1302 1214 137 789 539 1248 234 733 1256 1089 332 111 180 428 1374 615 1365 801 593 279 172 1058 602 1345 38 435 763 1352 588 317 762 365 1259 425 1099 594 1007 656 1269 1054 86 121 45 306 592 889 467 405 152 178 1349 364 1170 299 216 1017 1310 162 1117 597 868 639 972 302 1250 310 538 1314 725 1108 1192 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 182
]
wts 2: 224 794 1264 476 102 763 937 1228 1269 1210 292 1225 519 97 1180 1308 508 114 29 684 301 1190 156 480 828 1272 1339 741 399 979 1326 189 1230 607 756 312 226 310 671 541 70 1097 382 704 455 932 257 1242 71 665 750 821 131 175 209 454 1283 709 791 547 1293 265 632 211 326 283 865 15 267 776 952 1306 527 11 477 1143 451 187 1168 400 600 433 48 788 904 371 619 894 642 1038 1279 658 1056 623 588 523 259 652 574 976 685 1086 177 785 1197 203 184 356 425 647 1265 509 594 810 1000 662 953 723 1239 321 1256 804 59 351 464 1371 260 605 903 225 192 835 261 458 104 143 428 633 1130 653 73 1032 618 89 802 1322 891 562 95 9 965 303 23 555 777 1071 1009 1059 1094 411 1054 342 1291 993 1013 493 1243 590 21 584 651 902 981 715 870 1350 880 1213 868 128 171 951 808 295 36 105 500 907 84 842 510 858 1253 1148 1209 1188 512 782 130 610 613 538 602 360 275 531 1231 800 1217 1134 911 1046 264 1297 729 159 882 210 1338 1362 409 1178 1129 1311 1121 1215 1221 812 345 370 629 115 99 24 770 822 315 87 614 799 473 1029 826 931 498 243 120 284 365 1028 472 381 592 1140 1005 667 1025 732 309 1085 218 256 1066 154 1354 873 871 64 1304 628 889 1342 714 101 1068 1119 675 1074 1207 947 1062 19 145 1020 942 340 1332 581 1055 1363 1324 478 1128 846 205 793 239 1015 879 1186 1361 324 469 339 1152 116 569 798 388 992 1315 157 546 568 394 604 233 917 393 520 1233 81 1303 1289 278 1252 289 926 488 886 281 182 975 1364 347 280 660 689 737 1092 620 1135 1058 16 293 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 183
]
wts 2: 242 365 40 42 1138 575 1061 595 789 281 982 1353 1217 127 636 880 938 758 1038 628 544 1140 1136 584 256 1135 500 1131 206 146 1074 297 651 1344 289 543 1234 1064 209 922 213 1069 945 745 684 1145 581 85 1225 1304 1357 130 232 57 656 624 1264 617 332 1082 883 318 1222 240 364 162 974 986 1171 411 639 946 554 394 740 1163 329 806 1213 483 839 1011 503 238 812 457 643 670 24 87 951 22 683 915 1354 1170 989 1254 467 629 490 1106 664 1335 465 563 388 801 1042 577 1134 1168 453 495 339 227 330 864 1247 450 804 926 522 16 381 1122 38 1274 1065 560 1214 1154 1348 393 1080 1127 171 1129 321 1158 903 729 942 559 933 322 435 228 672 965 13 1073 145 825 720 881 755 1216 960 682 1046 1365 513 707 456 410 1139 183 950 1062 895 972 392 345 1195 1098 884 944 723 1356 867 1251 1252 1333 140 502 818 646 55 66 49 644 149 397 1000 586 335 150 530 1072 20 517 843 761 781 135 1175 1378 220 618 995 578 1167 315 284 185 473 603 1071 83 164 34 983 808 19 244 201 542 214 278 1162 236 492 216 568 1311 652 422 352 936 635 958 253 173 1324 905 62 68 719 1235 235 112 747 385 598 71 142 762 338 245 1189 1096 296 1246 851 1172 165 930 1089 1337 724 1181 896 118 1232 37 188 51 630 131 1364 911 247 606 89 1283 710 215 1299 671 1239 1221 770 1370 859 1026 539 1113 475 1058 688 1155 1137 1109 1318 1270 1173 621 1345 827 659 254 119 955 697 954 264 686 1031 886 1326 1033 444 497 133 273 430 637 1052 585 1303 1237 650 305 510 14 433 1197 290 980 274 537 904 279 442 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 184
]
wts 2: 312 950 604 772 806 1256 1333 1261 592 1183 298 875 1175 557 586 376 104 803 1296 707 1009 464 996 848 1108 584 470 52 767 552 787 854 117 332 57 559 832 287 387 1208 314 77 125 1123 1121 672 655 756 448 128 251 835 527 880 759 145 1110 933 700 501 677 1309 657 324 635 1251 634 1012 932 43 1048 416 161 411 870 1280 878 367 911 1337 452 1099 1139 236 664 430 1359 1159 1016 1185 44 788 941 1353 63 323 12 708 794 198 371 46 844 648 656 802 1230 1374 28 949 1298 342 1216 676 889 1229 1235 299 32 1210 471 182 951 611 1351 629 230 235 274 571 428 199 522 444 602 785 136 1244 1301 1068 455 668 640 132 431 243 518 1260 1101 94 216 402 1320 523 917 70 1057 372 354 270 284 311 48 441 427 1240 898 548 695 808 1115 457 393 1117 639 1302 998 1051 1295 1226 632 1177 680 412 388 1234 1006 328 1341 156 465 763 366 1027 519 513 3 606 663 578 994 481 419 21 1219 174 486 701 447 141 107 17 945 812 690 773 16 679 1217 343 637 91 585 133 353 861 51 499 514 1369 24 214 440 907 1275 539 1370 389 1265 433 163 400 717 1031 435 379 15 912 845 266 115 258 1327 1205 474 549 953 477 1307 524 902 20 1035 275 1294 956 488 774 406 582 590 876 1025 294 520 1218 816 1069 25 1127 473 422 638 194 496 985 930 1153 1191 479 1064 169 1227 745 612 54 238 1113 1187 82 851 981 409 1241 963 319 675 883 480 850 671 904 313 827 1167 217 222 746 988 272 317 1287 303 315 768 1330 239 1292 666 1024 150 1065 364 698 1118 112 23 407 195 1188 710 601 736 1254 798 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 185
]
wts 2: 1359 426 248 353 718 977 335 271 904 11 866 1052 59 973 1145 1378 161 858 258 181 196 439 342 1319 259 666 255 35 301 950 971 545 358 42 691 970 1239 735 633 915 952 1117 464 1054 187 788 91 1277 1024 948 227 986 1101 440 1267 256 645 285 44 1008 1354 1364 31 1202 761 291 758 1191 1213 164 672 551 729 756 254 703 524 566 985 1109 1379 471 1307 392 429 369 240 891 924 1252 515 704 687 394 1138 627 1152 455 45 1065 1240 650 391 1087 763 444 132 1022 405 723 698 954 499 961 363 898 696 1158 1179 219 14 931 732 323 854 784 606 1120 908 1184 466 996 733 128 1007 61 677 379 267 456 1042 345 19 63 298 114 794 92 914 1185 648 530 13 657 583 581 789 1102 859 414 331 236 105 73 494 938 804 521 725 1018 1100 831 528 98 1174 1019 71 1324 1009 346 655 1199 315 663 192 602 1082 1275 1051 1124 701 68 1088 594 1190 1223 1172 1215 565 36 1014 356 608 1295 878 1197 113 340 520 276 362 106 320 1320 202 1321 509 129 284 517 714 368 1099 999 367 272 198 204 902 680 753 745 1327 378 1375 757 179 269 496 579 621 533 104 1127 782 1097 629 427 1265 700 607 844 513 1283 907 976 682 1081 1071 357 1021 730 713 863 1089 1155 81 810 1144 724 1200 17 387 773 1064 1365 1061 913 263 148 274 373 23 1336 710 1284 739 526 802 1369 1234 476 771 299 946 600 775 919 1025 401 229 671 403 280 424 772 1233 1272 741 1370 644 921 1047 967 408 634 451 1317 366 1072 212 470 127 454 880 1003 286 1216 806 689 1170 9 398 34 928 413 249 1139 41 150 409 1048 339 717 1231 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 186
]
wts 2: 620 1039 31 370 627 911 988 675 842 410 733 1067 1210 294 396 719 909 130 1331 96 838 1020 1137 517 349 693 596 348 828 170 1351 1031 472 32 646 548 629 1224 1359 764 887 1360 48 598 560 1002 651 670 464 778 1238 1338 564 930 677 650 771 601 971 444 1048 878 882 226 333 1291 633 376 82 400 1202 311 83 320 1077 1215 841 123 1083 152 1084 563 844 729 1143 61 285 532 1049 275 1347 768 1130 200 119 1274 425 1066 873 1166 576 507 284 1007 264 252 676 734 706 779 155 969 159 697 151 465 11 1102 1047 505 826 1237 291 315 923 271 1119 963 940 12 1162 551 207 603 1108 386 1217 497 1000 1019 493 1312 949 261 836 1053 1318 954 503 469 258 221 997 178 710 490 901 775 391 1348 297 736 287 273 239 314 1345 773 1062 919 989 575 113 738 907 288 952 373 816 1150 1097 1250 1006 1219 589 180 1018 519 1248 964 418 740 1278 1372 164 199 1284 393 203 65 484 522 948 1169 332 763 72 881 97 9 478 1043 735 1152 727 46 1144 801 1155 1279 44 455 399 534 492 916 1163 1124 229 726 174 539 761 918 699 943 1300 683 991 925 1141 668 724 319 1157 648 1093 306 965 1071 765 1369 679 869 296 305 377 996 1172 1030 282 416 172 586 241 1226 352 1094 871 194 182 456 1050 133 609 537 495 1088 687 1220 798 747 552 1182 326 1014 1373 1057 150 1134 1186 417 1287 1295 1165 1321 53 1363 286 1241 453 1174 266 581 392 372 1211 1266 937 936 308 375 568 117 820 634 20 204 681 917 1361 662 674 1116 920 1027 1054 293 913 910 1192 25 799 439 508 934 479 972 19 473 1110 335 344 942 302 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 187
]
wts 2: 984 1167 428 439 6 543 23 407 546 1127 371 1179 1352 1374 1219 392 363 966 664 1255 490 1282 1365 876 266 799 485 1023 187 662 324 912 586 127 466 1332 30 978 648 1334 1096 1267 39 940 1253 479 1375 857 71 762 509 1209 867 943 1009 806 50 696 820 48 333 968 188 1249 670 1272 1302 653 861 647 508 785 625 1142 742 1200 19 20 1263 1256 992 641 1173 1298 959 795 124 270 445 1144 962 458 971 1028 982 549 558 1290 89 1008 284 836 910 1137 245 102 465 789 433 49 1239 519 895 215 547 286 999 277 981 619 293 837 296 769 78 592 1229 352 1112 138 1107 1084 533 532 355 1284 782 431 1074 523 765 725 374 404 621 810 314 55 1251 2 711 52 1199 28 1275 986 1377 160 1169 908 1042 205 193 337 567 673 79 336 1151 1301 817 551 1071 113 938 359 1055 1072 802 899 575 1015 298 948 34 630 1050 695 174 221 403 919 1259 214 32 427 868 1358 898 170 133 687 1120 751 690 198 176 1047 541 890 744 194 1277 1129 1180 1342 372 236 179 537 812 839 1104 671 877 175 63 272 993 1134 531 201 430 691 674 1210 873 148 593 440 464 659 822 1093 1333 510 1157 754 980 594 675 636 884 1220 386 768 253 990 131 821 1308 1109 1283 749 1355 529 724 1344 1152 1121 542 62 495 678 1262 477 707 287 844 17 209 37 105 829 525 712 756 620 303 81 1349 652 282 488 478 1225 376 1258 301 1372 191 1154 409 1299 676 248 93 1099 144 680 1085 230 471 833 925 720 603 1288 283 878 60 274 1062 285 1196 244 581 210 796 321 1257 1297 1037 761 764 571 76 369 1345 975 752 498 72 154 1131 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 188
]
wts 2: 68 927 699 275 53 450 936 1282 648 463 665 689 253 318 325 718 16 405 17 860 451 128 171 1034 1221 580 1046 900 832 666 327 996 505 836 51 111 54 751 676 1353 906 657 98 850 683 100 1326 71 132 579 292 742 777 1026 186 477 140 149 575 669 756 979 501 1048 1236 925 1370 1102 120 745 350 765 47 1015 889 495 309 562 688 722 1072 136 610 1252 556 1286 357 1162 182 1123 792 194 989 267 408 675 1081 768 687 181 269 1012 41 646 709 507 1172 165 655 266 992 719 942 625 752 924 155 492 328 296 1317 427 593 561 456 238 341 251 1223 1249 69 282 147 1025 364 239 121 559 204 643 531 806 875 867 1225 713 1313 145 1285 775 102 1244 549 1284 1129 781 1002 1039 84 1141 135 58 603 882 97 315 980 893 977 704 438 1355 759 905 1101 23 1160 219 420 664 99 1022 35 91 167 324 1175 319 730 215 527 587 715 1171 743 18 1056 479 93 1109 1093 1035 96 402 172 533 494 807 1071 846 334 635 772 1019 1241 902 1052 382 953 59 1087 871 969 707 77 434 199 1100 335 854 1023 569 959 895 33 1369 87 1084 391 442 159 223 1292 865 914 782 331 645 483 183 444 13 280 230 691 508 881 814 313 1074 536 212 958 1055 1202 374 773 209 600 180 95 1275 421 997 1320 930 1083 411 595 436 1158 127 184 1179 287 486 1125 766 8 29 170 213 636 431 462 550 459 919 36 856 682 1139 551 388 150 178 1338 503 731 848 985 474 679 1361 358 1076 1191 1330 75 207 946 1095 1192 298 56 744 73 1254 104 1112 918 1208 1253 1341 1137 1262 911 1091 1069 1145 1209 1228 294 248 1080 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 189
]
wts 2: 284 10 1218 285 745 705 220 1224 602 1352 1008 1342 451 1203 996 1037 165 1363 514 278 479 198 53 782 885 29 703 845 615 34 906 436 1229 307 636 1007 1278 826 70 64 87 1078 664 333 362 1261 199 577 665 1070 700 1253 122 835 1013 131 746 867 832 183 272 143 1124 527 454 1085 878 141 1001 929 365 237 1025 931 581 723 1069 888 544 524 672 887 1319 408 321 513 447 118 645 434 1328 1126 265 81 1366 1272 1192 659 557 630 663 519 933 777 308 1033 748 772 182 41 1304 1042 796 252 1275 892 221 386 1162 570 635 1279 276 65 585 384 169 1084 923 340 1135 899 1143 391 1365 1129 1091 232 207 644 992 840 790 1187 1269 104 629 263 351 499 646 1141 701 414 953 875 23 1346 52 55 299 1 1351 983 1188 69 1364 1308 993 952 116 458 459 1372 377 715 607 896 67 985 1133 1004 550 766 1223 203 244 694 955 914 486 776 127 315 314 795 111 140 415 6 218 467 229 305 928 399 656 168 601 653 854 628 587 139 28 603 1227 1240 774 470 1326 1103 971 429 450 704 520 348 698 807 925 685 547 1266 496 533 505 687 858 250 475 16 194 610 298 891 797 355 428 987 1358 407 193 918 372 370 1284 584 332 920 625 444 146 1244 947 969 502 110 247 668 1067 346 593 197 794 1075 803 1071 855 61 257 413 442 1299 1341 632 453 913 412 1291 338 256 360 115 433 1368 1345 59 1226 788 589 209 477 681 249 729 662 1225 1216 1234 282 921 301 1207 1260 551 1111 515 1353 606 1101 597 1274 403 743 1246 1173 1190 552 210 82 114 1139 1104 495 106 1095 633 837 717 235 1233 926 254 1209 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 190
]
wts 2: 391 179 217 415 1188 298 790 1315 152 869 459 911 708 1092 223 277 725 169 1258 1153 1375 199 194 531 877 996 59 945 1084 98 1169 191 524 400 1170 1099 989 1069 1329 134 835 1207 110 1298 709 721 642 353 799 532 319 818 1006 408 214 780 974 439 233 213 676 1176 672 1366 644 794 875 998 970 1212 873 719 1187 940 253 733 832 215 12 1215 1164 1307 564 572 1090 1275 980 1253 789 527 710 1281 225 1180 776 1202 590 562 809 1331 516 452 1033 235 178 917 173 983 1260 306 286 589 663 968 410 777 364 483 511 230 1076 1061 1132 1127 711 559 1002 689 66 302 1272 1371 839 883 144 1118 1265 299 517 1142 879 1117 256 948 1171 1223 1296 254 1248 646 1288 882 1079 343 1175 7 629 315 764 1193 1350 1011 1051 430 1210 943 115 683 1151 211 682 960 1269 109 687 338 334 61 86 237 817 82 309 1181 1052 258 946 551 1021 190 249 257 58 1257 94 872 404 367 993 571 15 385 384 77 131 401 287 896 378 1028 41 1128 1358 743 823 979 1346 405 888 412 1241 1224 512 698 735 310 1322 840 1005 317 480 1295 494 533 201 25 351 865 135 1030 102 198 125 54 1266 1100 344 1108 736 95 565 583 1035 216 157 1302 141 578 950 10 1133 778 685 853 965 1287 859 1218 296 1213 588 92 627 876 18 1348 1294 129 990 706 43 83 967 149 1111 274 84 39 227 757 543 992 730 145 569 158 239 1182 508 374 212 241 1145 782 1195 997 350 1270 417 162 1196 662 111 266 595 966 690 492 337 37 722 905 910 120 1104 72 208 938 851 1019 1160 336 345 597 96 99 621 276 1003 103 915 657 501 688 972 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 191
]
wts 2: 149 604 274 64 703 497 975 914 574 171 1147 1146 899 977 172 693 1099 556 1174 127 310 351 1320 1069 1304 601 1126 557 480 1132 764 722 671 138 233 1362 54 41 653 507 602 1059 71 958 1328 1137 136 1097 1135 1348 288 112 207 1078 1092 176 791 39 600 965 97 14 623 705 388 877 1169 386 560 878 319 398 711 893 469 774 634 695 1152 1119 577 620 98 752 1202 991 517 413 422 503 241 715 1116 606 969 621 165 1243 192 471 990 47 1231 343 1133 1302 1060 303 614 664 967 1375 942 26 341 489 454 1054 499 1288 99 311 132 1103 1189 539 928 950 803 1247 65 728 834 1260 191 1072 60 13 930 1342 304 200 1083 48 1124 742 1307 1168 812 543 1313 618 963 179 706 458 1075 522 628 569 78 1180 455 286 726 941 770 610 962 6 488 699 894 1067 900 576 534 255 815 513 1085 1173 1319 68 337 301 1139 919 116 355 1195 1153 844 782 401 258 1209 1365 784 1134 128 827 1333 384 465 1019 1127 150 979 519 147 402 984 450 115 732 559 361 1163 747 412 354 96 358 437 195 431 596 415 335 245 572 124 613 283 282 561 1128 1360 163 1377 828 438 649 332 1278 746 829 119 1048 101 117 660 737 1371 954 356 1257 579 170 783 835 1279 418 315 800 1142 1052 160 876 188 82 344 1206 822 775 1053 467 1061 220 281 902 1058 1355 447 619 1032 100 264 206 523 178 110 367 23 883 786 540 765 1040 945 1045 656 137 627 1027 514 1056 631 225 1232 1343 1284 687 212 254 1035 238 185 743 855 1117 725 249 140 591 530 1358 490 237 205 987 709 792 1192 1336 250 231 1298 19 567 1063 943 741 667 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 192
]
wts 2: 1095 1190 1074 839 651 457 337 389 42 484 827 939 808 1029 1045 1123 199 935 145 734 1361 715 374 1173 188 700 253 494 181 698 250 908 51 236 776 1230 666 412 398 545 726 1267 725 652 421 1342 431 60 1076 62 1301 958 468 901 779 355 933 136 140 823 204 976 1176 991 1066 793 19 179 846 1303 1219 943 1067 263 99 667 1098 262 309 1043 1051 84 50 881 1375 154 440 275 703 88 1273 1331 593 61 345 327 730 664 732 388 553 821 1240 1237 1319 1007 481 1247 22 350 714 294 1073 1162 1213 1117 225 1200 1302 760 778 81 542 469 583 15 1153 861 1294 1139 79 328 1308 1091 438 56 561 551 1030 217 681 1132 1024 351 998 1077 283 727 728 341 361 1199 146 1293 1107 579 287 90 1353 127 149 48 1218 463 12 1005 1312 929 493 218 720 1193 1087 1157 830 526 1216 1244 41 135 581 1159 599 106 747 501 200 258 524 175 557 386 889 882 232 260 705 1105 685 1355 1223 137 234 212 635 765 67 305 318 696 488 1306 1260 890 52 1357 1249 884 646 910 1368 364 352 540 814 435 541 1000 439 1281 744 324 399 1352 818 570 683 609 490 401 1226 921 116 1196 672 125 1022 299 448 869 286 276 178 1120 298 509 157 495 548 1367 141 994 1023 911 369 949 713 1140 854 1108 515 1127 368 1265 2 731 1316 112 1228 782 202 1126 762 27 834 94 160 407 721 1143 751 1239 121 880 1027 865 1110 804 1360 909 9 891 699 1183 883 210 1202 115 363 1060 877 931 614 539 564 366 197 310 853 625 677 896 554 562 1063 522 71 875 1198 323 467 1317 470 702 709 893 1167 452 1253 915 742 73 567 689 46 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 193
]
wts 2: 369 496 184 878 1209 362 1012 1114 1196 692 601 1223 1248 1049 426 852 702 728 1194 1307 595 829 1229 56 202 351 535 221 663 787 1175 432 553 623 1287 799 1247 14 1079 876 1026 459 13 358 680 168 356 785 38 486 1145 391 116 1178 936 839 1344 969 499 276 1225 567 330 653 1364 1197 751 898 138 141 1140 962 1214 882 1207 126 80 383 124 1348 68 908 1108 558 634 1361 1171 894 874 1014 947 760 837 921 972 498 1326 246 19 910 1220 232 176 628 1195 853 301 214 830 470 88 1098 919 1040 457 743 125 405 1115 63 49 757 189 481 770 110 841 662 1046 1255 25 474 217 1372 1061 15 831 1149 1138 828 434 603 1271 382 1016 1045 873 10 1252 938 1291 516 589 237 1047 91 1337 903 585 794 1097 1032 1375 96 285 997 931 1168 108 996 1294 617 297 964 37 868 920 984 423 478 334 2 1104 1166 1030 1293 361 599 817 1322 1127 733 754 652 1162 1318 502 1116 949 1170 144 299 1274 1212 1010 734 275 564 54 893 186 783 1082 350 602 867 646 581 149 451 291 952 1093 185 236 961 147 366 207 557 260 1088 394 419 420 151 250 1245 74 592 319 444 590 412 353 1300 1359 530 1314 598 895 821 1241 1265 166 845 1251 890 1000 48 500 511 430 413 252 1239 1020 985 649 249 1270 215 438 1240 591 52 740 1341 695 1133 31 1283 684 70 942 769 1350 521 883 263 528 1188 706 1084 3 906 233 1343 1281 1054 875 584 327 1222 1317 983 666 748 1013 523 913 339 135 224 73 1253 526 208 566 12 716 791 1080 739 869 605 1076 114 310 758 160 205 1112 368 811 118 909 1211 1095 696 796 547 1017 800 1331 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 194
]
wts 2: 1079 634 692 853 490 1312 131 186 1014 209 650 795 1087 698 1212 172 920 224 13 1107 554 1338 370 714 320 59 1094 76 443 922 40 70 630 844 740 499 588 752 393 670 53 569 1244 1170 241 46 291 1160 1129 187 1286 652 1054 448 801 506 793 257 660 882 563 1165 339 1188 1138 449 1290 1019 1343 1231 269 760 1326 654 845 450 877 233 942 914 297 827 1152 183 428 63 1084 218 295 1259 794 724 711 545 1052 579 487 1220 675 1071 1046 122 1159 466 356 1127 1105 388 805 483 1132 1285 1192 1363 631 541 1157 392 1161 750 290 663 635 544 673 998 661 620 1355 1315 599 171 1082 823 379 1178 129 48 1189 1135 1340 144 864 202 163 1109 1276 345 1356 402 1121 953 971 1226 1350 135 653 327 1230 378 334 1247 786 185 1370 1015 1095 497 292 943 856 931 1049 662 1266 32 715 151 677 1033 1058 1137 839 181 193 173 1297 91 96 892 764 380 719 1282 1069 1041 31 966 101 86 574 1175 557 344 537 646 1233 1287 1359 718 516 253 415 746 1320 340 1194 553 788 480 780 680 1299 825 915 178 349 1213 243 860 538 1010 721 612 50 816 1006 1361 833 1274 1180 792 1108 284 95 781 802 1261 1257 222 357 1221 674 757 609 465 1123 824 1066 1143 1018 649 591 1005 471 624 71 736 52 938 1372 228 600 99 430 1037 168 847 330 136 665 734 496 618 671 1185 580 888 346 1250 898 896 552 300 254 596 1319 685 749 522 566 539 770 277 272 723 335 767 4 994 421 972 738 502 420 1330 1074 7 1366 643 1262 894 472 1224 457 433 1369 722 23 526 111 114 616 977 713 606 659 1118 787 1203 729 161 152 1080 1232 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 195
]
wts 2: 1255 967 358 473 383 823 539 1376 417 1223 203 1056 668 1000 1195 696 422 365 2 933 573 1010 1224 440 410 446 878 1202 453 405 862 30 970 1210 292 1220 1236 1114 1148 356 319 418 142 884 888 476 520 1324 1226 1307 41 964 451 1271 1125 284 1215 435 1160 685 1283 442 57 1073 981 1263 810 389 364 1350 371 961 100 1179 1098 907 491 889 427 490 781 99 1241 138 1129 1175 989 1183 375 598 694 1192 285 1321 808 46 59 36 831 19 927 974 919 488 803 133 288 792 588 1177 756 847 101 537 604 632 626 89 634 1067 1009 480 205 1375 544 1111 232 913 1063 931 978 533 1012 376 164 1126 1115 788 735 828 137 619 579 574 641 759 600 77 1057 1344 55 1091 1028 27 1141 280 24 980 44 647 266 1360 1330 643 1346 732 206 263 176 1274 649 1001 894 932 150 355 425 572 342 236 551 895 6 518 165 1277 1336 771 955 123 1180 864 1166 511 461 833 1069 1345 1275 307 966 1261 382 387 596 1212 799 53 377 296 1187 278 1229 1221 855 400 91 805 1128 558 743 452 625 646 879 638 1234 420 475 825 227 1117 1235 953 785 1278 769 1247 786 987 1076 1103 672 349 1343 1225 787 158 496 152 274 169 1368 669 283 484 577 253 242 1170 357 734 40 388 67 959 1340 608 800 42 842 777 867 1132 120 182 111 469 773 489 144 941 1198 1231 954 468 1049 149 257 1039 249 615 1112 18 265 1323 710 207 404 305 677 199 691 148 1133 210 642 917 524 337 395 246 186 344 258 916 51 215 1244 697 1279 730 1347 562 1243 1122 331 617 521 64 1190 550 1065 1314 912 54 1258 1260 1238 1173 218 1 104 437 560 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 196
]
wts 2: 1340 377 811 1001 975 718 901 1311 808 673 961 920 1368 1371 753 651 1357 1048 667 917 682 793 989 381 1126 25 1180 752 52 566 1338 366 254 1244 1110 394 587 286 734 284 893 689 1267 153 507 278 767 274 1116 182 1217 348 422 1007 773 702 1221 740 1064 1325 178 1306 1289 741 1349 54 875 772 627 131 935 835 751 579 1045 529 742 272 201 415 334 590 318 200 497 568 615 985 301 1232 478 395 1039 969 220 481 937 167 1208 931 990 430 306 26 700 1235 5 24 1059 918 458 1362 119 1366 626 66 665 154 448 184 398 32 675 695 340 142 764 630 13 469 92 943 293 1249 400 363 669 84 1000 402 1214 204 652 1158 268 1367 120 686 28 745 836 217 133 162 870 1295 731 728 1125 647 239 205 640 347 806 335 242 1144 279 324 1055 1004 664 1379 594 1365 333 413 158 209 227 309 31 1060 860 736 1312 6 1070 1259 42 194 1274 1291 114 882 1224 746 482 801 1066 685 58 344 183 95 1015 1238 1166 1316 1215 941 769 866 12 819 973 1157 750 1065 444 921 776 1053 410 499 118 761 946 1315 888 1020 229 1331 249 1313 763 166 252 637 1114 33 1011 85 1033 780 730 1160 1026 417 230 633 69 1309 1105 958 786 727 277 337 123 208 1132 465 1278 438 496 401 847 3 927 221 300 708 233 1098 1123 14 1152 1093 20 509 102 895 720 550 332 1179 770 280 983 1081 1333 351 2 1292 999 824 810 181 1137 453 223 508 1285 688 570 1257 1063 864 672 1092 441 898 307 1003 1030 546 617 1364 1323 72 452 406 881 582 1318 436 71 263 1290 1178 696 1346 81 1234 464 671 586 434 523 792 359 1135 754 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 197
]
wts 2: 389 9 982 1164 347 256 241 1130 53 849 620 750 49 584 1168 930 659 1236 824 614 1219 789 487 872 1083 409 1334 289 505 1071 10 677 1019 940 160 993 129 688 1285 625 1259 184 1122 795 1017 1032 1373 645 1031 577 910 743 1366 575 416 56 1305 772 1252 662 246 17 161 898 428 951 959 736 870 458 781 646 1011 583 639 941 938 1322 1 1021 682 855 570 297 88 1134 1006 587 1346 448 896 1018 796 36 503 1026 1256 522 971 983 154 365 500 624 134 907 457 695 1270 576 964 779 269 429 928 450 533 251 1176 456 1361 1144 891 979 915 57 1160 1037 825 1295 696 120 1065 446 1049 641 820 660 415 726 439 600 560 702 909 642 1352 1272 111 787 1005 973 204 626 58 512 931 132 771 818 871 1191 1243 895 1047 286 1280 474 1337 693 133 974 1247 599 844 354 170 621 1255 381 980 194 5 1221 1238 582 555 224 1163 61 550 215 311 756 567 1041 199 1376 997 125 435 288 207 630 1002 460 1151 969 1175 306 523 143 250 633 708 581 651 792 833 1143 276 847 459 14 492 934 213 1059 671 1220 1139 1234 894 850 25 916 74 1343 1186 578 1121 678 1004 476 13 1233 397 1173 44 317 1235 333 368 566 1080 20 1029 747 1055 38 165 1162 858 23 675 292 105 541 879 956 905 452 526 424 279 731 227 647 18 801 3 1001 1370 605 52 867 85 235 1301 657 1069 749 690 471 221 1302 77 281 908 615 166 497 632 977 406 496 229 33 759 679 1324 233 788 1023 491 1137 1091 735 1318 198 1294 813 1364 802 371 1185 272 308 538 1267 717 315 244 563 280 1371 463 335 157 758 470 232 697 1136 195 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 198
]
wts 2: 143 571 591 57 3 531 258 724 630 27 1370 1111 567 102 751 423 1123 847 76 161 993 1149 15 763 995 1340 505 614 372 769 1000 152 779 795 1038 1024 1140 665 1208 81 758 291 421 882 1054 646 783 418 582 836 16 392 1061 467 301 941 1354 580 1158 1236 530 168 209 391 427 55 764 440 1364 456 369 1216 1310 1265 1081 190 38 861 1298 929 650 636 136 199 826 657 747 1030 968 181 305 966 980 1308 925 307 1379 1280 1025 17 1162 108 246 131 767 482 205 1090 355 819 1304 328 11 167 1356 315 326 757 626 1263 963 1011 377 561 765 395 1154 274 1070 673 360 1252 638 732 40 443 899 1197 721 824 454 86 812 177 811 1046 170 718 1287 1327 1200 1268 1133 632 1230 534 484 367 148 109 855 83 961 1260 1088 806 948 1118 12 627 211 1153 1008 213 970 1071 64 1313 891 228 336 175 1139 666 1235 1224 746 1210 1223 1351 692 1066 1359 1036 788 1103 151 1261 1104 475 827 276 1007 1068 879 1137 501 286 974 862 343 186 1314 293 1207 496 319 129 1322 147 802 1251 50 54 1019 978 1227 1365 573 277 919 84 124 1195 660 381 1121 719 1170 235 1258 466 318 410 1371 1353 1056 771 1357 1043 903 313 312 160 921 1334 843 663 242 159 264 349 943 353 1105 543 194 809 816 846 87 998 1004 59 872 459 958 340 693 600 1380 431 1032 967 659 1012 762 469 574 730 37 586 1283 82 46 1339 726 926 785 204 172 1006 94 144 1156 29 1372 173 828 1041 964 512 1343 35 909 736 725 500 1152 218 624 686 884 598 178 254 814 550 364 640 18 361 822 63 115 227 1132 237 647 1330 549 556 1316 1148 184 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 199
]
wts 2: 1238 1376 381 927 632 48 1302 732 1195 55 469 1085 710 1223 7 97 167 198 169 21 1147 206 476 673 1071 534 996 259 1241 1314 782 880 923 490 393 1026 586 1131 714 609 86 464 977 253 1297 1003 472 229 1149 64 195 665 221 575 608 1174 603 1059 1123 226 153 65 1081 1183 720 145 69 959 284 935 133 1233 844 364 514 641 610 1054 257 1013 1341 212 140 1011 251 886 272 1129 1362 1245 278 794 677 1163 690 1375 1099 445 49 1094 478 672 143 1153 1281 1143 758 573 701 839 1250 1315 524 590 859 1193 902 191 570 1260 475 1356 1119 779 1225 905 1029 1253 289 734 1041 728 135 1371 396 552 417 797 1064 343 921 1276 752 1049 420 315 836 1158 267 805 141 179 105 1249 899 945 763 1065 156 1024 366 408 353 171 1187 1012 704 134 101 314 30 465 564 342 1305 937 454 824 907 14 1361 486 268 963 1263 202 807 1182 1139 1346 112 260 116 27 77 1286 114 1348 431 1299 904 991 131 770 1042 498 1338 954 1298 488 28 879 744 877 546 341 307 331 394 682 1001 318 149 144 1343 939 1122 983 826 299 1135 35 1210 502 969 1197 208 39 857 828 1308 510 840 874 553 1344 277 1047 1138 846 929 1354 781 441 1360 713 18 185 1345 1086 439 1272 189 948 631 375 93 17 500 1270 953 688 571 244 1214 232 1221 11 270 1070 1134 645 463 618 1191 184 378 1373 647 319 1171 452 356 757 900 223 891 293 1369 1242 981 142 962 62 1116 626 845 1273 614 1137 588 764 550 449 706 583 483 591 1294 731 551 368 350 767 644 1316 1342 637 520 1169 820 1226 94 31 165 925 584 816 234 471 993 1351 132 154 239 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;

[!
*Ratchet iteration 200
]
wts 2: 128 424 913 772 301 258 977 1305 963 399 947 501 523 574 724 905 336 1231 684 431 145 540 533 244 48 870 248 546 1343 871 413 805 180 441 282 1265 545 1292 1105 1133 1277 174 949 1327 721 791 1027 694 234 1047 1290 1337 454 1021 682 829 302 1199 1181 1092 1370 1073 59 780 15 169 1244 471 860 933 686 1325 997 247 71 225 689 1179 798 656 814 211 723 250 866 395 722 909 1237 391 1165 227 217 910 277 1210 847 1122 433 11 749 834 373 249 1128 612 544 78 274 1070 896 466 283 312 931 763 1117 1123 1116 945 127 58 102 80 384 9 1262 470 563 774 926 700 599 110 680 1099 797 150 737 73 566 435 822 366 618 82 790 293 579 1120 843 632 934 850 1144 991 1049 60 465 994 407 894 1252 685 1 506 985 1191 77 839 878 154 1158 235 414 139 479 1141 40 1248 848 796 388 1052 1079 1306 107 17 1323 100 129 1026 146 764 1196 999 702 13 521 1309 420 907 377 173 230 162 782 385 744 661 516 938 869 1378 962 202 45 27 300 1029 992 1175 97 674 346 886 257 144 14 193 1151 194 369 808 436 1373 988 580 714 620 741 259 23 1236 404 25 1053 876 675 502 923 42 681 1043 1109 1348 557 515 460 357 121 630 635 141 873 1160 1260 49 619 1330 344 1136 106 37 76 965 415 1184 246 1221 757 1162 1161 742 736 975 338 571 854 832 88 1243 554 1082 785 444 603 1201 324 1361 409 815 968 1349 1336 605 298 1063 558 582 197 781 1363 784 79 218 328 65 1257 964 1353 662 859 1269 1036 1107 134 489 220 1076 771 10 520 1104 1232 655 1326 1150 380 1266 175 8 379 1006 1045 ;
hsearch start=current;
wts 1: all;
hsearch start=current;
time;
savetrees brlens=yes append=yes;
gettrees file=prat.pra allblocks=yes mode=3 storebrlens=yes duptrees=eliminate;
filter best;
contree all /strict=yes root=outgroup outroot=monophyl showtree=yes treefile=PRAPcons.tre replace=yes;
pscores /TL=yes CI=yes RI=yes RC=Yes HI=Yes;
[!

    To further swap on shortest tree: (e.g., copy from logfile into blank file and execute)

gettrees file=prat.pra allblocks=yes mode=3 storebrlens=yes duptrees=eliminate;
filter best;
set maxtrees=1000{or any number you want} increase=no;
hsearch start=current swap=TBR steepest=no multrees=yes;
contree all /strict=yes root=outgroup outroot=monophyl showtree=yes treefile=PRAPcons.tre replace=yes;
pscores /TL=yes CI=yes RI=yes RC=Yes HI=Yes;
]