Pinaceaecomb.nex

#NEXUS

BEGIN data;
    DIMENSIONS ntax=26  NCHAR=2941;
    FORMAT datatype=dna [standard:1-103, dna:104-2941] SYMBOLS= "0 1 2 3 4 5 6 7" interleave=yes MISSING=? GAP=- ;

[    CHARSTATELABELS  
        1  shoot_dimorphism / absent present,
  2  sieve_element_plastids / starch_accumulating protein_accumulating,
  3  stem_phloem_fibers / present absent,
  4  phloem_fiber_sclerids / absent present,
  5  phloem_mucilage / absent present,
  6  secondary_phloem_horizontal_resin_canals / absent present,
  7  phloem_resin_cavities / absent present,
  8  xylem_parenchyma / absent present,
  9  thickenings_on_transverse_tracheid_walls / absent spiral plates,
  10  spiral_thickenings_on_axial_tracheid_walls / absent present,
  11  epithelium_of_vertical_resin_canals / thick thin,
  12  vertical_secondary_wood_resin_canals / absent present,
  13  horizontal_resin_ducts_in_rays / absent present,
  14  cortical_resin_ducts / cavities_only present absent,
  15  indentations_horizont_walls_ray_parenchyma / absent present,
  16  ray_tracheids / absent present,
  17  crossfield_pits / cupressoid_or_taxoid piciform pinoid,
  18  root_resin_canals / absent_or_one two,
  19  brachioblasts / absent long_with_close_annual_rings long_with_distinct_annual_rings short,
  20  leaf_shape / falcate_profile_tetragonal_cross_section linear_lanceolate_bifacially_flattened scalelike bilaterally_flattened needlelike fused 'fan-shaped',
  21  leaf_arrangement / spread_out_on_branch 'in_fascicles,_spirally_arranged_on_short_shoots' helically_arranged_on_short_shoots,
  22  leaf_attachment / decurrent stalklike_constrictions shield_shaped,
  23  leaf_bases / decurrent fused,
  24  leaf_thickness / thick thin,
  25  leaf_persistence / persistent deciduous,
  26  apical_meristems / without_modified_leaves 'shorter_leaves,_interrupting_growth' scale_leaves 'winter_buds,_tips_free' 'winter_buds,_scales_overlapping',
  27  primary_stomatal_bands / abaxial adaxial_or_amphi,
  28  leaf_endoderm_Casparian_strips / absent present,
  29  mesophyll_parenchyma / smooth plicate,
  30  tracheids_of_leaf_tranfusion_tissue / lateral_to_vascular_bundle all_around_vascular_bundle,
  31  vascular_bundles_in_the_stele_of_the_leaf_2 / one two more_than_two,
  32  resin_canal_position / absent central marginal,
  33  biflavonoids / present absent,
  34  tropolones / absent present,
  35  chemical_immunology / pinoid abietoid,
  36  male_strobili_arrangement / single clusters_from_a_single_bud grouped_in_racemes,
  37  microsporangial_dehiscence / longitudinal oblique transverse,
  38  pollen_tetrad_formation / simultaneous successive,
  39  pollen_with / shallow_functional_germination_furrow harmomegathus functionless_germ_furrow pore,
  40  pollen_exine / tegillate rough_corrugate granular roughened,
  41  pollen_triradiate_streaks / absent present,
  42  pollen_saccae_or_frills / present absent,
  43  sperm_nuclei_cell_walls / present absent,
  44  pollination_drop / present absent,
  45  micropyle / symmetric asymmetric,
  46  ventral_canal_cell / distinct_cell_wall no_wall_but_nuclei,
  47  megaspore_membrane / uniform_thickness thin_at_micropylar_end,
  48  proembryo_wall_formation / secondary_type primary_type,
  49  proembryo_tiers / three four,
  50  polyembryony / simple cleavage,
  51  orientation_of_mature_cones / pendant erect,
  52  cones_on_leaved_peducles / absent present,
  53  scale_apex / thinning_distally thickening_distally_or_umbo,
  54  umbo / dorsal terminal,
  55  seed_scale_absission / absent present semi,
  56  disintegration_of_cone_rachis / absent present,
  57  bract / not_keeled keeled,
  58  bract_length / shorter well_developed,
  59  bract_apex / acute_or_rounded trifurcate,
  60  cone_scale_shape / ovate_obovate_orbicular deltoid_triangular flabellate rhombic subcordate tongue_shaped,
  61  'seed scales with narrowed, pedicellate base' / absent present,
  62  sclerenchyma_in_pith / absent present,
  63  resin_canals_in_pith / absent present,
  64  secondary_xylem_cone_axis / continuous_cylinder separate_strands,
  65  resin_canals_in_secondary_xylem / absent present,
  66  female_cone_maturation / one_year two_to_three,
  67  sclerenchyma_in_inner_cortex / absent present,
  68  sclerenchyma_in_outer_cortex / absent present,
  69  cortical_resin_canals / uniform_in_diameter dilated,
  70  trichomes / absent present,
  71  'vascular trace to each bract-scale' / separate fused,
  72  scale_trace / clearly_derived_from_two_lateral_strands derived_as_single_abaxially_concave_strand,
  73  scale_trace / abaxially_concave becoming_cylindrical_after_divergence,
  74  resin_canal_to_scale / single_branch two three four,
  75  bract_scale_separation / first_laterally first_medially,
  76  bract_base_abaxial_lobe / absent present,
  77  bract_sclerenchyma / absent present,
  78  bract_resin_canals / absent two greater_than_two,
  79  bract_trace / entering_bract terminating_before,
  80  resin_canals_to_scale_base / abaxial adaxial both absent,
  81  resin_canals_to_scale_seed_level / abaxial adaxial both both_and_between absent,
  82  resin_canals_to_scale_distal / abaxial adaxial both between_vascular_bundles absent both_and_between abaxial_and_between adaxial_and_between,
  83  sclerenchyma_in_scale / both abaxial adaxial absent both_and_between abaxial_and_between adaxial_and_between,
  84  scale_right_angle_to_cone_axis_and_sharply_upturned_distally / absent present,
  85  axillary_complex / free_from_bract partially_fused fused,
  86  sterile_appendages_per_dwarf_shoot / more_than_10 less_than_6,
  87  bract_scale_complexes_per_cone / many few one,
  88  mechanical_tissue_of_scale_base / modified well_developed,
  89  mechanical_tissue_at_scale_base / highly_gelatinous fibrous,
  90  ovule_position / lateral terminal,
  91  ovules_per_scale / more_than_two one two,
  92  interseminal_ridge / absent extending_less_than_half_seed_diameter extending_more_than_half overarching_seeds,
  93  seed_body / 'non-Pinaceae' triangular_cuneate 'oval-ovoid' 'round-obovate',
  94  seed_trace / absent present,
  95  seed_wing_origin / from_lateral_extension_of_integument absent from_scale_epidermis from_bract_and_scale,
  96  seed_wing_attachment / absent claws shallow_cup_separable shallow_cup deep_cup,
  97  seed_wing_overall_shape / 'widening_distally,_blunt_or_rounded_apex' 'elongate,_not_widening_distally,_rounded' 'semi-trullate_sharp',
  98  seed_coat_with_resin_vesicles / absent present,
  99  seed_storage_product / starch oils,
  100  seed_maturation / 2_years 1_year,
  101  seed_germination_hypogeal / absent present,
  102  number_of_cotyledons / two_to_six four_to_twenty,
  103  chromosome_number / 'n=12' 'n=11' 'n=10' 'n=13'
        ;
]
MATRIX
[                       10        20        30        40        50        60        70        80        90        100       ]
[                       .         .         .         .         .         .         .         .         .         .         ]

Cedrus         1110010100?000111020110104(01)10110111000000010011111100?100002100101(01)10(01)0103001012?5410000002(01)11240111010
Abies          0110101100?00110(01)001021004000112101020001011011110100?1011(01)21101(01)011(01)(01)(01)1011(01)110117010001102011240111010
Keteleeri      01101011000101101001021004000102101120000011011111110?011114100000011(01)011101111222010001102111240111100
Pseudolar      1110101100?000101011110114000102101120000011011110111?0100011101001101010?00110235100000102021242111001
Pseudolas      1?????????????????1111?1????????????????????????????1?0??0011???????????????????????000??02?2?242??????
Nothotsug      0??00011000100111?01010004000?01?0?1200100?10????1110?0(01)1100110000(01)?0(01)?1031(01)11011500000110213?2411????0
Tsuga          0110000100?001111001010004000101101020010?11011111000?001000110000(01)(01)0(01)01031(01)110115000001102131241111000
Larix          11110111010110111131110114010102100001120111111110110?0001100100(01)0(01)10101011(01)0(12)(01)115000001102(12)30231011000
Pseudotsu      01110111110111111101021004010102100010121111111110010?000110010010(01)10(01)010100010115000001102130231011010
Cathaya        1110010111011101110102100401110210?0000?0011011111010?0000000000000100?10??10112?500000??0213?231011000
Picea          01100110(01)1011111110?01000411?102110000000010011110000?0010030(01)0(01)(01)0(01)10(01)0101010(12)012(57)400001102(12)30221011010
Pinuscemb      1110011000111101110420?00411110210020000001001111100100000050(01)0011(01)0(01)0110100(01)102(03)5400001102130211010010
Pinusstro      1110011000111101210420?00401110210020000001001111100110000050(01)0011(01)0(01)0110100(01)100(03)5400001102130211010010
Pinuspond      1110011020111101210420?00411111210020000001001111100100000050(01)0011(01)(01)(01)0110100(01)100(03)5400001102130211010010
Pinussylv      1110011020111101210420?00411111210020000001001111100100000050(01)0011(01)1(01)0110100(01)100(03)5400001102130211010010
Pinusbelg      ?????????????1???????????????1??????????????????????100000050(01)0011(01)1(01)0110100(01)100(03)540000110213?211??????
Pseudoahe      ?????????????1??????????????????????????????????????1100000010010001000001001101120100000023112401?????
Pityostbo      ?????????????1?????????????????????????0?0??????????0?0??0050110000000010100?0100210000??0203?2110?????
Pityostca      ????????0????1??????????????????????????????????????0?0??002111010111001010001023500000??0221?2??0?????
Pityostco      ?????????????1??????????????????????????????????????0?0??0021100001100011?0011123510000??0201?2401?????
Araucaria      00?0000100?00200000100000110002100?(01)001301010000001?0?100102(01)????1?????????????????1210??01?0?3??0?0103
Podocarpu      0000000100?00100000100000400000100?120000000000001?0????0?0??????0??????????????????011??11?0?1??00??0?
Amentotax      00000??110?00?10000100000400000?00?101220100?00000?0?????????????????????????????????01??11?0?1??000?0?
Cryptomer      0000000100?00210000000000110000100?2003201000000010?0?00020?01000011000??00002034440100??0000?1??011001
Sciadopit      10000??000?00?00000500000210000?00?1012201000000010?0?1?0002000100000100010002011720100??0000?1??010?02
Ginkgo         1?00000100?00200001610?11000001000??00000100000000??????????????????????????????????????????0?1??000?00

   Cedrus  CTTATTATACTCCTGAATAT CAGACCAAAGATACGGATAT CTTGGCAGCATTCCGAGTAA CTCCTCAACCTGGGGTGCCA CCCGAGGAAGCGGGAGCAGC
    Abies  CTTATTATACTCCTGAATAT CAGACCAAAGATACGGATAT CTTGGCGGCATTCCGAGTAA CTCCTCAACCTGGGGTGCCG CCCGAGGAAGCGGGAGCAGC
Keteleeri  CTTATTATACTCCTGAATAT CAGACCAAAGATACGGATAT CTTGGCGGCATTCCGAGTAA CCCCTCAACCTGGGGTGCCG CCCGAGGAAGCGGGAGCAGC
Pseudolar  cttattatactcctgaatat cagaccaaagatacggatat cttggcagcattccgagtaa ctcctcaacccggggtgcca cccgaggaagcgggagcagc
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  CTTATTATACTCCTGAATAT CAGACCAAAGATACGGATAT CTTGGCAGCATTCCGAGTAA CTCCTCAACCCGGAGTGCCG CCCGAGGAAGCGGGAGCAGC
    Tsuga  cttattatactcctgaatat cagaccaaagatacggatat cttggcagcattccgagtaa ctcctcaacccggagtgccg cccgaggaagcgggagcagc
    Larix  cttattatactcctgaatat cagaccaaagatacggatat cttggcagcattccgagtaa ctcctcaacctggggtgccg cccgaggaagcgggagcagc
Pseudotsu  CTTATTATACTCCTGAATAT CAGACCAAAGATACGGATAT CTTGGCAGCATTCCGAGTAA CTCCTCAACCTGGGGTGCCA CCCGAGGAAGCGGGAGCAGC
  Cathaya  CTTATTATACTCCTGAATAT CAgACCAAAgATACGGATAT CTTGGCAGCATTCCGAGTAA CTCCTCAACCCGGGGTGCCG CCCGAAGAAGCGGGAGCAGC
    Picea  CTTATTATACTCCTGAATAT CAGACCAAAGATACGGATAT TTTGGCAGCATTCCGAGTAA CTCCTCAACCAGGGGTGCCG CCCGAGGAAGCGGGAGCAGC
Pinuscemb  CTTATTATACTCCTGAATAT CAGACCAAAGATACGGATAT CTTGGCAGCATTCCGAGTAA CCCCTCAACCTGGGGTGCCA GCCGAGGAAGCGGGTGCAGC
Pinusstro  CTTATTATACTCCTGAATAT CAGACCAAAGATACGGATAT CTTGGCAGCATTCCGAGTAA CTCCTCAACCTGGGGTGCCA GCCGAGGAAGcGGGTGCAGC
Pinuspond  CTTATTATACTCCTGAATAT CAGACCAAAGATACAGATAT CTTGGCAGCATTCCGAGTAA CTCCTCAACCCGGGGTGCCA CCTGAAGAAGCGGGAGCAGC
Pinussylv  CTTATTATACTCCTGAATAT CAGACCAAaGATACAGATAT CTTGGCAGCATTCCGAGTAA CTCCTCAACCCGGGGTGCCA CCTGAAGAAGCGGGAGCAGC
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  cttattatactccggaatat cagaccaaagatacggatat cttggcagcattccgagtca ctcctcaacccggagtgccc cccgaggaagcaggagcagc
Podocarpu  cttattatactccggaatat ccgaccaaagatactgatat cttgacgacattccgagtca ctcctcaacccggagtaccc cccgaggaagcaggagcgac
Amentotax  cttattatactccagaatat aagaccaaagatactgatat cttggcagcattccgagtca ctcctcaacccggagtgccc cccgaggaagcgggagcagc
Cryptomer  cttattatactccggaatat cagaccaaagatactgatat cttagcagcattccgagtca ctcctcaacctggagtaccc cccgaagaagcgggagcagc
Sciadopit  cttattatacccctgaatat cagaccaaagacactgatat cttggcagcattccgagtca ctcctcaacccggagtgcct cctgaggaggcaggannngc
   Ginkgo  cttattatactcctgaatat caaaccaaagatactgatat cttggcagcattccgagtaa ctcctcaacctggagtgcca cctgaggaagcgggagctgc

   Cedrus  AGTAGCTGCTGAATCTTCCA CCGGTACATGGACCACTGTT TGGACCGATGGACTTACTAG TCTTGATCGTTACAAGGGGC GATGCTATGACATCGAGCCC
    Abies  AGTAGCTGCTGAATCTTCCA CCGGTACATGGACCACTGTT TGGACCGATGGACTTACCAG TCTTGATCGTTACAAAGGGC GATGCTATGACATCGAGCCC
Keteleeri  AGTAGCTGCTGAATCTTCCA CCGGTACATGGACCACTGTT TGGACCGATGGACTTACCAG TCTTGATCGTTACAAGGGGC GATGCTATGACATCGAGCCC
Pseudolar  agtagctgctgaatcttcca ccggtacatggaccactgtt tggaccgatggacttaccag tcttgatcgttacaaggggc gatgctatgacattgagccc
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  AGTAGCTGCTGAATCGTCCA CCGGTACATGGACCACTGTT TGGACCGATGGACTTACCAG TCTTGATCGTTACAAGGGGC GATGCTATGACATCGAACCC
    Tsuga  agtagctgctgaatcgtcca ccggtacatggaccactgtt tggaccgatggacttaccag tcttgatcgttacaaggggc gatgctatgacatcgaaccc
    Larix  agtagctgctgaatcttcca ccggtacatggaccactgtt tggaccgatggacttactag tcttgatcgttacaagggac gatgctatgacatcgaggcc
Pseudotsu  AGTAGCTGCTGAATCTTCCA CCGGTACATGGACCACTGTT TGGACCGATGGACTTACTAG TCTTGATCGTTACAAGGGAC GATGCTATGACATCGAGGCC
  Cathaya  AGTAGCTGCTGAATcTTCCA CCGGTACATGGACCACTGTT TGGACCGATGGACTTACTAG TCTTGATCGTTACAAGGGGC GATGCTATGACATCGAGCCC
    Picea  AGTAGCTGCTGAATCTTCCA CCGGTACATGGACCACTGTT TGGACCGATGGACTTACTAG TCTTGATCGTTACAAGGGGC GATGCTATGACATCGAGCCC
Pinuscemb  AGTAGCTGCTGAATCTTCCA CCGGTACATGGACCACTGTT TGGACCGATGGACTTACTAG TCTCGATCGTTACAAGGGGC GATGCTATGACATTGAGCCC
Pinusstro  AGTAGCTGCTGAATCTTCCA CCGGTACATGGACCACTGTT TGGACCGATGGACTTACTAG TCTCGATCGTTACAAGGGGC GATGCTATGACATCGAGCCC
Pinuspond  AGTAGCTGCTGAATCTTCCA CCGGTACATGGACCACTGTT TGGACCGATGGACTTACTAG TCTCGATCGTTACAAGGGGC GATGCTATGACATCGAGCCC
Pinussylv  AGTAGCTGCTGAATCTTCCA CCGGTACATGGACCACTGTT TGGACCGATGGACTTACTAG TCTCGATCGTTACAAGGGGC GATGCTATGACATCGAGCCC
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  agtagcggctgaatcttcta ccggtacatggacaactgtt tggaccgatggacttaccag tcttgatcgttacaaggggc gatgctatgacatcgagcct
Podocarpu  agtagctgccgaatcttcca ctggtacatggactactgtt tggaccgatgggcttaccag cctcgatcgttacaaggggc gatgctatgacatcgaacct
Amentotax  agtagctgccgaatcttcca ctggtacatggaccactgtt tggaccgatggacttaccag tcttgatcgttacaagggac gatgctatgatattgagccc
Cryptomer  agtagccgccgaatcttcca ctggtacgtggacgactgtt tggaccgatggacttaccag tcttgatcgttacaaggggc gatgctatgatattgaaccc
Sciadopit  agtagctgccgaatcttcca ctggtacatggaccactgtt tggaccgatggactcaccag tcttgatcgttacaaggggc gatgctatgacatcgagccc
   Ginkgo  agtagctgccgaatcttcca ctggtacatggaccactgtt tggaccgatggacttaccag tcttgatcgttacaagggaa gatgctatgacatcgagccc

   Cedrus  GTTCCTGGAGAGGAGAGTCA ATTTATTGCCTATGTAGCTT ACCCCTTAGACCTTTTCGAA GAAGGTTCTGTTACTAACTT GTTCACTTCCATTGTAGGTA
    Abies  GTTCCTGGAGAGGAAAGTCA ATTTATTGCCTATGTAGCTT ACCCCTTAGACCTTTTCGAA GAAGGTTCTGTTACTAACTT GTTTACTTCCATTGTAGGTA
Keteleeri  GTTCCTGGAGAAGAAAGTCA ATTTATTGCCTATGTAGCTT ACCCCTTAGACCTTTTCGAA GAAGGTTCTGTTACTAACTT GTTCACTTCCATTGTAGGTA
Pseudolar  gttcctggagaggagagcca atttattgcctatgtagctt accccttagaccttttcgaa gaaggttctgttactaactt gttcacttccattgtaggta
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  GTTCCTGGAGAAGAGAGTCA ATTTATTGCCTATGTAGCTT ACCCCTTAGACCTTTTCGAA GAAGGTTCTGTTACTAACTT ATTCACTTCCATTGTAGGTA
    Tsuga  gttcctggagaagagagtca atttattgcctatgtagctt accccttagaccttttcgaa gaaggttctgttactaactt attcacttccattgtaggta
    Larix  gttcctggagaggagagtca atttattgcctatgtagctt accccttagaccttttcgaa gaaggttctgttactaactt gttcacttccattgtaggta
Pseudotsu  GTTCCTGGAGAGGAGAGTCA ATTTATTGCCTATGTAGCTT ACCCCTTAGACCTTTTCGAA GAAGGTTCTGTTACTAACTT GTTCACTTCCATTGTAGGTA
  Cathaya  GTTCCTGGAGAGGAGAGTCA ATTTATTGCCTATGTGGCTT ACCCTTTAGACCTTTTCGAA gAAGGCTCTGTTACTAATTT GTTCACTTCCATTGTAGGTA
    Picea  GTTCCTGGAGAGGAAACTCA ATTTATTGCCTTTGTAGCTT ACCCCTTAGACCTTTTCGAA GAAGGTTCTGTTACTAACTT GTTCACTTCCATTGTAGGTA
Pinuscemb  GTTCCTGGAGAGGAGAGTCA ATTTATTGCCTATGTAGCTT ACCCCTTAGACCTTTTCGAA GAAGGTTCTGTTACTAACCT GTTCACTTCCATTGTAGGTA
Pinusstro  GTTCCTGGAGAGGAGAATCA ATTTATTGCCTATGTAGCTT ACCCCTTAGACCTTTTCGAA GAAGGTTCTGTTACTAACCT GTTCACTTCCATTGTAGGTA
Pinuspond  GTTCCTGGAGAGGAGACTCA ATTTATTGCCTATGTAGCTT ACCCCTTAGACCTTTTCGAA GAAGGTTCTGTTACTAACTT GTTCACTTCCATTGTAGGTA
Pinussylv  GTTCCTGGAGAGGAGACTCA ATTTATTGCCTATGTAGCTT ACCCCTTAGACCTTTTCGAA GAAGGTTCTGTTACTAACTT GTTCACTTCCATTGTAGGTA
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  gttcctggagaggaaactca atttattgcctatgtagctt accccttagacctttttgaa gaaggttctgttaccaacct gttcacttccattgtgggta
Podocarpu  gttcctggagaagaaaatca atttattgtctatgtagctt atcccttagacctttttgaa gaaggttctgttactaacct gttcacctccattgtgggta
Amentotax  gttcctggagaggaaaatca atttattgcctatgtagctt accctttagatctttttgaa gaaggttctgttactaacct gttcacttccattgtaggta
Cryptomer  gttcctggagaggaaagtca atttattgcctatgtggctt accctttagatctttttgaa gaaggttctgttactaacct gttcacttctattgtaggta
Sciadopit  gttcctggagaggaaagtca atttattgcctatgtagctt atcccttagatctttttgag gaaggttctgttactaacat gttcacttctattgtaggta
   Ginkgo  gttcctggggaggaaaatca atttattgcctatgtagctt accctttggatcttttcgag gaaggttctgttactaacct gttcacttccattgtaggga

   Cedrus  ATGTATTTGGATTCAAGGCC CTACGGGCTCTACGTTTGGA AGATTTGCGGATTCCCCCTG CTTATTCCAAAACATTTCAA GGTCCGCCTCATGGTATCCA
    Abies  ATGTATTTGGATTCAAGGCC CTACGGGCTTTACGTTTGGA AGATTTGCGGATTCCCCCTG CTTATTCCAAAACTTTTCAA GGTCCACCTCATGGTATCCA
Keteleeri  ATGTATTTGGATTCAAGGCC CTACGGGCTCTACGTTTGGA AGATTTGCGGATTCCCCCTg CTTATTCCAAAACTTTTCAA GGTCCACCTCATGGtATCCA
Pseudolar  atgtatttggattcaaggcc ctacgggctctacgtttgga agatttgcggattccccctg cttattccaaaacttttcaa ggtccacctcatggtatcca
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  ATGTATTTGGATTCAAGGCC CTACGAGCTCTACGTTTGGA AGATTTGCGGATTCCCCCTG CTTATTCCAAAACTTTTCAA GGTCCGCCTCATGGTATCCA
    Tsuga  atgtatttggattcaaggcc ctacgggctctacgtttgga agatttgcggattccccctg cttattccaaaacttttcaa ggtccgcctcatggtatcca
    Larix  atgtatttggattcaaggcc ctacgggctctacgtttgga agatttgcggatcccccctg cttattccaaaacttttcaa ggtccacctcatggtatcca
Pseudotsu  ATGTATTTGGATTCAAGGCC CTACGGGCTCTACGTTTGGA AGATTTGCGGATCCCCCCTG CTTATTCCAAAACTTTTCAA GGTCCACCTCATGGTATCCA
  Cathaya  ATGTATTTGGATTCAAGGCC CTACGGGCTCTACGTTTGGA AGATTTGCGGATTCCCCCTG CTTATTCCAAAACTTTTCAA GGTCCACCTCATGGTATCCA
    Picea  ATGTATTTGGATTCAAGGCC CTACGGGCTCTACGTTTGGA AGATTTGCGGATTCCCCCTG CTTATTCCAAAACATTTCAA GGTCCACCTCATGGTATCCA
Pinuscemb  ATGTATTTGGATTCAAGGCC CTACGGGCTCTACGTTTGGA AGATTTGCGGATTCCCCCTG CTTATTCCAAAACTTTTCAG GGCCCACCTCATGGTATCCA
Pinusstro  ATGTATTTGGATTCAAGGCC CTACGGGCTCTACGTTTGGA AGATTTGCGGATTCCCCCTG CTTATTCCAAAACTTTTCAG GGTCCACCTCATGGTATCCA
Pinuspond  ATGTATTTGGATTCAAGGCC CTACGGGCTCTACGTTTGGA AGATTTGCGGATTCCCCCTG CTTATTCCAAAACTTTTCAG GGTCCACCTCATGGTATCCA
Pinussylv  ATGTATTTGGATTCAAGGCC TTACGGGCTCTACGTTTGGA AGATTTGCGGATTCCCCCTT CTTATTCCAAAACTTTTCAG GGTCCACCTCATGGTATCCA
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  atgtatttggattcaaagcc ctacgggctctacgtctgga agatctgcgaattcctcctg cttattccaaaactttccaa ggtccaccccatggtattca
Podocarpu  atgtttttggattcaaagcc ctacgggctctacgtctgga agatctgcgaattcctcctt cttattccaaaactttccaa ggtccaccacatggtatcca
Amentotax  atgtatttggattcaaagcc ctacgagctctacgtctgga agatctgcgaattcctcctg cttattcaaaaactttccaa ggcccaccacatggtatcca
Cryptomer  atgtatttggattcaaagcc ttacgggctctacgtctgga agatttacggattcctcctg cttattcaaaaactttccaa ggcccaccacatggtattca
Sciadopit  atgtatttggattcaaagcc ctacgggctctacgtctgga agatctgcgaattcctcctg cttattcaaaaactttccaa ggtccgccccatggtatcca
   Ginkgo  atgtatttggattcaaagcc ctacgagctctacgtctgga agatctgcgaattcctcctg cttattccaaaactttccag ggtccacctcatggtatcca

   Cedrus  AGTTGAAAGAGATAAATTGA ACAAATATGGCCGTCCTTTG TTGGGATGTACTATCAAACC AAAATTGGGTCTATCGGCTA AAAACTATGGTAGAGCAGTT
    Abies  AGTTGAAAGAGATAAATTGA ACAaATATGGCCGTCCTTTG TTGGGATGTACTATCAAACC AAAATTGGGTCTATCGGCTA AGAACTATGGTAGAGCAGTT
Keteleeri  AGTTGAAAGAGATAAATTGA ACAAATATGGTCGTCCTTTG TTGGGATGTACTATTAAACC AAAATTGGgTCTATCAGCTA AGAACTATGGTAGAGCAGTT
Pseudolar  agttgaaagagataaattga acaaatatggccgtcctttg ttgggatgtactatcaaacc aaaattgggtctatcggcta agaactatggtagagcagtt
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  AGTTGAAAGAGATAAATTGA ACAAATATGGTCGTCCTTTG TTGGGATGTACTATCAAACC AAAATTGGGTCTATCGGCTA AGAACTATGGTAGAGCAGTT
    Tsuga  agttgaaagagataaattga acaaatacggtcgtcctttg ttgggatgtactatcaaacc aaaattgggtctatcggcta agaactatggtagagcagtt
    Larix  agtcgaaagggataaattga acaaatatggccgtccttta ttgggatgtactatcaaacc aaaattgggtctatcggcta agaactatggtagagcagtt
Pseudotsu  AGTTGAAAGGGATAAATTGA ACAAATATGGCCGTCCTTTA TTGGGATGTACTATCAAACC AAAATTGGGTCTATCGGCTA AGAACTATGGTAGAGCAGTT
  Cathaya  AGTTGAAAGAGATAAATTGA ACAAATATGGACGTCCTTTA TTGGGATGTACTATCAAACC AAAATTGGGTCTATCAGCCA AGAACTATGGTAGAGCAGTT
    Picea  AGTTGAAAGAGATAAaTTGA ACAAATATGGCCGTCCTTTA TTGGGATGTACTATCAAACC AAAATTGGGTCTATCGGCCA AGAACTATGGTAGAGCAGTT
Pinuscemb  AGTTGAAAGAGATAAATTGA ACAAATATGGTCGTCCTTTA TTGGGATGTACTATCAAACC AAAATTGGGTCTATCAGCCA AAAACTATGGTAGAGCAGTT
Pinusstro  AGTTGAAAGAGATAAATTGA ACAAATATGGTCGTCCTTTA TTGGGATGTACTATCAAACC AAAATTGGGTCTATCAGCCA AAAACTATGGTAGAGCAGTT
Pinuspond  GGTTGAAAGAGATAAATTGA ACAAATATGGTCGTCCTTTA TTGGGATGTACTATCAAACC AAAATTGGGTCTATCAGCCA AAAACTATGGTAGAGCAGTT
Pinussylv  AGTTGAAAGAGATAAATTGA ACAAATATGGTCGTCCTTTA TTGGGATGTACTATCAAACC AAAATTGGGTCTATCAGCCA AAAACTATGGTAGAGCAGTT
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  agttgaaagagataaattaa acaaatatggccgtcccttg ttggggtgtactataaaacc aaaattgggtctatctgcca aaaattatggtagagcagtt
Podocarpu  ggtggaaagagataaattaa ataaatatggccgcccctta ttgggatgtaccatcaaacc aaaattgggtctgtctgcaa agaattatggtagagcagtt
Amentotax  agtggaaagagataaattaa acaaatatggtcgtcctttg ttgggatgtactatcaaacc aaaattgggcctatctgcca aaaattatggtagagcggtt
Cryptomer  agtagaaagagataaattaa acaaatatggtcgtcctttg ttgggatgtactataaaacc aaaattgggtctatctgcca agaattatggtagagcggtt
Sciadopit  agttgaaagagataaattaa acaaatatggtcgcccttta ttggggtgtactatcaaacc aaaatgtggcctatctgcca aaaattatggcagagcagtt
   Ginkgo  agttgaaagggataaattga ataaatatggccgtccccta ttgggatgtactatcaagcc aaaattgggtttatctgcca aaaattatggtagagcagtt

   Cedrus  TACGAATGTCTCCGTGGTGG ACTTGATTTTACCAAGGATG ATGAGAACGTAAATTCCCAA CCATTCATGCGCTGGAGAGA TCGTTTTGTCTTTTGTGCGG
    Abies  TACGaATGTCTTCGTGGTGG ACTCGATTTTACCAAGGATG ATGAGAACGTAAATTCCCAA CCATTCATGCGCTGGAGAGA TCGTTTTGTCTTTTGTGCGG
Keteleeri  TACGAATGTCTCCGTGGTGG ACTCGATTTTACCAAGGATG ATGAGAACGTAAATTCCCAA CCATTCATGCGCTGGAGAGA TCGTTTTGTCTTTtGTGCGG
Pseudolar  tacgaatgtctccgtggtgg acttgattttaccaaggatg atgagaacgtaaattcccaa ccattcatgcgctggagaga tcgttttgtcttttgtgcgg
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  TATGAATGTCTCCGTGGTGG ACTCGATTTTACCAAGGATG ATGAGAACGTAAACTCCCAA CCATTCATGCGCTGGAGAGA TCGTTTTGTCTTTTGTGCGG
    Tsuga  tatgaatgtctccgtggtgg actcgattttaccaaggatg atgagaacgtaaactcccaa ccattcatgcgttggagaga tcgttttgtcttttgtgcgg
    Larix  tacgaatgtctccgtggtgg actcgattttaccaaggatg atgagaacgtaaattcccaa ccattcatgcgctggagaga tcgttttgtcttttgtgcgg
Pseudotsu  TACGAATGTCTCCGTGGTGG ACTCGATTTTACCAAGGATG ATGAGAACGTAAATTCCCAA CCATTCATGCGCTGGAGAGA TCGTTTTGTCTTTTGTGCGG
  Cathaya  TACGAATGTCTCCGCGGTGG ACTCGATTTTACCAAGGATG ATGAGAACGTAAATTCCCAA CCATTCATGCGCTGGAGAGA TCGTTTTGTCTTTTGTGCGG
    Picea  TACGAATGTCTCCGTGGTGG ACTCGATTTTACCAAGGATG ATGAGAACGTAAATTCCCAA CCATTCATGCGCTGGagaga TCGTTTTGTCTTTTGTGCGG
Pinuscemb  TACGAATGTCTCCGTGGTGG ACTCGATTTTACCAaGGACG ATGAGAACGTAAATTCCCAA CCATTCATGCGCTGGAGAGA TCGTTTTGTCTTTTGTGCGG
Pinusstro  TACGAATGTCTCCGTGGTGG ACTCGATTTTACCAAGGATG ATGAGAACGTAAATTCCCAA CCATTCATGCGCTGGAGAGA CCGTTTTGTCTTTTGTGCGG
Pinuspond  TACGAATGTCTCCGTGGTGG ACTCGATTTTACTAAGGATG ACGAGAACGTAAATTCCCAA CCATTCATGCGCTGGAGAGA TCGTTTTGTCTTTTGTGCGG
Pinussylv  TACGAATGTCTCCGTGGTGG ACTCGATTTTACTAAGGATG ATGAGAACGTAAATTCCCAA CCATTCATGCGCTGGAGAGA TCGTTTTGTCTTTTGTGCGG
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  tatgaatgtctccgtggtgg actcgattttaccaaggatg atgagaacgtgaattcccaa ccattcatgcgctggagaga tcgttttgtcttttgtgcag
Podocarpu  tacgaatgtcttcgtggtgg acttgattttacgaaggatg atgagaatgtaaattcccaa ccatttatgcgctggagaga tcgtttttgcttttgcgctg
Amentotax  tacgaatgtctccgtggtgg acttgattttaccaaggatg atgaaaacgtgaattcccaa ccattcatgcgctggagaga tcgtttctgtttttgtgcag
Cryptomer  tatgaatgtctccgtggtgg acttgattttaccaaggatg atgaaaacgtgaattcccaa ccatttatgcgctggagaga tcgtttctgcttttgtgcag
Sciadopit  tacgaatgtcttcgcggtgg acttgattttaccaaagatg atgagaacgtgaattcccaa ccattcatgcgctggagaga ccgtttttgcttttgtgctg
   Ginkgo  tacgaatgtcttcgtggtgg acttgattttactaaagatg atgagaacgtaaattcccaa ccattcatgcgctggagaga tcgtttcttgttttgtgcag

   Cedrus  AAGCAATTTATAAGGCTCAG GCTGAGACGGGTGAAATTAA GGGGCATTACTTGAATGCTA CTGCAGGTACATGTGAAGAA ATGATGAAAAGGGCAGTCTT
    Abies  AAGCACTTTATAAGGCTCAG GCTGAGACGGGTGAAATTAA AGGACATTACTTGAATGCTA CTGCAGGTACATGTGAAGAA ATGATGAAAAGGGCAGTATT
Keteleeri  AAgCACTTAATAAGGCTCAG GCTGAGACGGGTGAAATTAA AGGACATTACTTGAATGCTA CTGCAGGTACATGTGAAGAA ATGATGAAAAGGGCAATATT
Pseudolar  aagcaatttataaggctcag gctgagacgggtgaaattaa aggacattacttgaatgcta ctgcaggtacatgtgaagag atgatgaaaagggcaatatt
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  AAGCACTTTATAAGGCTCAG GCTGAGACGGGTGAAATTAA AGGACATTACTTGAATGCTA CTGCAGGTACATGTGAAGAA ATGATGAAAAGGGCAATATT
    Tsuga  aagcactttataaggctcag gctgagacgggtgaaattaa aggacattacttgaatgcta ctgcaggtacatgtgaagaa atgatgaaaagggcagtatt
    Larix  aagcactttataaggctcag gctgagacgggtgaaattaa gggacattacttgaatgcta ctgcaggtacatgtgaagaa atgatgaaaagggcagtatt
Pseudotsu  AAGCACTTTATAAGGCTCAG GCTGAGACGGGTGAAATTAA GGGACATTATTTGAATGCTA CTGCAGGTACATGTGAAGAA ATGATGAAAAGGGCAGTATT
  Cathaya  AAGCAATTAATAAGGCTCAG GCTGAGACGGGTGAAATTAA GGGACATTACTTGAATGCTA CTGCAGGTACATGTGAAGAA ATGATAAAAAGGGCAGTATT
    Picea  AAGCAATTTATAAAGCTCAG GCTGAGACGGGTGAAATTAA GGGACATTACTTGAATGCTA CTGCAGGTACATGTGAAGAA ATGATGAAAAGGGCAGTATT
Pinuscemb  AAGCAATTAATAAGGCTCAG GCTGAGACGGGTGAAATTAA GGGACATTATTTGAATGCTA CTGCAGGTACATGTGAAGAA ATGGTAAAAAGGgCAGTATT
Pinusstro  AAGCAATTAATAAGGCTCAG GCTGAGACGGGTGAAATTAA GGGACATTATTTGAATGCTA CTGCAGGTACATGTGAAGAA ATGATGAAAAGGGCAGTATT
Pinuspond  AAGCAATTTATAAGGCTCAG GCTGAGACGGGTGAAATTAA GGGACATTATTTGAATGCTA CTGCAGGTACATGTGAAGAA ATGATAAAAAGGGCAGTATT
Pinussylv  AAGCAATTAATAAGGCCCAG GCTGAGACGGGTGAAATTAA GGGACATTATTTGAATGCTA CTGCAGGTACATGTGAAGAA ATGATGAAAAGGGCAATATT
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  aagcaatttataaagctcag gcggagacgggtgaaattaa ggggcattacttgaatgcta ccgcaggtacatgtgaagaa atgatgaaaagagcaagttt
Podocarpu  aagcactttttaaagctcag gctgaaacgggtgaaattaa ggggcattacctcaatgcta ccgcaggtacatgtgaagaa atgataaaaagagcggtatt
Amentotax  aagcactttataaagctcag gctgagacgggtganattaa gggacattacttgaatgcta ctgcaggtacatgtgaagaa atgatgaaaagagcagtatt
Cryptomer  aagcactttataaagctcag gctgagacgggtgagattaa gggacattacctgaatgcta ctgcaggtacatgtgaagaa atgatgaaaagagcagtatt
Sciadopit  aagcaatttataaagctcaa gctgaaacgggtgaaattaa gggacattatttgaatgcta ctgcaggtacatgtgaagaa atgatcaaaagagcagtatt
   Ginkgo  aagcaatttataaagctcag accgagacgggtgaaattaa gggacattacttgaatgcta ctgcaggtacatgcgaagaa atgatgaaaagggcagtatt

   Cedrus  TGCAAGAGAATTGGGAGTTC CTATCGTCATGCATGACTAT TTGACGGGAGGTTTTACCGC AAATACTAGTTTGGCTCATT ATTGCCGAGACAACGGCCTA
    Abies  TGCAAGAGAATTAGGAGTTC CTATCGTCATGCATGACTAT CTGACGGGGGGTTTTACCGC AAATACTACTTTGGCTCATT ATTGCCGAGACAATGGTCTA
Keteleeri  TGCAAGAGAATTAGGAGTTC CTATCGTCATGCATGACTAT CTGACGGGGGGTTTTACTGC AAATACTAGTTTGGCTCATT ATTGCCGAGACAATGGCCTA
Pseudolar  tgcaagagaattaggagttc ctatcgtcatgcatgactat ctgacgggaggttttactgc aaatactagtttggctcatt attgccgagacaatggccta
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  TGCAAGAGAATTAGGAGTTC CTATCGTCATGCATGACTAT CTGACGGGAGGTTTTACCGC AAATACTAGTTTGGCTCATT ATTGCCGAGACAATGGCTTA
    Tsuga  tgcaagagaattaggagttc ctatcgttatgcatgactat ctgacgggaggttttaccgc aaatactactttggctcatt attgccgagacaatggccta
    Larix  tgcaagagaattgggagttc ctatcgttatgcatgactat ctgacgggaggttttactgc aaatacttctttggctcatt attgccgagacaacggccta
Pseudotsu  TGCAAGAGAATTGGGAGTTC CTATCGTTATGCATGACTAT CTGACAGGAGGTTTTACCGC AAATACTTCTTTGGCTCATT ATTGCCGAGACAACGGCCTA
  Cathaya  TGCAAGAGAATTGGGAGTTC CTATCATTATGCATGACTAT CTGACGGGAGGTTTTACTGC AAATACTTCTTTGGCTCATT ATTGCCGAGACAACGGCCTA
    Picea  TGCAAGAGAATTGGGAGTTC CTATCGTTATGCATGACTAT CTGACGGGAGGTTTTACCGC AAATACTTCTTTGGCTCATT ATTGCCGAGACAACGGCCTA
Pinuscemb  TGCAAGAGAATTGGGAGTTC CTATTGTTATGCATGACTAC CTGACGGGAGGTTTTACCGC AAATACTTCTTTGGCTCATT ATTgCCGAGACAACGGCCTA
Pinusstro  TGCAAGAGAATTGGGAGTTC CTATTGTTATGCATGACTAC CTGACGGGAGGTTTTACCGC AAATACTTCTTTGGCTCATT ATTGCCGAGACAACGGCCTA
Pinuspond  TGCAAGAGAATTGGGAGTTC CTATCATTATGCATGACTAT CTGACGGGAGGTTTTACCGC AAATACTTCTTTGGCTCATT ATTGCCGAGACAACGGCCTA
Pinussylv  TGCAAGAGAATTGGGAGTTC CTATCGTTATGCATGACTAC CTGACGGGAGGTTTTACCGC AAATACTTCTTTGGCTCATT ATTGCCGAGACAACGGCCTA
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  cgcctatgaattgggagttc ccatcgtcatgcatgactat ctgacgggaggttttacggc aaatacttcgttggctcatt attgccgagaccatggccta
Podocarpu  cgctagagaattgggagttc ctatcgttatgcatgactat ctgacgggggggtttacggc gaatacttcgttggctcatt attgccgagacaacggccta
Amentotax  cgccagagaattgggagttc ctatagttatgcatgactat ttgactggaggttttacagc aaatacttcgttggctcatt attgccgagacaacggccta
Cryptomer  cgccagagaattgggagttc ctatagtcatgcatgactat ctgactggaggttttacggc aaatacttcgttggctcatt attgccgagataacggccta
Sciadopit  cgccagagaattgggagtcc ccatagtcatgcatgactat ctgacgggaggttttacggc aaatacttcgttgtctcatt attgccgagacaacggccta
   Ginkgo  tgccagagaattgggagttc ctatcgtcatgcatgactat ctgacgggaggttttactgc aaatactagcttggctcatt attgccgagacaatggccta

   Cedrus  CTTCTTCACATTCACCGCGC GATGCATGCAGTTATTGACA GACAAAGAATTCATGGTATG CATTTCCGTGTACTGGCTAA AGCATTGCGTATGTCCGGTG
    Abies  CTTCTTCACATTCACCGCGC GATGCATGCAGTTATCGACA GACAAAGAAATCATGGTATG CATTtCCGTGTACTGGCTAA AGCATTGCGTATGTCcGGTG
Keteleeri  CTTcTTCACATTCACCGCGC GATGCATGCAGTTATTGACA GACAAAGAAATCATGGTATG CATTTCCGTGTACTGGCTAA AGCATTGCGTATGTCCGGTG
Pseudolar  cttcttcacattcaccgcgc gatgcatgcagttattgaca gacaaagaaatcatggtatg catttccgtgtactggctaa agcattgcgtatgtccggtg
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  CTTCTTCACATTCACCGCGC GATGCATGCAGTTATTGACA GACAAAGAAATCATGGTATG CTTTTTCGTGTACTGGCTAA AGCATTGCGTATGTCCGGTG
    Tsuga  cttcttcacattcaccgcgc gatgcatgcagttattgaca gacaaagaaatcatggtatg cattttcgtgtactggctaa agcattgcgtatgtccggtg
    Larix  cttcttcacattcaccgcgc gatgcatgcagttattgaca gacaaagaaatcatggcatg catttccgtgtactggctaa agcattgcgtatgtccggtg
Pseudotsu  CTTCTTCACATTCACCGCGC GATGCATGCAGTTATTGACA GACAAAGAAATCATGGCATG CACTTCCGTGTACTGGCTAA AGCATTGCGTATGTCCGGTG
  Cathaya  CTTCTTCACATTCACCGCGC GATGCATGCAGTTATTGACA GACAAAAAATTCATGGTATG CATTTCCGTGTACTGGCTAA AGCATTGCGTATGTCCGGCG
    Picea  CTTCTTCACATTCACCGCGC GATGCATGCAGTGATTGACA GACAAAAAAATCATGGTATG CACTTCCGTGTACTGGCTAA AGCATTGCGTATGTCCGGTG
Pinuscemb  CTTCTTCACATTCACCGCGC GATGCATGCAGTTATTGACA GACAAAGAAATCATGGTATG CATTTCCGTGTACTGGCTAA AGCATTGCGTATGTCCGGTG
Pinusstro  CTTCTTCACATTCACCGCGC GATGCATGCAGTTATTGACA GACAAAGAAATCATGGTATG CATTTCCGTGTACTGGCTAA AGCATTGCGTATGTCCGGTG
Pinuspond  CTTCTTCACATTCACCGCGC GATGCATGCAGTTATTGACA GACAAAGAATTCATGGTATG CATTTCCGGGTACTGGCTAA AGCATTGCGTATGTCCGGTG
Pinussylv  CTTCTTCACATTCACCGCGC GATGCATGCAGTTATTGACA GACAAAGAAATCATGGTATG CATTTCCGGGTACTGGCTAA AGCATTGCGTATGTCCGGTG
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  cttcttcatattcaccgcgc aatgcatgcagttattgaca gacaaaaaattcatggtatg cactttcgtgtgctggctaa agcattgcgtatgtctggtg
Podocarpu  cttcttcacattcaccgcgc aatgcatgcagttattgata gacaaagaaatcacggtatg cactttcgtgtactagctaa agcgttgcgtatgtctgggg
Amentotax  cttcttcacattcaccgcgc aatgcatgcagttattgaca gacaaagaaatcatggtatg cacttccgtgtgctggctaa agcactgcgtatgtctggtg
Cryptomer  cttcttcacattcaccgcgc aatgcatgcagttattgaca gacaaagaaatcatggtatg cacttccgtgtactggctaa agcactacgtatgtctggtg
Sciadopit  cttcttcacattcaccgcgc gatgcatgcagttattgaca gacaaagaaatcatggtatg catttccgtgtgctggctaa agcactacgtatgtctggtg
   Ginkgo  cttcttcacattcaccgcgc aatgcatgcagttattgaca gacaaagaaatcatggtatg catttccgtgtactagctaa agcattgcgtatgtctggtg

   Cedrus  GAGATCATATTCACGCCGGT ACTGTAGTAGGTAAACTTGA AGGGGAACGAGATGTTACTT TAGGATTTGTTGATCTACTG CGTGATGATTTTATCGAAAA
    Abies  GAGATCATATTCACGCCGGT ACTGTAGTAGGTAAACTTGA AGGGGAACGAGACGTTACTT TAGGGTTTGTTGATCTACTG CGTGATGATTTTATCGAAAA
Keteleeri  GAGATCATATTCACGCCGGT ACTGTAGTAGGTAAACTTGA AGGGGAACGAGACGTCACTT TAGGGTTTGTTGATCTACTG CGTGATGATTTTATTGAAAA
Pseudolar  gagatcatattcacgccggt actgtagtaggtaaacttga aggagaacgagacgtcactt tagggtttgttgatctactg cgtgatgattttatcgaaaa
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  GAGATCATATTCACGCCGGT ACTGTAGTAGGTAAACTTGA AGGAGAACGAGACGTCACTT TAGGGTTTGTTGATCTACTG CGTGATGATTTTATCGAAAA
    Tsuga  gagatcatattcacgccggt actgtagtaggtaaacttga aggagaacgagaagtcactt tagggtttgttgatctactg cgtgataattatatcgaaaa
    Larix  gagatcatattcacgccggt actgtagtaggtaaacttga aggggaacgagacgtcactt tagggtttgttgatctactg cgtgatgattttattgaaaa
Pseudotsu  GAGATCATATTCACGCCGGT ACTGTAGTAGGTAAACTTGA AGGGGAACGAGACGTCACTT TAGGGTTTGTTGATCTACTG CGTGATGATTTTATCGAAAA
  Cathaya  GAGATCATATTCACGCCGGT ACTGTAGTAGGTAAACTTGA AGGGGAACGAGACGTCACTT TAGGGTTTGTGGATCTACTG CGTGATGATTTTATTGAAAA
    Picea  GAGATCATATTCACGGCGGT ACTGTAGTAGGTAAACTTGA AGGGGAACGAGACATCACTT TAGGGTTTGTTGATCTACTG CGTGATGATTTTATCGAAAA
Pinuscemb  GAGATCATATTCACGCCGGT ACTGTAGTAGGTAAACTTGA AGGGGAACGAGACGTCACTT TAGGGTTTGTTGATCTACTG CGTGATGATTTTATCGAAAA
Pinusstro  GAGATCATATTCACGCCGGT ACTGTAGTAGGTAAACTTGA AGGGGAACGAGACGTCACTT TAGGGTTTGTTGATCTACTG CGTGATGATTTTATCGAAAA
Pinuspond  GAGATCATATTCACGCCGGT ACTGTAGTAGGTAAACTTGA AGGGGAACGAGACGTAACTT TAGGGTTTGTTGATCTACTG CGTGATGATTTTATCGAAAA
Pinussylv  GAGATCATATtCACGCCGGT ACTGTAGTAGGTAAACTTGA AGGGGAACGAGACGTAACTT TAGGGTTTGTTGATCTACTG CGTGATGATTTTATCGAAAA
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  gagatcatgttcacgctggt actgtagtaggtaaacttga aggtgaacgagaagtcactt taggttttgttgatctacta cgtgatgattttattgaaaa
Podocarpu  gagatcatattcacgccggt actgtagtaggtaaactcga aggagaacgagaagtaactt tgggttttgtggatctgcta cgtgatgattttattgaaaa
Amentotax  gagatcatattcacgctggt actgtagtaggtaaacttga aggagaacgagaagtcactc taggttttgttgatctattg cgtgatgattttattgaaaa
Cryptomer  gagatcatattcacgctggt actgtagtaggtaaacttga aggagaacgggaagtgactt tgggttttgttgatctattg cgtgatgattttattgaaaa
Sciadopit  gagatcatattcacgctggt actgtagtaggtaaacttga aggagaacgagaagtcactt tgggttttgttgatttactg cgtgatgattttattgaaaa
   Ginkgo  gagatcatattcacgccggt actgtagtaggtaaacttga aggagaacgagaagtcactc tgggttttgttgatctactg cgtgatgattttattgaaaa

   Cedrus  AGATCGAAGTCGTGGTATTT ACTTCACTCAAGATTGGGTA TCTATGCCAGGTGTTTTGCC CGTAGCTTCAGGAGGTATTC ACGTTTGGCATATGCCTGCT
    Abies  AGATCGAAGTCGTGGTATTT TCTTCACTCAAGATTGGGTA TCTATGCCAGGTGTCCTGCC CGTAGCTTCAGGAGGTATTC ACGTTTGGCATATGCCTGCT
Keteleeri  AGATCGAAGTCGTGGTATTT ACTTCACTCAAGATTGGGTA TCTATGCCAGGTGTCCTGCC CGTAGCTTCAGGAGGTATTC ACGTTTGGCATATGCCTGCT
Pseudolar  agatcgaagtcgtggtattt acttcactcaagattgggta tctatgccaggtgttctgcc cgtagcttcaggaggtattc acgtttggcatatgcctgct
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  AGATCGAAGTCGTGGTATTT ACTTCACTCAAGATTGGGTA TCTATGCCAGGTGTTCTGCC GGTAGCTTCAGGAGGTATTC ACGTTTGGCATATGCCTGCT
    Tsuga  agatcgaagtcgtggtattt acttcactcaagattgggta tctatgccaggtgttctgcc cgtagcttcaggaggtattc acgtttggcatatgcctgct
    Larix  agatcgaagtcgtggtattt acttcactcaagactgggta tctatgccaggtgttctgcc cgtagcttcaggaggtattc acgtttggcatatgcctgct
Pseudotsu  AGATCGAAGTCGTGGTATTT ACTTCACTCAAGATTGGGTA TCTATGCCAGGTGTTTTGCC CGTAGCTTCAGGAGGTATTC ACGTTTGGCATATGCCTGCT
  Cathaya  AGATCGAAGTCGTGGTATTT ACTTCACTCAAGATTGGGTA TCTATGCCAGGTGTCCTGCC CGTAGCTTCAGGAGGTATTC ACGTTTGGCATATGCCTGCT
    Picea  AGATCGAAGTCGTGGTATTT ACTTCACTCAAGATTGGGTA TCTATGCCAGGTGTCCTGCC CGTAGCTTCAGGAGGTATtC aCGTTTGGCATATGCCTGCT
Pinuscemb  AGATCGAAGTCGTGGTATTT ACTTCACTCAAGATTGGGTA TCTATGCCAGGCGTTCTGCC CGTAGCTTCAGGAGGTATTC ACGTTTGGCATATGCCTGCT
Pinusstro  AGATCGAAGTCGTGGTATTT ACTTCACTCAAGATTGGGTA TCTATGCCAGGCGTTCTGCC CGTAGCTTCAGGAGGTATTC ACGTTTGGCATATGCcTGCT
Pinuspond  AGATCGAAGTCGTGGTATTT ACTTCACTCAAGATTGGGTA TCTATGCCAGGTGTTCTGCC CGTAGCTTCAGGAGGTATTC ACGTTTGGCATATGCCTGCT
Pinussylv  AGATCGAAGTCGTGGTATTT ACTTCACTCAAGATTGGGTA TCTATGCCAGGTGTTCTGCC CGTAGCTTCAGGAGGTATTC ACGTTTGGCATATGCCTGCT
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  agaccgaagtcgtggtattt attttactcaagattgggta tctatgccaggtgttttgcc tgtagcttcagggggtattc acgtttggcatatgcctgct
Podocarpu  agaccgaagtcgtggtattt atttcactcaagattgggta tctatgccaggtgtcctacc tgtagcttcggggggtattc atgtttggcatatgcctgct
Amentotax  agaccgaagtcgtggtattt atttcacccaagattgggtc tctatgccaggtgtcttgcc tgtagcttcaggaggtattc acgtttggcatatgcctgct
Cryptomer  agaccgaagtcgtggtattt atttcactcaagattgggtc tctatgccgggtgttctgcc tgtagcttcaggaggtattc acgtttggcatatgcctgct
Sciadopit  agatcgaagccgtggtattt atttcactcaagattgggta tctatgccaggtgttttgcc tgtggcttcagggggtattc acgtttggcatatgcctgct
   Ginkgo  agaccgaagtcgtggtattt atttcactcaagattgggta tctatgccaggtgttctgcc cgtagcttcagggggtattc acgtctggcatatgcctgct

   Cedrus  CTGACCGAGATCTTTGGGGA TGATTCCGTACTACAGTTTG GTGGGGGAACTTTGGGACAC CCTTGGGGAAATGCACCTGG TGCAGTAGCTAATCGGGTTG
    Abies  CTGACCGAGATCTTTGGAGA TGATTCCGTACTACAGTTTG GTGGGGGAACTTTGGGACAC CCTTGGGGAAATGCACCTGG TGCAGCAGCTAATCGGGTTG
Keteleeri  CTGACCGAGATCTTTGGAGA TGATTCCGTACTACAGTTTG GTGGGGGAACTTTGGGACAC CCTTGGGGAAATGCACCTGG TGCAGTAGCTAATCGGGTTG
Pseudolar  ctgaccgagatctttggaga tgattctgtactacagtttg gtgggggaactttgggacac ccttggggaaatgcacctgg tgcagtagctaatcgggttg
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  CTGACCGAGATCTTTGGAGA TGATTCTGTACTACAGTTTG GTGGGGGAACTTTGGGACAC CCTTGGGGAAATGCACCTGG TGCAGTAGCTAATCGGGTTG
    Tsuga  ctgaccgagatctttggaga tgattctgtactacagtttg gtgggggaactttgggacac ccttggggaaatgcacctgg tgcagtagctaatcgggttg
    Larix  ctgaccgagatctttgggga tgattccgtactacagtttg gtgggggaactttggggcac ccttggggaaatgcgcctgg tgcagtagctaatcgggttg
Pseudotsu  CTGACCGAGATCTTTGGGGA TGATTCCGTATTACAGTTTG GTGGGGGAACTTTAGGGCAT CCTTGGGGAAATGCACCCGG TGCAGTAGCTAATCGGGTTG
  Cathaya  CTGACCGAAATCTTTGGGGA TGATTCCGTACTACAGTTTG GTGGGGGAACTTTGGGGCAC CCTTGGGGAAATGCACCTGG TGCAGTAGCTAATCGGGTTG
    Picea  CTGACCGAGATCTTTGGGGA TGATTCCGTACTACAGTTTG GTGGGGGAACTTTGGGACAC CCTTGGGGAAATGCACCTGG tGCAgTAgCTAATCGAGTTG
Pinuscemb  CTGACCGAGATCTTTGGGGA TGATTCCGTACTACAGTTTG GTGGGGGAACTTTGGGACAT CCTTGGGGAAATGCACCTGG TGCAGTAGCTAATCGGGTTG
Pinusstro  CTGACCGAGATCTTTGGGGA TGATTCCGTACTACAGTTTG GTGGGGGAACTTTGGGACAT CCTTGGGGAAATGCACCTGG TGCAGTAGCTAATCGGGTTG
Pinuspond  CTGACCGAGATCTTTGGGGA TGATTCCGTACTACAGTTTG GTGGGGGAACTTTGGGACAT CCTTGGGGAAATGCACCTGG TGCAGTAGCTAATCGGGTTG
Pinussylv  CTGACCGAGATCTTTGGGGA TGATTCCGTACTACAGTTTG GTGGGGGAACTTTGGGACAT CCTTGGGGAAATGCACCTGG TGCAGTAGCTAATCGGGTTG
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  ctgaccgagatctttgggga tgattctgtattacagtttg gtgggggaactttgggacac ccttggggaaatgcacctgg tgaggtagctaatcgggtcg
Podocarpu  ctgaccgagatctttgggga tgattctgtattacagtttg gtggaggaactttagggcac ccttggggaaatgcacctgg tgcagtagctaatcgggttg
Amentotax  ctgaccgagatctttgggga tgattctgtattacagtttg gtggagggactttggggcac ccttggggaaatgcacctgg tgcagtagctaatcgagtcg
Cryptomer  ctgaccgagatctttgggga tgattccgtattacagttcg gtggagggactttggggcac ccttggggaaatgcacctgg tgcagtggctaatcgggtcg
Sciadopit  ctgactgagatctttgggga cgattctgtattacagttcg gtgggggaactttggggcat ccgtggggaaatgcgcctgg tgcagtagctaatcgagtcg
   Ginkgo  ctgaccgagatctttgggga tgattctgtactacagtttg gtgggggaactttgggacac ccttggggaaatgcacctgg tgcagtagctaatcgggtcg

   Cedrus  CTCTAGAAGCTTGTGTACAA GCTCGTAATGAAGGACGTGA TCTTGCTCGTGAAGGTAATG AAtcaagttcctccgaaccg atggaacatttcagtttcaa
    Abies  CTCTAGAAGCTTGTGTACAA GCTCGTAATGAAGGACGTGA TCTTGCTCGTGAAGGTAATG AAtCAaGTTCcTCTgAATCG aTGGAACATTTAAGTTCCAA
Keteleeri  CTGTAGAAGCTTGTGTACAA GCTCGTAATGAAGGACGTGA TCTTGCTCGTGAAGGTAATG AATCAaGTtCCTCTgAATCG aTGGAACATTTTAGTTCCAA
Pseudolar  ctctagaagcttgtgtacaa gctcgtaatgaaggacgtga tcttgctcgtgaaggtaatg aatcaagttcctctgaaccg atggaacatttaagctccaa
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  CTCTAGAAGCTTGTGTACAA GCTCGTAATGAAGGACGTGA TCTTGCTCGTGAAGGTAATG AAtcaagttcctctgaaccg atggaacatttaagttccaa
    Tsuga  ctctcgaagcttgtgtacaa gctcgtaatgaaggacgtga tcttgctcgtgaaggtaatg aatcaagttcctctgaaccg atggaacatttaagttccaa
    Larix  ctctagaagcttgtgtacaa gctcgtaatgaaggacgtga tcttgctcgtgaaggtaatg aatcgagttcctccgaaccg atggaacatgtaagttccaa
Pseudotsu  CTCTAGAAGCTTGTGTACAA GCTCGTAATGAAGGACGTGA TCTTGCTCGTGAAGGTAATG AAtcgagttcctccgaaccg atggaacatgtaagttccaa
  Cathaya  CTCTAGAAGCTTGTGTACAA GCTCGTAATGAAGGACGTGA TCTTGCTCGTGAAGGTAAtG AAttgagttcccctgaaccg agggaacatttcagttccaa
    Picea  CTCTAgAAGCTTGTGTACaA GCTCGTAATGAAgGACGTGA TCTTGCTCGTGAAGGTAATG AAtcgagttcctccgaaccg atggaacatttaagttccaa
Pinuscemb  CTCTAGAAGCTTGTGTACAA GCTCGTAATGAAGGACGTGA TCTTGCTCGTGAAGGTAATG AATCAAGTTCTTCCGAACCG ATGGAACATTTAAGTTCCAA
Pinusstro  CTCTAGAAGCTTGTGTACAA GCTCGTAATGAAGGACGTGA TCTTGCTCGTGAAGGTAATG AATCAAGTTCTTCCGAACCG ATGGAACATTTAAGTTCCAA
Pinuspond  CTCTAGAAGCTTGTGTACAA GCTCGTAATGAAGGACGTGA TCTTGCTAGGGAAGGTAATG AAtCAAGTtCCtCCagaCCG AtgGAaCATTtAAGTTCCAa
Pinussylv  CTCTAGAAGCTTGTGTACAA GCTCGTAATGAAGGACGTGA TCTTGCTCGTGAAGGTAATG AATCAAGTTCCTCCAGACCG ATGGAACATTTAAGTTCCAA
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  ctttagaagcttgtgtacaa gctcgtaatgaaggacgtga tcttgctcgtgaaggtaatg aatcgagttcttctgaaccg gcggaaatttgcatttccaa
Podocarpu  ctttagaagcttgtgtagaa gctcgtaatgagggacgtga tcttgctcgtgaaggtaatg aagcaaattgctttgaaccc tcggaaattaggatttccaa
Amentotax  ctttagaagcctgtgtacaa gcgcgtaatgaaggacgtga tcttgctcgtgaaggtaatg aatcaagttccttcgaacgg acggaaattttaatttctaa
Cryptomer  ctttagaagcttgtgtacaa gctcgtaatgaaggacgtga tcttgcgcgtgaaggtaatc aatctggttcctccgaacca acggaaattttagtttctaa
Sciadopit  ctttagaagcttgtgtacaa gctcgtaatgaaggacgcga tcttgctcgtgaaggtaatg aatcaagtttctccgaaccg ttggaaaatttcctttccaa
   Ginkgo  ccctagaagcttgtgtacaa gctcgtaatgaaggacgtga tcttgctcgtgaaggtaatg aatcgagttgcttcgaaccg atggaaaattcaagttccaa

   Cedrus  tgatcaattaagtttcctaa ctgtaaaacgtttgattggt cgaatacgtgaacagaatca ttcaattggtttattcgtga attgcgatccaaatccat--
    Abies  TGATCAATTCAGTTTCCTAA CTGTAAAACGTTTGATTGGT CAAATACGTCAACAGAATAA TTCCATTGTTTTCTTTTTGA ATTGCGATCCAAATCCAT--
Keteleeri  TGATCAATTCAGTTTCCTAA CTGtAAAACGTTTGATTGGT CAAATACGTCAACAGAATCA TTCAATTGTTTTATTTTTGA ATTGCGATTCAAATCCAT--
Pseudolar  tgatcaattcagtttcctaa ctgtaaaacgtttgattggt caaatacgtcaacagaatca ttcaattgtgttattcgtga attgcgatccaaatccatta
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  tgatcaatttagtttcctaa ctgtaaaacgtttgattggt caaatacgtcaacagaatca ttcaattttttcattcgtga attgcgatccaaatccat--
    Tsuga  tgataaattaagtttcctaa ttgtaaaacgtttgattggt caaatacgtaaacagaataa ttcaatttttttatttgtga attgcgatccaaatccat--
    Larix  tgatcaattcagtttcctaa ctgtaaaacgtttgattggt caaatacgtcaacagaatca ttcaattgttttattcgtga attgtgatccaaatccat--
Pseudotsu  tgatcaattcagtttcctaa ctgtaaaacgtttgattggt caaatacgtcaacaaaatca ttcaatttttttattcgtga atcgtgatccaaatccat--
  Cathaya  tgatcaattcagtttcctaa ctataaaacggttgattggt caaatacgtcaacagaatca ttcaatttttttattcgtga attgcgattcaaatccat--
    Picea  tgatcagttcagtttcctaa ctgtaaaacgtttgattggt caaatacgtcaacagaatca ttcaattgttttattcgtga attgcgatccaaatccat--
Pinuscemb  TGATCAATTCAGTTTCCTAA CTGTAAAACGTTTGATTGGT AAAATACGTCAACAAAATCA TTCAATTGTTTTATTCGTGA ATTGCGCTCCAAATCCAT--
Pinusstro  TGATCAATTCAGTTTCCTAA CTGTAAAACGTTTGATTGGT CAAATACGTCAACAAAATCA TTCAATTGTTTTATTCGTGA ATTGCGCTCCAAATCCAT--
Pinuspond  TGATCAATTAAGTTTCCTAa CTGtAAAACGTTTGATTGGT CAAATACGTCAACAAAATCA TTCAATTGTTTTATTCGTGA ATTGCGATCCAAATCCAT--
Pinussylv  TGATCAATTAAGTTTCCTAA CTGTAAAACGTTTGATTGGT CAAATACGTCAACAAAATCA TTCAATTGTTTTATTCGTGA ATTGCGATCCAAATCCAT--
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  tgat---tttagttttttaa ctgtaaaacgttcgattagt cggatacgtcaacagaatga gtcaattgttttattttgga attgtgatcgaaatcaat--
Podocarpu  tgag---tttagttttctaa ctgtaaaacgttcaattaat cgcatacgtaaagtaaaaga ttctattttcttatttcgga atttaa---------aat--
Amentotax  ttat---tttagtttcctaa ctgtaaaacgtttgattcgt cggatacgtcaacagaatga ttcaactggtttattcggga attgtgatccaaatcaat--
Cryptomer  tttc---ttgagtttcctaa ctgtaaaacgttcaattcgt cggatgcgtaaacaaactaa ttccattagtttattcggga attccgatccaaataaat--
Sciadopit  ggag---tttagtttcctaa ctgtaaaacgtttgattcgt cggatacgtcaacagaacaa ttcaattgttttatccggta attgcgatccaaatgaaa--
   Ginkgo  cgatcgatttagtttcctaa ctgtaaaacgtttgattagt cgaatacatcaacagaatga tttaatcatttcatttttga attgcgatcaaaatccat--

   Cedrus  ----tagttgatcgcaacaa gagttcctattttgaatcgg tactagaaggactgacattg gtcctggaagttccgttctc tacacggtcaaaatattctg
    Abies  ----TAGTTGATCGCAACAA GAGTTTCTATTATGAATCGG TACTAGAAGGACTTACATTG GTCCTGGAAGTTCCGTTCTC TATACGGTCGAAATATTCTG
Keteleeri  ----TAGTTGATCGCAACAA GAGTTCCTATTCTGAATCGG TACTAGAAGGACTGACATTG GTCCTGGAAGTTCCGTTCTC TATACGGTCGAAATATTCTG
Pseudolar  gttgaagttgatcgcaacaa tagttcctattctgaatcgg tactagaaggacttacattg gtcctggaagttccgttctc tatacggtcaaaatattctg
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  ----tagttgatcgcaacaa gagttcctattctgaatcgg tactagaaggactgacattg gtcctggaagttccgttttc tatacggtcaaaatattctg
    Tsuga  ----tagttaatcacaacaa gagttcctattctgaatcgg tactagaaggactgacattg gtcctggaagttccgttctc tatacggtcaaaatattctg
    Larix  ----tagttgaacgcaacaa gagttcctattatgaatcgg tactagaaggacttacattg gtcctggaagttccgttctc tatacggtcaaaatattctg
Pseudotsu  ----tagttgatcgcaacaa gagttcctattctgaatcgg tactagaaggacttacattg gtcctggaagttccgttctc tatacggtcaaaaaattctg
  Cathaya  ----tagttgatcgcaataa aagttcctattctgaatcgg tgctagaaggacttacattg gtcctggaagttccgttctc tatacggccaaaatattctg
    Picea  ----tagttgatcgcaagaa gagttcctattctgaatcgg tactagaaggactgacattg gtcctggaagttccgttctc tatacggtcaaaatattctg
Pinuscemb  ----TAGCTTATTGCAAGAA GAGTTCCTATTCTGAATCGG TACTAGAAGGACTTACATTG GTCCTGGAAGTTCCGTTCTC TATACGGTCAAAATATTCTG
Pinusstro  ----TAGCTGATTGCAAGAA GAGTTCCTATTCTGAATCGG TACTAGAAGGACTTACATTG GTCCTGGAAGTTCCGTTCTC TATACGGTCAAAATATTCTG
Pinuspond  ----TAGCTGATCGCAAGAA GAGTTTCTATTCTGAATCGG TACTAGAAGCACTTACATTG GTCCTGGAAGTTCCGTTCTC TATATGGTCAAAATATTCTG
Pinussylv  ----TAGCTGATCGCAAGAA GAGTTTCTATTCTGAATCGG TACTAGAAGCACTTACATTG GTCCTGGAAGTTCCGTTCTC TATATGGTCAAAATCTTCTG
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  ----ggattgatcgcaatag gagttcttcttctgaattga tattagaaggcttggtagtg gtcttggaaatttcgttttc aatgcgattaaaacattctc
Podocarpu  ----ggatggatcacaatag gaattcttattccttcttga tattagaaggctttactgtg gtcttggaagtttcattctc aatgcgagccaaatattct-
Amentotax  ----ttattgatcgcaatag aaattcttattctgaatcgg tattagaagctttgacagtt atcttggaagtttcgttcgc aatgcgatcaaaacatttty
Cryptomer  ----tgattgaatgcaataa gaatttttattctaaatcga tactagaaggttttacaatt gtcttggaagtttcgttcgc aatgcgatcaaaacatttca
Sciadopit  ----tgattaatcgcaatca gaattcttattctgaattga tactagaaagtttggcagtg gtctcggaagtttcgttctc aatgcgatcaaaaccttttc
   Ginkgo  ----ttgttggtcacaacag cagtttctattctgaattgg tactagaaggtccgacagtg gttctggaagttccgttctt gatgcgatcgaaacattctc

   Cedrus  tgcaagggataaaagaatgg aagagtttccgatcgatcca ttcaatatttcccttcttag aggagaaattcccgcattct aattatatattagatacacg
    Abies  TGGAAGGGATGAATGACTGG AAGAGTTTCCGATCGATCCA TTCAATATTTCCCTTCTTGG AAGATAAATTCCCGCATTCT AATTATATATTAGATACACG
Keteleeri  TGGAAGGGATGAATGAATGG AAGAGTTTCCGGTCGATCCA TTCAATATTTCCCTTCTTGG AAGAGAAATTCCCGCATTCT AATTATATATTAGATACACG
Pseudolar  tggaagggacgaatgaatgg aagagtttccggtcgatcca ttcaatatttcccttcttgg aagataaatttccgcattca aattatatattagatacaca
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  tggaagggatgaatgaatgg aagagtttccggtcgatcca ttcaatatttcccttcttgg aagataaattcccgcattca aattatatattagataaacg
    Tsuga  tggaagggattaatgaatgg aagagtttccggtcgatcca ttcaatatttcccttcttgg aagataaattcccgcattca aattatatattagatacacg
    Larix  tggaagggataaatgaatgg aagagtttccggtcgatcca ttcaatatttcccttcttgg aagataaattcccgcattca aattatatatcagatacacg
Pseudotsu  tggaagggattaatgaatgg aagagtttccggtcgatcca ttcaatatttcccttcttgg aagataaattcccgcattca aattatatatcagatacacg
  Cathaya  tggaaggtatgaatgaatgg aagagcttccggtcgatcca ttcaatatttcccttcttgg aggagaaattcccgcattca aattatatatcagatacacg
    Picea  tggaagggatgaatgaatgg aagagtttccggtcgatcca ttcaatatttcccttcttgg aggataaattcccgcattca aattatgtatcagatacacg
Pinuscemb  TGGAAGGGATGAATGAATGG AAGAGTTTCCGGTCGATCCA TTCAATATTTCCCTTCTTGG AGGATAAATTCCCGCATTCC AATTATATATCAGATGCACG
Pinusstro  TGGAAGGGATGAATGAATGG AAGAGTTTCCGGTCGATCCA TTCAATATTTCCCTTCTTGG AGGATAAATTCCCGCATTCA AATTATATATCAGATGCACG
Pinuspond  TGGAAGGGATGAATGAATCG AAGAGTTTCCGGTCGATCCA TTCAATATTTCCCTTCTTAG AGGATAAATTCCCGCATTCA AATTCTATATTAGATGCACG
Pinussylv  TGGAAGGGATGAATGAATGT AAGAGTTTCCGGTCGATCCA TTCAATATTTCCCTTCTTAG AGGATAAATTCCCGCATTCA AATTCTATATTAGATGCACG
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  tagaagttatgaatggatgg aagagtttccgatccgccca tagcctatttcctcttatgg aggagaaattcccacattct aattatatattagatatacg
Podocarpu  --aaatgtatgaatggatgc aaaagtttccgatccatcca tggcctattccctcttatag aagataaattcccacattca aattatatatcagatatacg
Amentotax  tagaaggaattaatggatgg aagagtatccgatccattca ttgcatatttccccttatgg aggataaattcccatattcc aattatatatcagatatacg
Cryptomer  tagaaggaatgaatgggtgg aatagtctccgatccatcca ttgcctatttcctcttatgg aggataagttaccgcattcc aattatatatcagatatacg
Sciadopit  tagaaggaataaatgaatgg aagagttttcgatccatcca ttgtctatttccttttatgg aggataaattaccacataca aattatatatcagatatacg
   Ginkgo  tagaaaaaaagaatgaatgg aagagtttccgatctattca ttcgatattttcctttatgg aggacaaatttccacatccc aattcgatctcggatatgcg

   Cedrus  aataccctattctattcatc cggaatttttggttcgaacc tttcgtcgctggatccaaga tgctccctccttgcacccat tacgatctgttctctatgaa
    Abies  AATACCCTATTCTATTCATC CGGAAATTTTGGTTCGAACC TTTCGTCGCTGGATCCGAGA TGCTCCCTCCTTGCACCCAT TACGATCTGTTCTCTATAAA
Keteleeri  AATACCCTATTCTATTCATC CGGAAATTTTGGTTCGAACC TTTCGTCGCTGGATCCGAGA TGCTCCCTCCTTGCAcCCAT TACGATCTGTTCTCTATAAA
Pseudolar  aataccctattctattcatc cggaaattttggttcgaacc tttcgtcgctggatccgaga tgctccctccttgcacccat tacgatctgttctctataaa
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  aataccctattctattcatc cggaaattttggttcgaacc tttcgtcgctggatccgaga tgctccctccttgcatccat tacgatctgttctctataaa
    Tsuga  cataccctattctattcatc cggaaattttggttcgaacc tttcgtcgctggatccgaga tgctccctccttgcacccat tacgatctgttctctataaa
    Larix  aataccctattctattcatc cagaaattttggttcgaacc tttcgtcgctggatccgaga tgctccctccttgcacccat tacgatctgttctctatgaa
Pseudotsu  aataccctattctattcatc cggaaattttggttcgaacc tttcgtcgctggatccgaga tgctccctccttgcacctat tacgatctgttctctatgaa
  Cathaya  aataccctattctattcatc cggaaattttggttcgaacc tttcgtcgctggatcctaga tgcttcctccttgcacctat tacgatctgttctatatgaa
    Picea  aataccctattctattcatc cagaaattttggttcgaacc tttcgtcgctggatcggaga tgctccctccttgcacccat tacgatctattctctatgaa
Pinuscemb  AATACCCTATTCTATTCATC CAGAAATTTTGGTTCGAACC TTTCGTCGCTGGATCCGAGA TGCTCCCTCCTTGCACCCAT TACGCTCTGTTCTCTATGAA
Pinusstro  AATACCCTATTCTATTCATC CGGAAATTTTGGTTCGAACC TTTCGTCGCTTGATCCGAGA TGCTCCCTCCTTGCACCCAT TACGCTCTGTTCTCTATGAA
Pinuspond  AATaCCCTATTCTATTCATC CGGAAATTTTGGTTCGAACC TTTCGTCGCTGGATCCGAGA TGCTCCCTCCTTGCACCCAT TACGATCTGTTCTCTATGAA
Pinussylv  AATACCCTATTCTATTCATC CGGAAATTTTGGTTCGAACC TTTCGTCGCTGGATCCGAGA TGCTCCCTCCTTGCACCCAT TACGATCTGTTCTCTATGAC
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  agtaccctactctattcatc cagagattttggttcgagct tttcgtcgctggatccggga tgctccttctttgcatctat tacgacgcattctttatgaa
Podocarpu  aataccttacgctattcatc cagaaattttggttcgaatc tttcgtcgctggattcgaga cgctccttctttgcatctat tgcgatgcattctatatgaa
Amentotax  agtaccctactcgattcatc cagaacttttggtgcggacc tttcgtcgctggatccgaga tactccttctttgcatctat tacgattcattctccattca
Cryptomer  agtgccctactcaattcatc cggaaattttggttcgaatt tttcgtcgctggattcgaga tgctccttctttgcatttat tacgatccattctccatgaa
Sciadopit  aataccttactcaattcatc cagaaattttggttcgaact tttcgtcgctggatgcgaga tgtcccttctttgcatctat tacgatccattctccatgaa
   Ginkgo  aataccccactctattcatt cggaaatttttattcgaacc tttcgtcgctgggttcgaga tgctccttctttacacttat cacgatctgttctccacgaa

   Cedrus  tatcgaaat------agtcc agagaat---ttacaaagat cgattattgtcgctccgaga gtaaatacgagattcttcct gttcctgtggaatcattatg
    Abies  TATCGAAAT------AGTCC AGATAAT---TTACAAAGAT CAATTATTATCGCCCCGAGA GTAAATACAAGATTCTTGCT GTTCCTGTGGAATCATTATG
Keteleeri  TATCGAAAT------AGTCC AGAAAAT---tTCAAAAGAT CGATTATTGTCGCCCCGAGA GTAAATACAAGATTCTTGCT GTtCCTGTGGAATCATTATG
Pseudolar  tatcgaaatcgaaatagtcc agagaat---ttacaaagat caattattgtcgccccgaga gtaaatacaagattcttgct gttcctatggaatctttata
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  tatcgaaat------agtcc agagaataatttacaaagat cgattattatcgttccgaga gtaaatacaagattcttgct gttcctgtggaatcattatg
    Tsuga  tatcgaaat------agtcc agagaat---ttgaaaagat cgattattgtcgttccgaga gtaaatacaagattcttgct gttcctgtggaataattatg
    Larix  tatcgaaat------agtcc agagaat---ttacaaagat cgattattgtcgccccaaga gtgaatacgagatttttcct attcctgtggaatcattatg
Pseudotsu  tatcgaaat------agttc agaaaat---ttacaaagat cacttattgtcgccccgaga gtgaatacgagattcttcct gttcctgtggaatcattatg
  Cathaya  tatcgaaat------a---- --ataat---ttacaaagat cgattattgtcgtcccgaga gtaaatacgagattcttcct gttcctgtggaatcattatg
    Picea  tatcgaaat------agttc agagagt---ttacaaagat cgattattgtcgtcccgaaa gtaaatacgagattcttcct gttcctgtggaataattatg
Pinuscemb  TATCGAAAT------AGTCC AGAGAAT---TTACAAAGAT CAATTATTGTCGTCCCAAGA GTAAATACGAGATTATTCCT GTTCCTGTGGAATTATTATG
Pinusstro  TATCGAAAT------AGTCC AGAGAAT---TTACAAAGAT CAATTATTGTCGTCCCAAGA GTAAATACGAGATTCTTCCT GTTCCTGTGGAATTATTATG
Pinuspond  TATAGAAAT------AGTCC AGATAAT---TTACAAAGAT CAATTATTGTCGTCCCAAGA GTAAATACGAGATTCTTCCT GTTCCTGTGGAATTATTATG
Pinussylv  TATAGAAAT------AGTCC AGAGAAT---TTACAAAGAT CAATTATTGTCGTCCCAAGA GTAAATACGAGATTCTTCCT GTTCCTGTTGAATTATTATG
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  tgtcaaaacagttctaatgc agaaaat---ttgcagaaag ccattttggttgtcctgaga gaaaatacgaagttctacct gttcctatggaattcttatg
Podocarpu  tgtggaaatagttccagttc cgagaat---tcgcagaaag catttttggytagcctgaaa gagaataaaaatttatatat gttcttgtggaattcttatg
Amentotax  tggaaaaatagttttagtgc agaaaat---ttgcagaaag c---tatggttgcaccgaga gaaaatatgaggttatccct gttcctatggaattcttatg
Cryptomer  tggaaaaatagttttagtcg agaaaat---ttgcagaaag c---tctgattacacagata gaaaatacgaggttctccct gttcctttggaattcttatg
Sciadopit  tggagagatagttctagtac tgaaaac---ttgcagaaag c---tctggttgtttcggga gaaaaaacgaagttctccct gttcctgtggaattcttatg
   Ginkgo  catcggaat------agttc ggagaat---ttgtataaat cgattctcatcggctccgga agaaatacaaagttctttct gtttctgtggaattattatg

   Cedrus  tctatgaatgcgaatccatt ttagttccccttctgaaacg atcctttcagtcacggtcgt cgtctcatggatctttccct gagcgaactctttttgatcg
    Abies  TCTATGGATGTGAATCCATT CTAGTTCCCCTTCTTAAACG ATCCTTTCATCCACGATCGT CGTCTCATGGATCTTTcCCT GATCGAACTCATTTTGATCG
Keteleeri  TCTATGAATGCGAATCCATT CTAGTTCCCCTTCTTAAACA ATCCTTTCATCCACGAtCGt CGtCTCATGGATCTTtccct gagcgaactcattTTGATCG
Pseudolar  tttatgaatgcgaatccatt ttagttccccttcttaaacg atcctttcatccacgatcgt cgtctcatggatcttttcct gagcaaactcattttcatca
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  tttatgaatgcgaatccatt ttagttccccttcttaaacg atcttttcatccacgatcgt cgtctcatggatctttccct gagcgaactcattttcatcg
    Tsuga  tttatgaatgcgaatccatt ttagttccccttcttaaacg atcttttcatccacgatcgt cgtcttatggatctttccct gagcgaactcattttcatcg
    Larix  tctatgaatgcgaatccatt ttagttccccttcttaaacg atcctctcatttacgatcgt tgtctcatggatctttccct gagcgaactcattttgatcg
Pseudotsu  tctatgaatgcgaatccatt ttagttccccttcttaaacg atcctctcattcacgatcat tgtctcatggatctttccct gagcgaactcattttaatcg
  Cathaya  tttatgaatgcgaatccatt ttagttcctcttcttaaacg atcctctcattcacgatcgt tgtctcatggatctttccct cagcgaactctttttaatcg
    Picea  tctatgaatgcgaatccatt ttagtttcccttcttaaacg atcctctcattcacgatcgt tatctcatgggtctttccct cagcgaactcattttcatcg
Pinuscemb  TCTATGAATGCGAATCCATT TTATTTTCCCTTCTTAAACG ATCCTCTCATTCACGATCGT TGTCTCATAGATCTTTCCCT CAGCGAACTCATTTTCATCG
Pinusstro  TCTATGAATGCGAATCCATT TTCTTTTCCCTTCTTAAACG ATCCTCTCATTCACGATCGT TGTCTCATAGACCTTTCCCT CAGCGAACTCATTTTCATCG
Pinuspond  TCTGTGAATGCGAATCCATT TTATTTTCCCGTCTTAAACG ATCCTCTCATTCACGATCGT TGTCTCATGGATCTTTCCCT CAGCGAACTCATTTTCATCG
Pinussylv  TCTGTGAATGCGAATCCATT TTATTTTCCCGTCTTAAACG ATCCTCTCATTCACGATCGT TGTCTCATGGATCTTTCCCT CAGCGAACTCATTTTCATCG
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  gttatgaatgcgaatccatt ttagttcctcttctgaaacg atcttctcattcacggtcgt tgtcctatggatcttttccc gatcgaactcattttgatcg
Podocarpu  tttgtgaatgtgaatccatt ctagttccccttatgaagcg attttctcattcacaattgt tgtcctatgggtctcttccc gaacgaactcattttaatcg
Amentotax  tatatgaatgcgaatccttt ttagttcctcttctgaaacg attttctcattcacaatcgt tgttgtatggatcttttccc aatygraatcattttgttcg
Cryptomer  tgtatgaatgcgaatcgttt ttaattcctcttattaaacg attttttaattcacaatcgt tgttatatggatcttttccc gatcgaactcattttgataa
Sciadopit  tatatgaatgggaatccatt ttaattccccttctgaaacg atcttctcattcacgctctt tgttatcaggattttttcct gatcgaaccctttttgatca
   Ginkgo  cttatgaatgtgaatctctc ctagttccccttcggaaacg atcttctcattcacgattgt tgtcctatggagcttttctc gagcaaattcattcttatcg

   Cedrus  aaagataaaacatattatca gaatttcccatcgaaattca ttgaaaagtatctggtcgtt gaaggatcctaaaattcact atgtgaggtatggagaaaga
    Abies  AAAGATCAAACATATTATCA GAAATTCTCGTCGAAATTCA CTGAAAAGTATCTGGTCGTt GAAGGATCCTAGAaTTCACT ATGTtAGATATGCAGAAAGA
Keteleeri  AAAGATCAAAAATATTATCA GAaTTTCTcGtCGAAATTCA CTGaAAAGTATCTGGTCGTT GAAGGATCCTAGAATTCACT ATGTTAGATATGGAGAAAGA
Pseudolar  aaagatcaaaaatattatca gaatttctcgtcgaaattca ctgaaaagtatctggtcgtt gaaggatcctaaaattaact atgttagatatgaagaaaga
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  aaaggtcaaacatattatca gaatttttcgtcgaaattca ctgaaaagtatctggtcgtt gaaggatcctaaaattcact atgttagatatggagaaaga
    Tsuga  aaaagtaaaacatattatca gaaattttcgtcgaaattca ctgaaaagtatctggtcgtt gaaggatcctaaaattcact atgttagatatggagaaaga
    Larix  aaagatcaaacatattatca tattttctcgtcgaaattca ctgaaaaggatctggtcgtt gaaggatcctaacattcact attttagatatggagaaaga
Pseudotsu  aaagataaaacatattctca tattttctcgtcgaaattca ctgaaaaggatctggtcgtt gaaggatcctaacattcact atgttagatatggagaaaga
  Cathaya  aaaaataaaaaatattttcc tattttctcgtcgaaattca ctgaaaagtatctggtcgtt gaaggatcctaacattcact atgttagatacggagaaaga
    Picea  aaaaataaaaaatatttttc tattttctcgtcgaaattca tttcaaagtatctggtcgtt gaaggatcctaacattcact atgttagatatggagaaaga
Pinuscemb  AAAGATAAAACATATTATCA TATTTTCTCGTCGAAATTCA CTGAAAAGTATCTGGTTGTT GAAGGATCCTAAAATTCACT ATGTTAGATATGGTGAAAGA
Pinusstro  AAAGATAAAACATATTATCA TATTTTCTCGTCGAAATTCA CTGAAAAGTATCTGGTTGTT GAAGGATCCTAAAATTAACT ATGTTAGATATGGTGAAAGA
Pinuspond  AAAGATAAAACATATTATCA TATTTtCTcGTCGAAATTCA CTGAAAAGTATCTGGTCGTT GAAGGATCCTAAAATTCACT ATGTTAGATATGGCGAAAGA
Pinussylv  AAAGATAAAACATATTATCA TTTTTTCTCGTCGAAATTCA CTGAAAAGTATCTGGTCGTT GAAGGATCCTAAAATTCACT ATGTTAGATATGGCGAAAGA
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  aaagatcaaacatattctaa tatttccgcgtaaaaattca aggaaaaagatctggttgtt aaaggatcctttcattcact atgtgagatatggagaaaga
Podocarpu  aaaaatcaagcatattctca tatttcgttgtacaacttca acgaaaaggatctggttctt aaaggatcctttctttaact atgtgagatatcgagaaaga
Amentotax  aaagatcaaacatattgtca tatttcccatcaatatttca acgraaaggatctggttgtt gaaggatcctttcatccaat atgttagatatggagaaaga
Cryptomer  aaagatcaaagatattgttc tatttccccgtaaaatttca acaaaaaagatctggttgtt gaaggattctttcatccatt atgtgagatatggagaaaga
Sciadopit  aaagatcaaacatattgttg tatttccccatcaaatttca acaaaaaggatctggttgtt gaaggatcctttcattcatt atctgagatatgaagaaaga
   Ginkgo  aaagatcgaacatattgtca tattttcccgtcgtaattta gcaaaaagtatctggtcttt gaaggattcttccatttctt atgtaaggtatggggaaaga

   Cedrus  tttattatagctataaaggg tactcatctcctagtgaaaa aatgtagatattatcttcca atttttcggcaatgttattt ccatctttggtccgaaccat
    Abies  TCTATTATAGCTATAAAGGG TACTCATCTCCTAGTGAAAA AATGTAGATATCATCTTCCA ATTTTTCGGCAATTtTATTT CCATCTTTGGTCCGAACCAT
Keteleeri  TCTATTATAGCTATAAAGGG TACTCATCTCCTAGTGAAAA AaTGTAGATATCATCTTATC ATTTTTTGGCAATGTTATTT CCATCTTTGGTCCGAACCAT
Pseudolar  tccattatagttataaaggg tactcatctcctagtgaaaa aatgtagatattatcttcca atttttcggcaatgttattt ccatctttggtccgaaccat
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  cctattatagctataagagg tactcatctcctagtgaaaa aatgtagatatcatcttcca atttttcggcaatgttattt ccatctttggtccgaaccat
    Tsuga  cctattatagctataagggg tactcatctcctagtgaaaa aatgtagatatcatcttcca atttttcggcaatgttattt ccatctttggtccgaaccat
    Larix  tctattatagctataaaggg tactcatctcctagtgaaaa aatgtagatatcatcttcca atttttcggcaatgttattt ccatctttggtccgaaccat
Pseudotsu  tctattatagctataaaggg tactcatctcctagtgaaaa aatgtagatatcatcttcta atttttcggcaatgttattt ccatctttggttcgaaccat
  Cathaya  tttattatagctataaaggg tactcatctcctagtgaaaa aatggagatatcatctttca atttttttgcaatgttattt ccatctttggtctgaaccat
    Picea  tctattatagctataaaggg tactcatctcctagtgaaaa aatatagatattatcttcca atttttcggcaatgttattt ccatctttggaacgaaccat
Pinuscemb  TCTATTATAGCTATAAAAGG TACTCATCTCCTAGTGAAAA AATGTAGATATTATCTTCTA ATTTTTCGGCAATGTTATTT CCATCTTTGGTCCGAACCGT
Pinusstro  TCTATTATAGCTATAAAAGG TACTCATCTCCTAGTGAAAA AATGTAGATATTATCTTCTA CTTTTTCGGCAATGTTATTT CCATCTTTGGTCCGAACCGT
Pinuspond  CCTATTATAGCTATAAAGGG TGCTCATCTCCTAGTTAAAA AATGTAGATATTATCTTCTA ATTTTTCGGCAATTTTATTT CCATCTTTGGTCCGAACCGT
Pinussylv  CCTATTATAGCTATAAAGGG TGCTGATCTCCTAGTTAAAA AATGTAGATATTATCTTCTA ATTTTTCGGCAATTTTATTT CCATCTTTGGTCCGAACCGT
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  tcccttatagctctgaaggg tactcaccttcaagtgaaaa aatgtagatatcatcttcta aacttttggcaatgttattt ccatctttggttccaaccgt
Podocarpu  tccctcgtagcgctgaaggg tagcgcacttcaagtgaaaa aatggaaatatcatcttctc cacttttggctacgttattc ccatctttggccccaaccgt
Amentotax  tcccttatagctctaaaggg tactcacctccaagtgaaaa aatgtagatatcatctgttt catttttggcaatattattt ccatctttggtctcaaccgt
Cryptomer  tcccttatggctctaaaggg tacgcaccttcaagtgaaaa aatgtagatatcatctgttt catttttggcaatactattt tcatctttggtttcaaccgt
Sciadopit  tctcttttagttctgaaggg tactcaactacaagtgaaaa aatgtagatatcatcttttc aaattttggcaatgttcttt tcatctttgggcccaaccat
   Ginkgo  tctattatggctctgaaggg tgctcactccccagtcagga gatggagatattatctttca attttttggcgatgttattt ccatttctggtcccaaccgt

   Cedrus  atagggtatgttctcatcaa ttatccaagaattgttcttc ttttccaggttattctctga gggttcggatgaaacctctt ctggtcaggaccaaaatgct
    Abies  ATAGGGTATGTTCTCATCAA TTATCCAAGAATTGTTCTTC TTCTTTAGGTTATTTTCTGA GGGTTCGGATGAAACCTCTT CTGGTCAGGACCAAAATGCT
Keteleeri  ATAGAGTATGTTCTCATCAA TTATCCAAGAATTGTTCTTC TTTTCTAGGTTATTTTCTGA GGGTTCGGATGAAATCTCTT CTGGTCAGGACCAAAATGCT
Pseudolar  atagggtatgttctcataaa ttatccaagaattgttcttc ttctctaggttattctctga gggttcgaatgaaacctctt ctggtcaggaccaaaatgct
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  atagggtatgttctcatcaa ttatccaagaattgttcttc ttctctaggttattctctga gggttcggatgaaacctctt ctggtcaggaccaaaatgct
    Tsuga  atagggtatgttctcatcaa ttatccaagaattgttcttc ttctctaggttattctctga gggttcggatgaaacctctt ctggtcaggaccaaaatgct
    Larix  atagggtatgttctcatcaa ttatccaagaattgttcttc ttctctaggctattttctga ggattcggatgaaacctctt ttggtcaggaccaaaatgct
Pseudotsu  atagggtatgttctcatcaa ttatccaagaattgttcttc ttctctaggctattttctga ggattcggatgaaacctctt ttggtcaggaccaaaatgct
  Cathaya  atagggtatgttctcatcaa ttatccaagaattgttcttc ttctctaggttattttctga aggttcagattaaacctctt ttggtcaggaccaaaatgct
    Picea  atagggtatgttctcatcaa ttatccaagaattgttcttc ttctttaggttattttctga gggttcggatgaaacctctt ttggtcaagactaaaatgct
Pinuscemb  ATAGGGTCTGTTCTCATCAA TTATCCAAGAATTGTTCTTc TTCTCCAGGTTATTTTCTGA GGGTTCGGATGAACCCTCTT TTGGTCAGAACCAAAATGCT
Pinusstro  ATAGGGTCTGTTCTCATCAA TTATCCAAGAATTGTTCTTC TTCTCCAGGTTATTTTCTGA GGGTTCGGATGAACCCTCTT TTTGTCAGAACCAAAATGCT
Pinuspond  ATAGGGTCTGTTCTCATCAA TTATCCAAGAATTGTTCTTC TTCTCCAGGTTATTTTTTGA GGGTTCGGATGAACCCTATT TTGGTCAGAACCAAAATGCT
Pinussylv  ATAGGGTCTGTTCTCATCAA TTATCCAAGAATTGTTCTTC TTCTCCAGGTTATTTTTTAA GGGTTCGGATGAACCCTCTT TTGGTCAGAACCAAAACGCT
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  atagggtatggattcttgaa ttatccaagaattgttcctc ttttctaggtttttttctga gtgttaaaatgaaatctctc atggttaggaccaaaaaggt
Podocarpu  atagggtatggattttcgaa ttacccaagaatcttttttc ttttctcggatactctttga gtataaaaatgaaatatctc gcggttagaacaaaaatgct
Amentotax  ataggatatgtattcttgaa ttatccaagaattattcctt ttttttaggttattttctga gttttaaaatgaaacctctc gtggttaggaccaaaatgct
Cryptomer  ataggatatgcagtcttcaa ttatccaagacttctttttc ttttttaggttattttctgc atgttaaaatgaaacctctc gtggttagggtcaaaatgct
Sciadopit  ataggatatggattcatgaa ttatccaagaattgttcttc ttttctaggttattttctga gtgttaaaatgaaacctctc gtggttagggccaaaatgct
   Ginkgo  ataggatacggatcgatgaa ttatccaataattgttcttc ctttttaggctatttcctgg gcgttcgaatgaatacttcc gtggttaggatcaaaatgct

   Cedrus  aggtgagttattcattaccg atcttattaccgatgaattt tatccaatagttccaattgt atcaataattggattattgg ctagagaaaaattctgtgac
    Abies  AGATGAGTTATTCATTACCG ATCTTATTACCGATGAATTT GATCCAATAGTTCCGATTGT ACCAATAATTGGATTATTGG CTAGAGAAAAATTATGTGAC
Keteleeri  AGATGAGTTATTCATTACCG ATCTTATTACCGATGAATTT TATCCAATAGTTCCGATTGT ACCAATAATTGGATTATTGG CTAGAGAAAAATTCTGTGAC
Pseudolar  agatgagttattcattaccg atcttattaccgatgaattt gatccaatagttccaattgt accaataattggattattgg ctagagaaaaattctgtgac
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  agatgagttattaattaccg atcttattaccgatgaattt gatccaatagttccgattgt accaataattggattattgg ctagagaaaaattctgtgac
    Tsuga  agataagttatttattactg atcttattaccgatgaattt gatccaatagttccgattgt accaataattggattattgg ctaaagaaaaattctgtgac
    Larix  agatgagttatttattgccg atcttattaccggtgaattt gatccaatagttccgattgt accaataattggattattgg ctagagaaaaattctgtgac
Pseudotsu  agatgagttatttattgccg atctgattaccggtgaattt gatccaatagttccgattat accaataattggattattgg ctagagaaaaattctgtgac
  Cathaya  agatgagttattcattgccg atcttattaccgatgaattt gatccaatagttccgattgt accaataatcggattattgg ctagagaaaaattctgtgac
    Picea  agatgagttattcattgccg atcttattactgatgaattt gatccaatagttccgattgt accaataattggattattgt ctagagaaaaattctgtgat
Pinuscemb  AGATGAGTTATTCATCGCCG ATCTTATTACCAATGAATTT GATCCAATAGTTCCGATTGT ACCAATACTTGGATTATTGG CTAGAGAAAAATTATGTGAC
Pinusstro  AGATGAGTTATTCATCGCCG ATCTTATTACCAATGAATTT GATCCAATAGTTCCGATTGT ACCAATACTTGGATTATTGG CTAGAGAAAAATTCTGTGAC
Pinuspond  AGATGAGTTATTCATCGCCG ATCTTATTACCGATGAAATT GATCCAATAGTTCCGATTGT ACCAATAATTGGATTATTGG CTACAGAAAAATTCTGTGAC
Pinussylv  AGATGAGTTATTCATCCCCG TTCTTATTACCAATGAAATG GATCCAATAGTTCCGATTGT ACCAATAATTGGATTATTGG CTACAGAAAAATTCTGTGAC
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  agatgatttaatgattacct atatcattacgaatgaattg gatccaatagcccctattag atccataataggattattag ctaaagaaaggttctgcgac
Podocarpu  aaataattcatttattactg acctcattatcaatgaaatt catccaatagctccaattag atcaataatttatttcttgg ctaaagaaaggttctgtgac
Amentotax  aaatgatttattcattacca atctaattactaatgaattg aatccaatagctccgattag atcaattcttttctttttgg ctaaagaaaggttctgtgac
Cryptomer  agacgatttattcattaccg atctcattaccaatgaatta aacccaatagctccgattag agcaattcttttctttttgg ctaaagaaaagttttgtgac
Sciadopit  agatcgtttattcattaacg atctcattaccaatgaattg aggccaatagctccgattag ttcaataattagattttttg ctaaagaaaggttctgtgtt
   Ginkgo  agatgatttattcattaccg atcttattaccaatgaattt gattcaatagctccgattat acctctgattggattattgg ctaaagaaaggttttgtgac

   Cedrus  atatcagggcggccaattag taaattggcttggaccagtc taacagatgatgatatcctc gatcgattcgatcgaatttg gagaaatttttttcattact
    Abies  ATATCAGGGCGGCCAATTAG TAAATTGTATTGGACTAGTC TAACAGATGATGATATCCTC GATCGATTCGATCGAATTTG GAAAAATATTTTTCATTACT
Keteleeri  ATATCAGGGCGGCCAATTAG TAAATTGTATTGGACTAGTC TAACAGATGATGATATCCTC GATCGATTCGATCGAATTTG GAAAAATCTTTTTCATTACT
Pseudolar  atatcagggcggccgattag taaattgtcttggactagtc taacagatgatgacatcctc gatcgattcgatcgaatttg gagaaatctttttcattact
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  atatcagggcggccaattag taaattgtcttggactagtc taacagatgataatatcctc gatcgattcgatcgaatttg gagaaatctttttcattact
    Tsuga  atatcagggcggccaattag taaattgtcttggactagtc taacagatgatgatatcctc gatcgattcgatcgaatttg gagaaatatttttcattact
    Larix  atatcagggcggccaattag taaattgtcttggaccagtc taacagatgatgatatcctc gatcgattcgatcgaatttg gagaaatctttttcattatt
Pseudotsu  atatcagggcggccaattag taaattgtcttggaccagtc taacagatgatgatatcctc gatcgatttgatcgaatttg gagaaatatttttcattact
  Cathaya  atatcagggcggccaattag taaattgtcttggaccagtc taacagatgatgatatcctc gatcgattcgatcgaatttg gataaatatttttcattact
    Picea  atatcagggcggccaattag taaattgtcttggaccagtc taacagatgatgatatcctg gatcgattcgatcgaatttg gagaaatctttttcattact
Pinuscemb  ATATCAGGACGGCCAATTAG TAAATTGTCTTGGACCAATC TAACAGATGATGATATCCTC AATCGATTTGATCAAATTTG GAGAAATATTTTTCATTACT
Pinusstro  GTATCAGGACGGCCAATTAG TAAATTGTCTTGGACCAATC TAACAGATGATGATATCCTC AATCGATTTGATCAAATTTG GAGAAATCTTTTTCATTACT
Pinuspond  ATATCAGGGCGGCCAATTAG TAAATTGTCTTGGACCAGTC TAACAGATGATGATATCCTC GATCGATTCGATCAAATTTG GAGAAATCTTTTTCATTACT
Pinussylv  ATATCAgGGCGGCCAATTAG TAAATTGTCTTGGACCAGTC TAACAGATGATGATATCCTC GATCGATTCGATCAAATTTG GAGAAATCTTTTTCATTACT
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  atctcagggcgaccaattag taaattggcttggaccagtt tatcagatgattatatcctc gatcgattcgatcgaatttg gaggaatctttttaattatt
Podocarpu  atctttggtcggccaattag taaatttgcctgggccagtc tgactgatgacgatatcctc gatcgattcgatcgaatttg gagtaatttttttcattact
Amentotax  atctcagggcagacaattag taaattatcctggaccagtc tatcagatgatgatatcctc gatcgattcgatcgaatttg tagaaatctttttcattact
Cryptomer  atctcagggtggccaattag taaattgtcttggaccagtc tatcagatgatgatatcctc gatcgattcgatcgaatttg gataaatctttttcattact
Sciadopit  atctcaggacggccaataag taaattggcctggacaagtc taacagatgatgatatcctc gatcgattcgatcgaatttg gagaaatctttttcatcact
   Ginkgo  atttcagggcgtccaattag taaattggcttggaccggtc taaaagatgatgatattctt gatcgattcgatcgaatttg tagaaacattattgattact

   Cedrus  acagtggatcctttggtcga gatggtttatatcgtataaa gtatatactttcactatcat gtgctaaaactttagcttgt aaacataaaagtacgatacg
    Abies  ACAGTGGATCCCTTGATCGA GATGGTTTATATCGTATAAA GTATATACTTTCACTATCAT GTGCTAAAACTTTAGCCTGT AAACATAAAAGTACGATACG
Keteleeri  ACAGTGGATCCTTTGGTCGA GATGGTTTATATCGTATAAA GTATATACTTTCACTATCAT GTGCTAAAACTTTAGCCTGT AAACATAAAAGTACGATACG
Pseudolar  acagtggatcctttggtcga gatggtttatatcgtataaa gtatatactttcactatcat gtgctaaaactttagcctgt aaacataaaagtacgatacg
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  acagtggatcctttggtcga gatggtttatatcgtataaa gtatatactttcgctatcat gtgctaaaactttagcctgt aaacataaaagtacgatacg
    Tsuga  acagtggatcctttggtcga gatggtttatatcgtataaa gtatatactttcactatcat gtgctaaaactttagcctgt aaacataaaagtacgatacg
    Larix  acagtggatcctttggtcga gatggtttatatcgtattaa gtatatactttcattatcat gtgctaaaactttagcctgt aaacataaaagtacgatacg
Pseudotsu  atagtggatcctttggtcga gatggtttatatcgtataaa gtatatactttcattatcat gtgctaaaactttagcctgt aaacataaaagtacgatacg
  Cathaya  acagtggatcctttggtcga gatggtttatatcgtataaa gtatatactttcattatcat gtgctaaaactttagcctgt aaacataaaagtacgatacg
    Picea  acagtggatcctttggtcga gatggtttatatcgtataaa gtatatactttcattatcat gtgctaaaactttagcctgt aaacataaaagtacgatacg
Pinuscemb  ACAGTGGATCCTTTGGTCGA GATGGTTTATATCGTATAAA GTATATACTTTCATTATCAT GTGCTAAAACTTTAGCCTGT AAACATAAGAGTACGATACG
Pinusstro  ACAGTGGATCCTTTGGTCGA GATGGTTTATATCGTATAAA GTATATACTTTCATTATCAT GCGCTAAAACTTTAGCCTGT AAACATAAAAGTACGATACG
Pinuspond  ACAGTGGATCCTTTGATCGA GATGGTTTATATCGTATAAA GTATATACTTTCATTATCAT GTGCTAAAACTTTAGCCTGT AAACATAAAAGTACGATACG
Pinussylv  ACAGTGGATCCTTTGATCGA GATGGTTTATATCGTATAAA GTATATACTTTTATTATCAT GTGCTAAAACTTTAGCCTGT AAACATAAAAGTACGATACG
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  acagtggatccatcaatcaa gatggtttatattgtataaa gtatatacttctactttcat gtgctaaaactttagcctgt aaacataaaagtacgatacg
Podocarpu  acagtgggtctttcaatcaa gatggtttatatagtataaa gtatatacttctactttcat gcgctaaaactctagcctgt aaacataaaagtacgatacg
Amentotax  acagtggatccatcaatccg gatggtttatattatataaa gtatatacttctacttccat gcgctaaaactttagcctgt aaacataaaagtacgatacg
Cryptomer  acagtggatcaatcaatcaa gagggtttatatcatataaa atatatacttctactttcgt gtgctaaaactttggcctgt aaacataaaagtacgatacg
Sciadopit  acagtggatctttcaatcaa gagggtttatactatataaa gtatatacttctactttcat gtgctaaaactttagcctgt aaacataaaagtacgatacg
   Ginkgo  acagtggatctttcaataaa gatggttcatatcggatgaa gtatatactccgacttccat gtgctaaaactttagcctgt agacataaaagtacgatacg

   Cedrus  tgtagttcggaaggaattag gtccagagctcttcaaaaaa tcgttttcgaaagaacgaga atttgattctccggcttttt catcgaaagcggtggcccgt
    Abies  TGTAGTTCGGAAGGAATTAG GTCCAGAACTCTTCAAAAAA TATTTTTCAAAAGAGCGAGA ATTTGATTTTCCGGCTTTTT CATCGAAAGCAGCGGCCCGT
Keteleeri  TGTAGTTCGGAAGGAATTAG GTCCAGAACTCTTCAAAAAA TCTTTTTCAAAAGAACGAGA ATTTGATTTTCCGGCTTTTT CATCGAAAGCAGCGGCCCGT
Pseudolar  tgtagttcggaaggaattag gtccagaactcttcaaaaat tttttctcaaaagaacgaga attcaattctccagcttttt catcgaaagcagcagcccgt
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  tgtagttcggaaggaattag gtccagaactcttcaaaaaa tctttttcaaaagaacgaga attggattatccggcttttt catcgaaagcagcggcccat
    Tsuga  tgtagttcggaaggaattag gtccagaactcttcaaaaaa tatttttcaaaagaacgaga atttgattatccggcttttt catcgaaagcagcggcccat
    Larix  tgtagttcggaaggaattag gtccagaactctttaaaaaa tcgttttcaaaagaacgaga attcgattctccgccctttt catcaaaggcggcggcccgc
Pseudotsu  tgtagttcggaaggaattag gtccagaactctttaaaaaa tcgttttcaaaagaacgaga attcgattctccgccctttt catcaaagtcgggggcccgc
  Cathaya  tgtagttcggaaggaattag gtccagaactctttaaaaaa tcgtgttcaaaagaacgaga attcgattatccgctttttt catcaaaagcggcggcccgt
    Picea  tgtagttcggaaggaattag gtccagaactctttaaaaaa tcgttttcaaaagaacgaga attggattctccgccttttt catcaaaagcggcggcccgt
Pinuscemb  TGTAGTTCGGAAGGAATTAG GTCCAGAACTCTTTCAAAAA TCGTTTTCAAAAGAACGAGA ATTTGATTCTCTGCCTTTTT CGTCAAAAGCGGCGGCCCGT
Pinusstro  TGTAGTTCGGAAGGAATTAG GTCCAGAACTCTTTCAAAAA TCGTTTTCAAAAGAACGAGA ATTTGATTCTCTGCCTTTTT CGTCAAAAGCGGCGGCCCGT
Pinuspond  TGTAGTTCGGAAGGAATTAG GTCCAGAACTCTTTAAAAAA TCGTTTTCAAAAGAACGAGA ATTTTATTCTCTGCGCTTTT CATCAAAAGCGGCGGCCCGT
Pinussylv  TGTAGTTCGGAAGGAATTAG GTCCAGAACTCTTTAAAAAA TCGTTTTCAAAAGAACGAGA ATTTGATTCTCTGCCTTTTT CATCAAAAGCGGCGGCCCGT
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  cgtagttcgggaagaattag gttcggaactcttcacaaaa tcgttctcaaaagaacgaga attcatttcttcgttctttt c----aaag-----actcgt
Podocarpu  tgtagttcgggaggaattag ggtcggaactcttcacaaaa gcgttctcaaaaaaacgaga attcatttctccagtgttat c----aaag-----attcgt
Amentotax  tgtagttcgggaagaatcag gttcggaactctttacaaaa tcgttctccaaagaacgaga attcatttcttcgtcctttt c----aaaga-----ctcgt
Cryptomer  tgtagttcgggaacaattag gttcggaactctttacaaaa tcattttcaaaagaaa---a attcatttcttcgtcctttt c----aaaaa-----ctcgt
Sciadopit  tgtagttcgagaagaattag gttcagaactgttcacaaaa tcgttctcaaaaaaacgaga attcatttcttcatcctttt c----aaag-----actagt
   Ginkgo  tgtagtttgggaagaattcg gttcggaactatttacgaaa tcgttccccaaagagggaga attaatctctccgttcttct c----aaag-----acctgc

   Cedrus  tcacagagagaacgaatttg gcattcagatattccccaga taaatcccctagccaattcc tggcaaaagatacagga--- ----ccttaaaataaaaaa-
    Abies  TCACAGAGAGAACGAATTTG GCATTCAGATATTCCCCAGA TAAATCCCCTAGCCAATTCC TGGCAAAAGATACAGGATCT TAAATCTTAAAATAGAAAA-
Keteleeri  TCACAGAGAGAACGAATTTG GCATTCAGATATTCCCCAGA TAAATCCCCTAGCCAATTCC TGGCAAAAGATACAGGATCT GAAATCTGAAAATGGAAAAC
Pseudolar  tcacagagagaacgaatttg gcattcagatattccccaga taaatcccctagccaattcc tggcaaaagatacagga--- ----tctgaaaatagaaaa-
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  tcacagagagaacgaatttg gcattcagatattccccaga taaatcccctagccaattcc tggcaaaagatacagga--- ----tcttaaaatagaaag-
    Tsuga  tcacagagagaacgaatttg gcattcagatattccccaga taaatcccctagccaattcc tggcaaaagatacagga--- ----tcttagaatagaaag-
    Larix  tcacagagagaacgaatttg gcattcagatattccccaga taaatcccctagccaattcc tggcaaaagatacagga--- ----tctgaaaatagaaaa-
Pseudotsu  tcacagagagaacgaatttg gcattcagatattccccaga taaatcccctagccaattcc tggcaaaagatacagga--- ----tctgaaagtagaaaa-
  Cathaya  ttacagagagaacgaatttg gcattcagatattccccaga taaatcccctagccaattcc tggcaaaagatacaaga--- ----cctgaaaatagaaaa-
    Picea  tcacagagagaacgaatttg gcattcagatattccccaga taaatcccctagcccattcc tggcaaaagatacagga--- ----tctgaaaatagaaaa-
Pinuscemb  TCGCAGAGAGAACGAATTTG GCATTCAGATATTCCCCAGA TAAATCCCCTAGCTAATTCC TGGCAAAAGATACAGGA--- ----TCTGAAAATAGAAAA-
Pinusstro  TCGCAGAGAGAACGAATTTG GCATTCAGATATTCCCCAGA TAAATCCCCTAGCTAATTCC TGGCAAAAGATACAGGA--- ----TCTTAAAATAGAAAA-
Pinuspond  TCGCAGAGAGAACGAATTTG GCATTCAGATATTCCCCAGA TAAATCCCCTAGCTAATTCC TGGCAAAAGATACAGGA--- ----TCTGAAAATAGAAAA-
Pinussylv  TCGCAGAGAGAACGAATTTG GCATTCAGATATTCCCCAGA TAAATCCCCTAGCTAATTCC TGGCAAAAGATACAGGA--- ----TCTGAAAATAGAAAA-
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  tcgcagagagaacgaatttg gcatttagatattctccgga taattcccttggctaattcc tggcaaaagatacagaa--- ----taaaaaaatagaaaa-
Podocarpu  tcgcagagagaacgattttg gcatttagatatttttgaga tgaattccctatctaattcc tggcaaaagatacgt????? ????????????????????
Amentotax  tcacagagagaacgattttg gaattcagatattatccaga taaatcccctatctaattcc tggcaaaagatacagaa--- ----taaacaagtagaaaa-
Cryptomer  ttacagagagaacgaatttg gaattcagaaattagccaga taaatcccctggctaatttc tggcaaaagatgcagaa--- ----taaacaaatagaaaa-
Sciadopit  tcgcagagagaactaaattg gaatggagatattctccaga taaatcccctggctaattcc tggcaaaagatacagaa--- ----taaa-aaatag?????
   Ginkgo  tcacagagaaaacgaatttg gcattcagatattctccgga taaatctcccggccaatttt tggcaaaataaacgtaa--- ----tagacaaattgaaac-

   Cedrus  ----cttatttgaccaatga aatgctctttgagtcattgc ctcgattcagaatcattttt ctttttccatcc-----gag aactaaaatgattagggaat
    Abies  ----CTTATTTGACCAATGA AATGCTCTTTGAGTCATTGC CTCGATTCAGAATCATTTTT ATTTTTCCATCC-----GAG AACTAAAATGATTAGGGAAT
Keteleeri  TAAACTTATTTGACCAATGA AATGCTCTTTTAGTCATTGC CTCGATTCAGAATCATTTTT CTTTTTCCATCC-----GAG AaCTAAAATGATTAGGGAAT
Pseudolar  ----cttatttgaccaatga aatgctctttgagtaattgc ctcgattcagaatcattttt attttttcatcc-----gag aactagaatgattagggaat
Pseudolas  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Nothotsug  aaaacttatttgaccaatga aatgctctttgagtaattgc ctcgattcagaatcattttt ctttttccatcc-----gag aactaaaatgattaggaaat
    Tsuga  aaaacttatttgaccaatga aatgctctttgagtaattgc ctccattcaaaatcattttt ctttttccatcc-----gag aactaaaatgattaggaaat
    Larix  ----cttatttgaccaatga aatgctctttgagtcattgc ctcgattcagaatcattttt atttttccatcc-----gag aactaaaatgattaggaaat
Pseudotsu  ----cttatttgaccaatga aatgctctttgagtaattgc ctcgattcagaatcattttt ctttttccatcc-----gag aactaaaatgattaggaaat
  Cathaya  ----cttatttgaccaatga aatgctctttgagtaattgc ctcgattcaaaatcattttt ctttttccatccgagacgag aactaaaatgattaggaaat
    Picea  ----cttatttgaccaatga aatgctctttgagtcattgc ctcgattcagaatcattttt attttgccatcc-----gag aactaaaatgattaggaaat
Pinuscemb  ----CTTATTTGACCAATGA AATGCTCTTTGAGTAATTGC CTCGATTCAGAATCATTTTT ATTTTTCTATCC-----GAG AACTAAAATGATTAGGAAAT
Pinusstro  ----CTTATTTGACCAATGA AATGCTCTTTGAGTAATTGC CTCGATTCAGAATCATTTTT CTTTTTATATCC-----GAG AACTAAAATGATTAGGAAAT
Pinuspond  ----CTTATTTGACCAATGA AATGCTCTTTGAGTAATTGC CTCGATTCAGAATCATTTTT ATTTTTCTATCC-----GAG AACTAAAATGATTAGGAAAT
Pinussylv  ----CTTATTTGACCAATGA AATGCTCTTTGAGTAATTGC CTCGATTCAGAATCATTTTT CTTTTTCTATCC-----GAG AACTAA------TAGGAAAT
Pinusbelg  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pseudoahe  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostbo  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostca  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Pityostco  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Araucaria  ----ctta???????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Podocarpu  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Amentotax  ----ctga???????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Cryptomer  ----ctga???????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
Sciadopit  ???????????????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????
   Ginkgo  ----ccta???????????? ???????????????????? ???????????????????? ???????????????????? ????????????????????

   Cedrus  aaaaacattacaggggaa?? ??????????????????
    Abies  AAATAAATTACATGGGGAAA GCCGTGTGCGATGAGAAT
Keteleeri  AAAAaCATTACATGGGGAAA GCCGTGTGCGATGAGAAT
Pseudolar  aaatacattacatggggaaa gccgtgtgcaatgag???
Pseudolas  ???????????????????? ??????????????????
Nothotsug  aaatacattacatggggaaa gccgtgtgcgatgagaat
    Tsuga  aaatacattacatggggaaa gccgtgtgcgatgagaat
    Larix  agatacattacatggggaaa gccgtgtgcgatgagaat
Pseudotsu  agatacattacatggggaaa gccgtgtgcgatgagaat
  Cathaya  agatacattacatggggaaa gccgtgtgcaatgagaat
    Picea  agatacattacatggggaaa gccgtgtgcgatgagaat
Pinuscemb  AGATACATTACATGGGGAAA GCCGTGTGCAATGAGAAT
Pinusstro  AGATACATTACATGGGGAAA GCCGTGTGCAATGAGAAT
Pinuspond  AGATACATTACATGGGGAAA GCCGTGTGCAATgAGaAT
Pinussylv  AGATACATTACATGGGGAAA GCCGTGTGCAATGAGAAT
Pinusbelg  ???????????????????? ??????????????????
Pseudoahe  ???????????????????? ??????????????????
Pityostbo  ???????????????????? ??????????????????
Pityostca  ???????????????????? ??????????????????
Pityostco  ???????????????????? ??????????????????
Araucaria  ???????????????????? ??????????????????
Podocarpu  ???????????????????? ??????????????????
Amentotax  ???????????????????? ??????????????????
Cryptomer  ???????????????????? ??????????????????
Sciadopit  ???????????????????? ??????????????????
   Ginkgo  ???????????????????? ??????????????????

;
  end;

begin assumptions;
charset morphology = 1-103;
charset molecules = 104-2941;
charset rbcL = 104-1366;
charset matK = 1367-2941;
end;

begin paup;
delete Pseudolas Pinusbelg Pseudoahe Pityostbo Pityostca Pityostco;
outgroup Ginkgo;
charpartition morphmol = morphology:1-103, mol:104-2941;
charpartition genes = rbcL:104-1366, matK:1367-2941;
end;

begin mrbayes;
outgroup Ginkgo;
charset morphology = 1-103;
charset rbcL = 104-1366;
charset matK = 1367-2941;

partition 3sources = 3: morphology, rbcL, matK;
set partition=3sources;
lset applyto=(2) nst=2 rates=invgamma ngammacat=4;
lset applyto=(3) nst=6 rates=gamma ngammacat=4;

unlink revmat=(all) statefreq=(all) shape=(all);
prset applyto=(all) ratepr=variable;
mcmcp ngen=5000000 temp=0.2 samplefreq=200 printall=yes mcmcdiagn=yes diagnfreq=2000 relburnin=yes filename=Pinaceaecomboct23 savebrlens=yes;
mcmc;
end;