primate-mtDNA-interleaved.nex

#NEXUS

[!Data from:
    Hayasaka, K., T. Gojobori, and S. Horai. 1988. Molecular phylogeny
        and evolution of primate mitochondrial DNA. Mol. Biol. Evol.
        5:626-644.
]

begin taxa;
    dimensions ntax=12;
    taxlabels
Lemur_catta    
Homo_sapiens
Pan
Gorilla
Pongo
Hylobates
Macaca_fuscata
M._mulatta
M._fascicularis
M._sylvanus
Saimiri_sciureus
Tarsius_syrichta
;
end;

begin characters;
    dimensions nchar=898;
    format missing=? gap=- matchchar=. interleave datatype=dna;
    options gapmode=missing;
    matrix

Lemur_catta      AAGCTTCATAGGAGCAACCATTCTAATAATCGCACATGGCCTTACATCATCCATATTATT
Homo_sapiens     AAGCTTCACCGGCGCAGTCATTCTCATAATCGCCCACGGGCTTACATCCTCATTACTATT
Pan              AAGCTTCACCGGCGCAATTATCCTCATAATCGCCCACGGACTTACATCCTCATTATTATT
Gorilla          AAGCTTCACCGGCGCAGTTGTTCTTATAATTGCCCACGGACTTACATCATCATTATTATT
Pongo            AAGCTTCACCGGCGCAACCACCCTCATGATTGCCCATGGACTCACATCCTCCCTACTGTT
Hylobates        AAGCTTTACAGGTGCAACCGTCCTCATAATCGCCCACGGACTAACCTCTTCCCTGCTATT
Macaca_fuscata   AAGCTTTTCCGGCGCAACCATCCTTATGATCGCTCACGGACTCACCTCTTCCATATATTT
M._mulatta       AAGCTTTTCTGGCGCAACCATCCTCATGATTGCTCACGGACTCACCTCTTCCATATATTT
M._fascicularis  AAGCTTCTCCGGCGCAACCACCCTTATAATCGCCCACGGGCTCACCTCTTCCATGTATTT
M._sylvanus      AAGCTTCTCCGGTGCAACTATCCTTATAGTTGCCCATGGACTCACCTCTTCCATATACTT
Saimiri_sciureus AAGCTTCACCGGCGCAATGATCCTAATAATCGCTCACGGGTTTACTTCGTCTATGCTATT
Tarsius_syrichta AAGTTTCATTGGAGCCACCACTCTTATAATTGCCCATGGCCTCACCTCCTCCCTATTATT

Lemur_catta      CTGTCTAGCCAACTCTAACTACGAACGAATCCATAGCCGTACAATACTACTAGCACGAGG
Homo_sapiens     CTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGG
Pan              CTGCCTAGCAAACTCAAATTATGAACGCACCCACAGTCGCATCATAATTCTCTCCCAAGG
Gorilla          CTGCCTAGCAAACTCAAACTACGAACGAACCCACAGCCGCATCATAATTCTCTCTCAAGG
Pongo            CTGCCTAGCAAACTCAAACTACGAACGAACCCACAGCCGCATCATAATCCTCTCTCAAGG
Hylobates        CTGCCTTGCAAACTCAAACTACGAACGAACTCACAGCCGCATCATAATCCTATCTCGAGG
Macaca_fuscata   CTGCCTAGCCAATTCAAACTATGAACGCACTCACAACCGTACCATACTACTGTCCCGAGG
M._mulatta       CTGCCTAGCCAATTCAAACTATGAACGCACTCACAACCGTACCATACTACTGTCCCGGGG
M._fascicularis  CTGCTTGGCCAATTCAAACTATGAGCGCACTCATAACCGTACCATACTACTATCCCGAGG
M._sylvanus      CTGCTTGGCCAACTCAAACTACGAACGCACCCACAGCCGCATCATACTACTATCCCGAGG
Saimiri_sciureus CTGCCTAGCAAACTCAAATTACGAACGAATTCACAGCCGAACAATAACATTTACTCGAGG
Tarsius_syrichta TTGCCTAGCAAATACAAACTACGAACGAGTCCACAGTCGAACAATAGCACTAGCCCGTGG

Lemur_catta      GATCCAAACCATTCTCCCTCTTATAGCCACCTGATGACTACTCGCCAGCCTAACTAACCT
Homo_sapiens     ACTTCAAACTCTACTCCCACTAATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCT
Pan              ACTTCAAACTCTACTCCCACTAATAGCCTTTTGATGACTCCTAGCAAGCCTCGCTAACCT
Gorilla          ACTCCAAACCCTACTCCCACTAATAGCCCTTTGATGACTTCTGGCAAGCCTCGCCAACCT
Pongo            CCTTCAAACTCTACTCCCCCTAATAGCCCTCTGATGACTTCTAGCAAGCCTCACTAACCT
Hylobates        GCTCCAAGCCTTACTCCCACTGATAGCCTTCTGATGACTCGCAGCAAGCCTCGCTAACCT
Macaca_fuscata   ACTTCAAATCCTACTTCCACTAACAGCCTTTTGATGATTAACAGCAAGCCTTACTAACCT
M._mulatta       ACTTCAAATCCTACTTCCACTAACAGCTTTCTGATGATTAACAGCAAGCCTTACTAACCT
M._fascicularis  ACTTCAAATTCTACTTCCATTGACAGCCTTCTGATGACTCACAGCAAGCCTTACTAACCT
M._sylvanus      ACTCCAAATCCTACTCCCACTAACAGCCTTCTGATGATTCACAGCAAGCCTTACTAATCT
Saimiri_sciureus GCTCCAAACACTATTCCCGCTTATAGGCCTCTGATGACTCCTAGCAAATCTCGCTAACCT
Tarsius_syrichta CCTTCAAACCCTATTACCTCTTGCAGCAACATGATGACTCCTCGCCAGCTTAACCAACCT

Lemur_catta      AGCCCTACCCACCTCTATCAATTTAATTGGCGAACTATTCGTCACTATAGCATCCTTCTC
Homo_sapiens     CGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTC
Pan              CGCCCTACCCCCTACCATTAATCTCCTAGGGGAACTCTCCGTGCTAGTAACCTCATTCTC
Gorilla          CGCCTTACCCCCCACCATTAACCTACTAGGAGAGCTCTCCGTACTAGTAACCACATTCTC
Pongo            TGCCCTACCACCCACCATCAACCTTCTAGGAGAACTCTCCGTACTAATAGCCATATTCTC
Hylobates        CGCCCTACCCCCCACTATTAACCTCCTAGGTGAACTCTTCGTACTAATGGCCTCCTTCTC
Macaca_fuscata   TGCCCTACCCCCCACTATCAATCTACTAGGTGAACTCTTTGTAATCGCAACCTCATTCTC
M._mulatta       TGCCCTACCCCCCACTATCAACCTACTAGGTGAACTCTTTGTAATCGCGACCTCATTCTC
M._fascicularis  TGCCCTACCCCCCACTATTAATCTACTAGGCGAACTCTTTGTAATCACAACTTCATTTTC
M._sylvanus      TGCTCTACCCTCCACTATTAATCTACTGGGCGAACTCTTCGTAATCGCAACCTCATTTTC
Saimiri_sciureus CGCCCTACCCACAGCTATTAATCTAGTAGGAGAATTACTCACAATCGTATCTTCCTTCTC
Tarsius_syrichta GGCCCTTCCCCCAACAATTAATTTAATCGGTGAACTGTCCGTAATAATAGCAGCATTTTC

Lemur_catta      ATGATCAAACATTACAATTATCTTAATAGGCTTAAATATGCTCATCACCGCTCTCTATTC
Homo_sapiens     CTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTC
Pan              CTGATCAAATACCACTCTCCTACTCACAGGATTCAACATACTAATCACAGCCCTGTACTC
Gorilla          CTGATCAAACACCACCCTTTTACTTACAGGATCTAACATACTAATTACAGCCCTGTACTC
Pongo            TTGATCTAACATCACCATCCTACTAACAGGACTCAACATACTAATCACAACCCTATACTC
Hylobates        CTGGGCAAACACTACTATTACACTCACCGGGCTCAACGTACTAATCACGGCCCTATACTC
Macaca_fuscata   CTGATCCCATATCACCATTATGCTAACAGGACTTAACATATTAATTACGGCCCTCTACTC
M._mulatta       CTGGTCCCATATCACCATTATATTAACAGGATTTAACATACTAATTACGGCCCTCTACTC
M._fascicularis  CTGATCCCATATCACCATTGTGTTAACGGGCCTTAATATACTAATCACAGCCCTCTACTC
M._sylvanus      CTGATCCCACATCACCATCATACTAACAGGACTGAACATACTAATTACAGCCCTCTACTC
Saimiri_sciureus TTGATCCAACTTTACTATTATATTCACAGGACTTAATATACTAATTACAGCACTCTACTC
Tarsius_syrichta ATGGTCACACCTAACTATTATCTTAGTAGGCCTTAACACCCTTATCACCGCCCTATATTC

Lemur_catta      CCTCTATATATTAACTACTACACAACGAGGAAAACTCACATATCATTCGCACAACCTAAA
Homo_sapiens     CCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCACCACATTAACAACATAAA
Pan              CCTCTACATGTTTACCACAACACAATGAGGCTCACTCACCCACCACATTAATAACATAAA
Gorilla          CCTTTATATATTTACCACAACACAATGAGGCCCACTCACACACCACATCACCAACATAAA
Pongo            TCTCTATATATTCACCACAACACAACGAGGTACACCCACACACCACATCAACAACATAAA
Hylobates        CCTTTACATATTTATCATAACACAACGAGGCACACTTACACACCACATTAAAAACATAAA
Macaca_fuscata   TCTCCACATATTCACTACAACACAACGAGGAACACTCACACATCACATAATCAACATAAA
M._mulatta       CCTCCACATATTCACCACAACACAACGAGGAGCACTCACACATCACATAATCAACATAAA
M._fascicularis  TCTCCACATGTTCATTACAGTACAACGAGGAACACTCACACACCACATAATCAATATAAA
M._sylvanus      TCTTCACATATTCACCACAACACAACGAGGAGCGCTCACACACCACATAATTAACATAAA
Saimiri_sciureus ACTTCATATGTATGCCTCTACACAGCGAGGTCCACTTACATACAGCACCAGCAATATAAA
Tarsius_syrichta CCTATATATACTAATCATAACTCAACGAGGAAAATACACATATCATATCAACAATATCAT

Lemur_catta      CCCATCCTTTACACGAGAAAACACCCTTATATCCATACACATACTCCCCCTTCTCCTATT
Homo_sapiens     ACCCTCATTCACACGAGAAAACACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCT
Pan              GCCCTCATTCACACGAGAAAATACTCTCATATTTTTACACCTATCCCCCATCCTCCTTCT
Gorilla          ACCCTCATTTACACGAGAAAACATCCTCATATTCATGCACCTATCCCCCATCCTCCTCCT
Pongo            ACCTTCTTTCACACGCGAAAATACCCTCATGCTCATACACCTATCCCCCATCCTCCTCTT
Hylobates        ACCCTCACTCACACGAGAAAACATATTAATACTTATGCACCTCTTCCCCCTCCTCCTCCT
Macaca_fuscata   GCCCCCCTTCACACGAGAAAACACATTAATATTCATACACCTCGCTCCAATTATCCTTCT
M._mulatta       ACCCCCCTTCACACGAGAAAACATATTAATATTCATACACCTCGCTCCAATCATCCTCCT
M._fascicularis  ACCCCCCTTCACACGAGAAAACATATTAATATTCATACACCTCGCTCCAATTATCCTTCT
M._sylvanus      ACCACCTTTCACACGAGAAAACATATTAATACTCATACACCTCGCTCCAATTATTCTTCT
Saimiri_sciureus ACCAATATTTACACGAGAAAATACGCTAATATTTATACATATAACACCAATCCTCCTCCT
Tarsius_syrichta GCCCCCTTTCACCCGAGAAAATACATTAATAATCATACACCTATTTCCCTTAATCCTACT

Lemur_catta      TACCTTAAACCCCAAAATTATTCTAGGACCCACGTACTGTAAATATAGTTTAAA-AAAAC
Homo_sapiens     ATCCCTCAACCCCGACATCATTACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAAC
Pan              ATCCCTCAATCCTGATATCATCACTGGATTCACCTCCTGTAAATATAGTTTAACCAAAAC
Gorilla          ATCCCTCAACCCCGATATTATCACCGGGTTCACCTCCTGTAAATATAGTTTAACCAAAAC
Pongo            ATCCCTCAACCCCAGCATCATCGCTGGGTTCGCCTACTGTAAATATAGTTTAACCAAAAC
Hylobates        AACCCTCAACCCTAACATCATTACTGGCTTTACTCCCTGTAAACATAGTTTAATCAAAAC
Macaca_fuscata   ATCCCTCAACCCCAACATCATCCTGGGGTTTACCTCCTGTAGATATAGTTTAACTAAAAC
M._mulatta       ATCTCTCAACCCCAACATCATCCTGGGGTTTACTTCCTGTAGATATAGTTTAACTAAAAC
M._fascicularis  ATCTCTCAACCCCAACATCATCCTGGGGTTTACCTCCTGTAAATATAGTTTAACTAAAAC
M._sylvanus      ATCTCTTAACCCCAACATCATTCTAGGATTTACTTCCTGTAAATATAGTTTAATTAAAAC
Saimiri_sciureus TACCTTGAGCCCCAAGGTAATTATAGGACCCTCACCTTGTAATTATAGTTTAGCTAAAAC
Tarsius_syrichta ATCTACCAACCCCAAAGTAATTATAGGAACCATGTACTGTAAATATAGTTTAAACAAAAC

Lemur_catta      ACTAGATTGTGAATCCAGAAATAGAAGCTCAAAC-CTTCTTATTTACCGAGAAAGTAATG
Homo_sapiens     ATCAGATTGTGAATCTGACAACAGAGGCTTA-CGACCCCTTATTTACCGAGAAAGCT-CA
Pan              ATCAGATTGTGAATCTGACAACAGAGGCTCA-CGACCCCTTATTTACCGAGAAAGCT-TA
Gorilla          ATCAGATTGTGAATCTGATAACAGAGGCTCA-CAACCCCTTATTTACCGAGAAAGCT-CG
Pongo            ATTAGATTGTGAATCTAATAATAGGGCCCCA-CAACCCCTTATTTACCGAGAAAGCT-CA
Hylobates        ATTAGATTGTGAATCTAACAATAGAGGCTCG-AAACCTCTTGCTTACCGAGAAAGCC-CA
Macaca_fuscata   ACTAGATTGTGAATCTAACCATAGAGACTCA-CCACCTCTTATTTACCGAGAAAACT-CG
M._mulatta       ATTAGATTGTGAATCTAACCATAGAGACTTA-CCACCTCTTATTTACCGAGAAAACT-CG
M._fascicularis  ATTAGATTGTGAATCTAACTATAGAGGCCTA-CCACTTCTTATTTACCGAGAAAACT-CG
M._sylvanus      ATTAGACTGTGAATCTAACTATAGAAGCTTA-CCACTTCTTATTTACCGAGAAAACT-TG
Saimiri_sciureus ATTAGATTGTGAATCTAATAATAGAAGAATA-TAACTTCTTAATTACCGAGAAAGTG-CG
Tarsius_syrichta ATTAGATTGTGAGTCTAATAATAGAAGCCCAAAGATTTCTTATTTACCAAGAAAGTA-TG

Lemur_catta      TATGAACTGCTAACTCTGCACTCCGTATATAAAAATACGGCTATCTCAACTTTTAAAGGA
Homo_sapiens     CAAGAACTGCTAACTCATGCCCCCATGTCTAACAACATGGCTTTCTCAACTTTTAAAGGA
Pan              TAAGAACTGCTAATTCATATCCCCATGCCTGACAACATGGCTTTCTCAACTTTTAAAGGA
Gorilla          TAAGAGCTGCTAACTCATACCCCCGTGCTTGACAACATGGCTTTCTCAACTTTTAAAGGA
Pongo            CAAGAACTGCTAACTCTCACT-CCATGTGTGACAACATGGCTTTCTCAGCTTTTAAAGGA
Hylobates        CAAGAACTGCTAACTCACTATCCCATGTATGACAACATGGCTTTCTCAACTTTTAAAGGA
Macaca_fuscata   CAAGGACTGCTAACCCATGTACCCGTACCTAAAATTACGGTTTTCTCAACTTTTAAAGGA
M._mulatta       CGAGGACTGCTAACCCATGTATCCGTACCTAAAATTACGGTTTTCTCAACTTTTAAAGGA
M._fascicularis  CAAGGACTGCTAATCCATGCCTCCGTACTTAAAACTACGGTTTCCTCAACTTTTAAAGGA
M._sylvanus      CAAGGACCGCTAATCCACACCTCCGTACTTAAAACTACGGTTTTCTCAACTTTTAAAGGA
Saimiri_sciureus CAAGAACTGCTAATTCATGCTCCCAAGACTAACAACTTGGCTTCCTCAACTTTTAAAGGA
Tarsius_syrichta CAAGAACTGCTAACTCATGCCTCCATATATAACAATGTGGCTTTCTT-ACTTTTAAAGGA

Lemur_catta      TAGAAGTAATCCATTGGCCTTAGGAGCCAAAAA-ATTGGTGCAACTCCAAATAAAAGTAA
Homo_sapiens     TAACAGCTATCCATTGGTCTTAGGCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAA
Pan              TAACAGCCATCCGTTGGTCTTAGGCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAA
Gorilla          TAACAGCTATCCATTGGTCTTAGGACCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAA
Pongo            TAACAGCTATCCCTTGGTCTTAGGATCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAA
Hylobates        TAACAGCTATCCATTGGTCTTAGGACCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAA
Macaca_fuscata   TAACAGCTATCCATTGACCTTAGGAGTCAAAAACATTGGTGCAACTCCAAATAAAAGTAA
M._mulatta       TAACAGCTATCCATTGACCTTAGGAGTCAAAAATATTGGTGCAACTCCAAATAAAAGTAA
M._fascicularis  TAACAGCTATCCATTGACCTTAGGAGTCAAAAACATTGGTGCAACTCCAAATAAAAGTAA
M._sylvanus      TAACAGCTATCCATTGGCCTTAGGAGTCAAAAATATTGGTGCAACTCCAAATAAAAGTAA
Saimiri_sciureus TAGTAGTTATCCATTGGTCTTAGGAGCCAAAAACATTGGTGCAACTCCAAATAAAAGTAA
Tarsius_syrichta TAGAAGTAATCCATCGGTCTTAGGAACCGAAAA-ATTGGTGCAACTCCAAATAAAAGTAA

Lemur_catta      TAAATCTATTATCCTCTTTCACCCTTGTCACACTGATTATCCTAACTTTACCTATCATTA
Homo_sapiens     TAACCATGCACACTACTATAACCACCCTAACCCTGACTTCCCTAATTCCCCCCATCCTTA
Pan              TAACCATGTATACTACCATAACCACCTTAACCCTAACTCCCTTAATTCTCCCCATCCTCA
Gorilla          TAACTATGTACGCTACCATAACCACCTTAGCCCTAACTTCCTTAATTCCCCCTATCCTTA
Pongo            CAGCCATGTTTACCACCATAACTGCCCTCACCTTAACTTCCCTAATCCCCCCCATTACCG
Hylobates        TAGCAATGTACACCACCATAGCCATTCTAACGCTAACCTCCCTAATTCCCCCCATTACAG
Macaca_fuscata   TAATCATGCACACCCCCATCATTATAACAACCCTTATCTCCCTAACTCTCCCAATTTTTG
M._mulatta       TAATCATGCACACCCCTATCATAATAACAACCCTTATCTCCCTAACTCTCCCAATTTTTG
M._fascicularis  TAATCATGCACACCCCCATCATAATAACAACCCTCATCTCCCTGACCCTTCCAATTTTTG
M._sylvanus      TAATCATGTATACCCCCATCATAATAACAACTCTCATCTCCCTAACTCTTCCAATTTTCG
Saimiri_sciureus TA---ATACACTTCTCCATCACTCTAATAACACTAATTAGCCTACTAGCGCCAATCCTAG
Tarsius_syrichta TAAATTTATTTTCATCCTCCATTTTACTATCACTTACACTCTTAATTACCCCATTTATTA

Lemur_catta      TAAACGTTACAAACATATACAAAAACTACCCCTATGCACCATACGTAAAATCTTCTATTG
Homo_sapiens     CCACCCTCGTTAACCCTAACAAAAAAAACTCATACCCCCATTATGTAAAATCCATTGTCG
Pan              CCACCCTCATTAACCCTAACAAAAAAAACTCATATCCCCATTATGTGAAATCCATTATCG
Gorilla          CCACCTTCATCAATCCTAACAAAAAAAGCTCATACCCCCATTACGTAAAATCTATCGTCG
Pongo            CTACCCTCATTAACCCCAACAAAAAAAACCCATACCCCCACTATGTAAAAACGGCCATCG
Hylobates        CCACCCTTATTAACCCCAATAAAAAGAACTTATACCCGCACTACGTAAAAATGACCATTG
Macaca_fuscata   CCACCCTCATCAACCCTTACAAAAAACGTCCATACCCAGATTACGTAAAAACAACCGTAA
M._mulatta       CCACCCTCATCAACCCTTACAAAAAACGTCCATACCCAGATTACGTAAAAACAACCGTAA
M._fascicularis  CCACCCTCACCAACCCCTATAAAAAACGTTCATACCCAGACTACGTAAAAACAACCGTAA
M._sylvanus      CTACCCTTATCAACCCCAACAAAAAACACCTATATCCAAACTACGTAAAAACAGCCGTAA
Saimiri_sciureus CTACCCTCATTAACCCTAACAAAAGCACACTATACCCGTACTACGTAAAACTAGCCATCA
Tarsius_syrichta TTACAACAACTAAAAAATATGAAACACATGCATACCCTTACTACGTAAAAAACTCTATCG

Lemur_catta      CATGTGCCTTCATCACTAGCCTCATCCCAACTATATTATTTATCTCCTCAGGACAAGAAA
Homo_sapiens     CATCCACCTTTATTATCAGTCTCTTCCCCACAACAATATTCATGTGCCTAGACCAAGAAG
Pan              CGTCCACCTTTATCATTAGCCTTTTCCCCACAACAATATTCATATGCCTAGACCAAGAAG
Gorilla          CATCCACCTTTATCATCAGCCTCTTCCCCACAACAATATTTCTATGCCTAGACCAAGAAG
Pongo            CATCCGCCTTTACTATCAGCCTTATCCCAACAACAATATTTATCTGCCTAGGACAAGAAA
Hylobates        CCTCTACCTTTATAATCAGCCTATTTCCCACAATAATATTCATGTGCACAGACCAAGAAA
Macaca_fuscata   TATATGCTTTCATCATCAGCCTCCCCTCAACAACTTTATTCATCTTCTCAAACCAAGAAA
M._mulatta       TATATGCTTTCATCATCAGCCTCCCCTCAACAACTTTATTCATCTTCTCAAACCAAGAAA
M._fascicularis  TATATGCTTTTATTACCAGTCTCCCCTCAACAACCCTATTCATCCTCTCAAACCAAGAAA
M._sylvanus      TATATGCTTTCATTACCAGCCTCTCTTCAACAACTTTATATATATTCTTAAACCAAGAAA
Saimiri_sciureus TCTACGCCCTCATTACCAGTACCTTATCTATAATATTCTTTATCCTTACAGGCCAAGAAT
Tarsius_syrichta CCTGCGCATTTATAACAAGCCTAGTCCCAATGCTCATATTTCTATACACAAATCAAGAAA

Lemur_catta      CAATCATTTCCAACTGACATTGAATAACAATCCAAACCCTAAAACTATCTATTAGCTT
Homo_sapiens     TTATTATCTCGAACTGACACTGAGCCACAACCCAAACAACCCAGCTCTCCCTAAGCTT
Pan              CTATTATCTCAAACTGGCACTGAGCAACAACCCAAACAACCCAGCTCTCCCTAAGCTT
Gorilla          CTATTATCTCAAGCTGACACTGAGCAACAACCCAAACAATTCAACTCTCCCTAAGCTT
Pongo            CCATCGTCACAAACTGATGCTGAACAACCACCCAGACACTACAACTCTCACTAAGCTT
Hylobates        CCATTATTTCAAACTGACACTGAACTGCAACCCAAACGCTAGAACTCTCCCTAAGCTT
Macaca_fuscata   CAACCATTTGGAGCTGACATTGAATAATGACCCAAACACTAGACCTAACGCTAAGCTT
M._mulatta       CAACCATTTGAAGCTGACATTGAATAATAACCCAAACACTAGACCTAACACTAAGCTT
M._fascicularis  CAACCATTTGGAGTTGACATTGAATAACAACCCAAACATTAGACCTAACACTAAGCTT
M._sylvanus      CAATCATCTGAAGCTGGCACTGAATAATAACCCAAACACTAAGCCTAACATTAAGCTT
Saimiri_sciureus CAATAATTTCAAACTGACACTGAATAACTATCCAAACCATCAAACTATCCCTAAGCTT
Tarsius_syrichta TAATCATTTCCAACTGACATTGAATAACGATTCATACTATCAAATTATGCCTAAGCTT
    ;
end;

begin assumptions;
    charset coding = 2-457 660-896;
    charset noncoding = 1 458-659 897-898;
    charset 1stpos = 2-457\3 660-896\3;
    charset 2ndpos = 3-457\3 661-896\3;
    charset 3rdpos = 4-457\3 662-.\3;
    
    exset coding = noncoding;
    exset noncoding = coding;
    
    usertype 2_1 = 4        [weights transversions 2 times transitions]
        a  c  g  t
    [a]    .  2  1  2
    [c] 2  .  2  1
    [g]    1  2  .  2
    [t]    2  1  2  .
        ;
    usertype 3_1 = 4        [weights transversions 3 times transitions]
        a  c  g  t
    [a]    .  3  1  3
    [c] 3  .  3  1
    [g]    1  3  .  3
    [t]    3  1  3  .
        ;
        
    taxset hominoids = Homo_sapiens Pan Gorilla Pongo Hylobates;
end;

begin paup;
    constraints ch = ((Homo_sapiens,Pan));
    constraints chg = ((Homo_sapiens,Pan,Gorilla));
end;