|
matK primers that work in Pinus
|
||||
| Primer name | sequence 5prime to 3prime | length | Position in Pinus thunbergii | Reference |
| trnKF1 | tactgatcagaagttaagagc | 21 | 3604-3624 | Wang et al. 2000 |
| orf515-900F | tacgcaatttctcatgatca | 20 | 3178-3159 | Gadek et al. 2000 |
| GYM480F | catccrgaaattttggttc | 19 | 2779 | Hilu et al. 2003 |
| matK2R | taaacgatcctctcattcacga | 22 | 2588-2567 | Wang et al. 1999 |
| matK2496R | ttttcagtgaatttcgacgag | 21 | 2476-2496 | Gernandt et al. 2003 |
| matK1R | gagaaatctttttcattactacagtg | 22 | 2017 | Wang et al. 1999 |
| orf505-2000F | tcaggrcggccaattagtaa | 26 | 2119-2100 | Gadek et al. 2000 |
| matK2F | cgtacttttatgtttacaggctaa | 24 | 1928 | Wang et al. 1999 |
| matK1F | gaactcgtcggatggagtg | 19 | 1530-1548 | Wang et al. 1999 |
| trnK2R | aactagtcggatggagtag | 19 | 1531-1549 | Johnson & Soltis 1995 |
|
A word of caution: matK is coded on the antisense strand, and unfortunately we have not been careful about specifying "Forward" and "Reverse" primers. More specifically, Wang et al. (1999) use "F" and "R" to refer to the positive strand, while Gadek et al. (2000) and Gernandt et al. (2003) referred to the matK open reading frame. |
||||
| We typically amplified matK in two separate reactions 1) 900F & 2496R and 2) matK1R & matK2F. | ||||
| The matK900F & 2496 product is about 700 bp (including the primer sites) and easily sequenced with the two PCR primers. Recently we changed to amplifying and sequencing with trnKF1 and matK2496 (product size is about 1150 bp). The matK1R & matK2F product is about 1059 bp (including the primer sites), and for better results can be sequenced with matK1R, matK2R, matK1F & matK2F. GYM480F has also been useful in other conifers. In contrast, the trnK2R primer has a mismatch at the 3 prime end with Pinus and Cryptomeria. | ||||
REFERENCES
Gernandt, D.S., Liston, A. and D. Pinero. 2003. Phylogenetics of Pinus subsections Cembroides and Nelsoniae inferred from cpDNA sequences. Systematic Botany. 28: 657-673.
Johnson, L.A. and D.E. Soltis. 1995. Phylogenetic inference in Saxifragaceae sensu stricto and Gilia (Polemoniaceae) using matK sequences. Annals of the Missouri Botanical Garden 82:149-175.
Gadek, P.A., Alpers, D.L., Heslewood, M.M. and C. J. Quinn. 2000. Relationships within Cupressaceae sensu lato: a combined morphological and molecular approach. American Journal of Botany 87:1044-1057.
Hilu, K.W., Borsch, T., Muller, K. et al. 2003. Angiosperm phylogeny based on matK sequence information. American Journal of Botany 90:1758-1776.
Wang, X.-Q., Tank, D.C. and T. Sang. 2000. Phylogeny and divergence times in Pinaceae: evidence from three genomes. Molecular Biology and Evolution 17:773-781.
Wang, X.-R., Tsumura, Y., Yoshimaru, H., Nagasaka, K. and A.E. Szmidt. 1999. Phylogenetic relationships of Eurasian pines (Pinus, Pinaceae) based on chloroplast rbcL, matK, rpl20-rps18 spacer, and trnV intron sequences. American Journal of Botany 86:1742-1753.